Ст 930 п 3 гк рф: ГК РФ Статья 930. Страхование имущества / КонсультантПлюс

Содержание

Статья 930 ГК РФ с комментариями - Страхование имущества

1. Имущество может быть застраховано по договору страхования в пользу лица (страхователя или выгодоприобретателя), имеющего основанный на законе, ином правовом акте или договоре интерес в сохранении этого имущества.

2. Договор страхования имущества, заключенный при отсутствии у страхователя или выгодоприобретателя интереса в сохранении застрахованного имущества, недействителен.

3. Договор страхования имущества в пользу выгодоприобретателя может быть заключен без указания имени или наименования выгодоприобретателя (страхование "за счет кого следует").

При заключении такого договора страхователю выдается страховой полис на предъявителя. При осуществлении страхователем или выгодоприобретателем прав по такому договору необходимо представление этого полиса страховщику.

Комментарий к статье 930 Гражданского Кодекса РФ

1. При страховании имущества страховыми случаями выступают утрата (гибель), недостача или повреждение имущества (подп. 1 п. 2 ст. 929 ГК). Основным объектом страхования здесь являются вещи, хотя возможно и страхование иных видов имущества, способных к уничтожению, похищению или повреждению (например, программ для ЭВМ).

2. Договор страхования предполагает наличие у страхователя или выгодоприобретателя основанного на законе, ином правовом акте или договоре интереса в сохранении этого имущества. Нередко суды подчеркивают, что в соответствии с подп. 1 п. 2 ст. 929 и п. 1 ст. 930 ГК страхователем (выгодоприобретателем) по договору страхования имущества может быть не любое лицо, заинтересованное в сохранении имущества, а лишь тот, кто несет риск утраты или повреждения застрахованного имущества (см., например, Постановление ФАС Московского округа от 29 ноября 2006 г. N КГ-А40/11323-06).

Таким интересом, прежде всего, обладает собственник вещи. Как указано в п. 3 письма ВАС N 75, "собственник как лицо, обладающее наиболее полным абсолютным правом на принадлежащее ему имущество, всегда имеет основанный на законе интерес в его сохранении. Интерес в сохранении имущества имеется у его собственника и тогда, когда по условиям договора аренды обязанность по ремонту поврежденного имущества возлагается на арендатора". Ущерб, который причинен имущественной сфере собственника страховым случаем, подлежит возмещению страховщиком. Страховые убытки собственника состоят в возмещении стоимости погибшей вещи или стоимости ее ремонта. Таким образом, собственнику возмещается реальный ущерб, но не упущенная выгода (на это косвенно указывает и п. 2 ст. 947 ГК). Возмещение упущенной выгоды осуществляется по договору о страховании предпринимательского риска (ст. 933 ГК). Юридические препятствия для оформления двух этих видов страхования одним документом отсутствуют.

Арендатор также признается лицом, заинтересованным в сохранении арендуемого им имущества, что обусловливает возможность страхования в его пользу этого имущества (см., например, Постановление Президиума ВАС от 21 апреля 1998 г. N 1540/98; Постановление ФАС Уральского округа от 5 февраля 2003 г. N Ф09-101/03-ГК). Заинтересованность арендатора в страховании арендуемой вещи проявляется в том, что с гибелью или повреждением вещи арендатор лишится возможности владеть и пользоваться ею, а также в том, что он не сможет вернуть эту вещь арендодателю. Опасность наступления этих обстоятельств может быть застрахована при условии, что они относятся к риску арендатора. Так, если арендатор отвечает за случайную гибель или повреждение вещи (п. 3 ст. 401 ГК), то у него имеется интерес в страховании этой вещи. Повреждение вещи в результате пожара лишает арендатора возможности использовать эту вещь, а потому он вправе требовать страхового возмещения на ремонт этой вещи.

Страховой интерес имеется у арендатора и тогда, когда обязанность к страхованию не предусмотрена договором аренды. Если сданное в аренду имущество застраховано и арендатором, и арендодателем, то наступление страхового случая по обоим договорам страхования не должно приводить к неосновательному обогащению собственника имущества (при получении возмещения стоимости имущества от арендатора он обязан вернуть полученную им излишнюю сумму страхового возмещения своему страховщику на основании ст. 1102 ГК).

Ссудополучатель может застраховать имущество, находящееся в его безвозмездном пользовании. Его интерес обусловлен потребностью в пользовании имуществом и необходимостью возврата этого имущества ссудодателю в соответствии с п. 1 ст. 689 ГК (п. 4 письма ВАС N 75).

Страхование имущества, служащего предметом сделки, предусмотрено законом также для залогодателя и залогодержателя (подп. 1 п. 1 ст. 343 ГК), продавца и покупателя (ст. 490 ГК), заказчика и подрядчика по договору строительного подряда (ст. 742 ГК), ломбарда (п. 3 ст. 358, п. 4 ст. 919 ГК) и т.д.

3. В силу п. 2 коммент. ст. договор страхования имущества, заключенный при отсутствии у страхователя или выгодоприобретателя страхового интереса, является ничтожным. Бремя доказывания отсутствия интереса лежит на лице, заявившем требование о признании договора ничтожным (п. 2 письма ВАС N 75). Страховщик может проверить наличие страхового интереса при заключении договора страхования или довериться сведениям, сообщенным страхователем.

Страховой интерес может существовать у страхователя или выгодоприобретателя на момент заключения договора, но затем отпасть (например, арендатор застраховал арендованную вещь в свою пользу, но до повреждения вещи возвратил ее арендодателю). Поэтому страховщик проверяет наличие страхового интереса также перед страховой выплатой. Отсутствие интереса служит поводом к отказу в страховом возмещении на основании ст. 929 ГК (если страховой случай еще может наступить) или ст. 958 ГК (если страховой случай уже наступить не может). Отпадение страхового интереса не влечет превращения договора страхования в ничтожную сделку, поскольку в момент заключения договора он соответствовал законодательству.

4. Буквальное толкование п. 2 коммент. ст. приводит некоторых авторов к выводу, что договор страхования, заключенный при отсутствии страхового интереса, всегда является ничтожным; приобретение страхователем или выгодоприобретателем страхового интереса впоследствии "не излечивает договора" (см.: Комментарий к Гражданскому кодексу Российской Федерации, части второй (постатейный) / Под ред. А.П. Сергеева и Ю.К. Толстого. М., 2003. С. 705 (автор комментария - А.А. Иванов)). Согласиться с этим мнением нельзя. Пункт 2 коммент. ст. нуждается в ограничительном толковании. Если к моменту наступления страхового случая у страхователя (выгодоприобретателя) имеется страховой интерес, то, несмотря на отсутствие этого интереса в момент заключения договора, страховое возмещение подлежит уплате страховщиком. Иначе говоря, объектом страхования может быть и будущий страховой интерес. В практике страхования это случается довольно часто, когда страхуется имущество, еще только приобретаемое страхователем.

5. Закон обходит молчанием вопрос о судьбе договора страхования, если выгодоприобретатель не имеет страхового интереса, а страхователь имеет. Представляется, что договор страхования в части назначения выгодоприобретателя, не имеющего страхового интереса, ничтожен (п. 2 ст. 930). Но в остальной части этот договор является действительным (ст. 180 ГК).

6. Предусмотренное п. 3 коммент. ст. страхование "за счет кого следует" сопровождается выдачей страхователю страхового полиса на предъявителя. О правовой природе страхового полиса см. коммент. к ст. 940 ГК. Потребность в таком виде страхования существует тогда, когда застрахованный товар активно используется в гражданском обороте. Смысл этого вида страхования состоит в том, что при отчуждении застрахованного товара нет необходимости извещать страховщика о переходе права на застрахованное имущество (ср. со ст. 960 ГК) и о замене выгодоприобретателя (ср. со ст. 956 ГК).

Предъявляя страховой полис страховщику, выгодоприобретатель легитимирует себя в качестве кредитора по обязательству о страховой выплате. Кроме того выгодоприобретатель должен доказать наступление страхового случая и свой страховой интерес (например, факт приобретения им в собственность застрахованного имущества).

Ст. 930 ГК РФ с Комментариями 2020-2021 года (новая редакция с последними изменениями)

1. Имущество может быть застраховано по договору страхования в пользу лица (страхователя или выгодоприобретателя), имеющего основанный на законе, ином правовом акте или договоре интерес в сохранении этого имущества.

2. Договор страхования имущества, заключенный при отсутствии у страхователя или выгодоприобретателя интереса в сохранении застрахованного имущества, недействителен.

3. Договор страхования имущества в пользу выгодоприобретателя может быть заключен без указания имени или наименования выгодоприобретателя (страхование «за счет кого следует»).

При заключении такого договора страхователю выдается страховой полис на предъявителя. При осуществлении страхователем или выгодоприобретателем прав по такому договору необходимо представление этого полиса страховщику.

Комментарий к Ст. 930 ГК РФ

1. В комментируемой статье установлены основные правила, касающиеся договора страхования имущества. Содержащаяся в п. 2 ст. 929 ГК РФ отсылка к комментируемой статье свидетельствует, что указанный договор является разновидностью договора имущественного страхования. Соответственно, он подпадает под общее определение указанного договора по п. 1 ст. 929 ГК РФ. Из этого усматривается смысл данного договора с позиции страхователя (выгодоприобретателя) — при наступлении страхового случая получить в оговоренных договором пределах возмещение причиненных вследствие этого случая убытков в застрахованном имуществе.

Имуществом, которое может быть застраховано по договору страхования имущества, выступают прежде всего вещи. Отнесение к такому имуществу иных объектов гражданских прав, составляющих понятие имущества с точки зрения ст. 128 ГК РФ (деньги и др.), весьма спорно. Однако стоит согласиться с тем утверждением, что допустимо страхование таких видов имущества, которые в принципе (исходя из их природы) могут быть уничтожены, похищены или повреждены , например животных .

———————————
См. п. 1 комментария к ст. 930 ГК РФ в кн.: Абрамова Е.Н., Аверченко Н.Н., Арсланов К.М. и др. Комментарии к Гражданскому кодексу Российской Федерации. Часть вторая: Учебно-практический комментарий / Под ред. А.П. Сергеева. М.: Проспект, 2010 // СПС «Гарант» (автор комментария к гл. 48 — В.В. Грачев). Здесь в качестве примера такого имущества названы программы для ЭВМ.

См., например, Постановление ФАС Поволжского округа от 28 июля 2010 г. по делу N А06-6459/2009 // СПС «Гарант».

2. В п. 1 комментируемой статьи определено лицо, в пользу которого заключается договор страхования имущества. Подобный договор заключается либо в пользу самого страхователя, либо в пользу иного лица — выгодоприобретателя. В любом случае указанное лицо должно иметь интерес в сохранении этого имущества. Речь идет об интересе, который (1) является имущественным, (2) должен отвечать требованиям ст. 928 ГК РФ, т.е. не должен относиться к числу тех интересов, страхование которых в силу закона не допускается. Вместе с тем с точки зрения сложившейся судебно-арбитражной практики интерес собственника в сохранении имущества не может считаться противоправным исключительно на основании того, что застрахованное имущество в момент заключения договора страхования находилось на территории России с нарушением таможенных правил (п. 5 Обзора практики по страхованию). Думается, что этот вывод имеет и более общее значение — он должен касаться всех ситуаций, когда собственник (иной законный владелец) допускает в отношении застрахованного имущества нарушение установленных публичным правом предписаний.

Названный интерес следует понимать с учетом п. 2 ст. 929 ГК РФ, а также с учетом разъяснения, данного на примере интереса ссудополучателя в п. 4 Обзора практики по страхованию. Таким образом, рассматриваемый интерес представляет собой потребность лица в сохранении (сбережении) непосредственно для себя определенного (конкретно установленного) имущества от утраты (гибели), недостачи или повреждения. К подобным негативным имущественным последствиям могут привести различные обстоятельства, например хищение застрахованного груза путем разбойного нападения .

———————————
Пункт 6 Обзора ФАС Северо-Кавказского округа от 3 декабря 2010 г. «Обобщение практики рассмотрения споров по страхованию и хранению».

Согласно п. 1 комментируемой статьи означенный имущественный интерес должен основываться на законе, ином правовом акте (указе Президента РФ или постановлении Правительства РФ — см. п. 6 ст. 3 Гражданского кодекса РФ) или на договоре. С учетом отмеченного договор страхования имущества может быть заключен прежде всего в пользу собственника имущества. Причем, как отмечено в п. 3 Обзора практики по страхованию, интерес в сохранении имущества имеется у его собственника и тогда, когда обязанность нести расходы по замене утраченного или восстановлению поврежденного имущества возлагается на другое лицо. Также такой договор может быть совершен в пользу ссудополучателя по договору ссуды (п. 4 Обзора практики по страхованию), арендатора , заказчика или подрядчика по договору строительного подряда (ст. 742 ГК) и пр.

———————————
Однако статус арендатора как страхователя или выгодоприобретателя, т.е. наличие или отсутствие у него страхового интереса, зависит от содержания договора аренды. Соответственно, если из этого содержания страховой интерес не усматривается, то нет оснований и для страховой выплаты. См., например, Постановление ФАС Северо-Западного округа от 22 сентября 2010 г. по делу N А56-49204/2008 // СПС «Гарант».

3. Правило п. 1 комментируемой статьи о необходимости наличия у лица, в пользу которого заключен договор страхования, особого интереса подкрепляется содержанием п. 2 этой же статьи. Здесь установлено правовое последствие совершения договора страхования имущества при отсутствии у страхователя или выгодоприобретателя интереса в сохранении застрахованного имущества. Данный договор считается недействительным. В таком случае к этому договору применяется положение ст. 168 ГК РФ — сделка является ничтожной как не соответствующая закону . Если же между сторонами возникает спор о действительности договора страхования имущества в связи с отсутствием интереса у лица, в пользу которого заключен договор, обязанность доказывать отсутствие интереса лежит на лице, предъявившем соответствующее требование о признании договора недействительным (п. 2 Обзора практики по страхованию).

———————————

КонсультантПлюс: примечание.

Комментарий к Гражданскому кодексу Российской Федерации (учебно-практический). Части первая, вторая, третья, четвертая (под ред. С.А. Степанова) включен в информационный банк согласно публикации — Проспект, Институт частного права, 2009 (2-е издание, переработанное и дополненное).

Бесплатная юридическая консультация по телефонам:

В юридической литературе в отношении этой ничтожности считается дискуссионным следующий вопрос: имеет ли место ничтожность уже в момент заключения договора страхования имущества при отсутствии названного интереса, что отвечает буквальному смыслу п. 2 комментируемой статьи, или же данная норма подлежит ограничительному толкованию — на момент наступления страхового случая страховой интерес был, значит, договор действителен и подлежит исполнению? Об этом см. п. 4 комментария к ст. 930 ГК РФ в кн.: Комментарии к Гражданскому кодексу Российской Федерации. Часть вторая: Учебно-практический комментарий / Под ред. А.П. Сергеева; п. 2 комментария к ст. 930 ГК РФ в кн.: Алексеев С.С., Васильев А.С., Голофаев В.В., Гонгало Б.М. Комментарий к Гражданскому кодексу Российской Федерации (учебно-практический). Части первая, вторая, третья, четвертая / Под ред. С.А. Степанова. 2-е изд., перераб. и доп. М.: Проспект; Екатеринбург: Институт частного права, 2010. Конечно, здесь остается открытым вопрос о том, почему подобное ограничительное толкование нужно связывать именно с моментом наступления страхового случая, а не, скажем, с моментом осуществления страховой выплаты. Представляется, что в любом случае такое ограничительное толкование необходимо применять при страховании «за счет кого следует» (п. 3 комментируемой статьи).

В судебно-арбитражной практике рассмотренное правило п. 2 комментируемой статьи применяется, например, тогда, когда у страхователя или выгодоприобретателя нет права собственности на застрахованное имущество .

———————————
См., например, п. 15 Обзора ФАС Северо-Кавказского округа от 3 декабря 2010 г.

4. В п. 3 комментируемой статьи определены специальные правила об одной из разновидностей договора страхования имущества. Согласно данной норме производится так называемое страхование «за счет кого следует». В этом случае договор страхования имущества (1) совершается в пользу выгодоприобретателя, (2) заключается без указания имени (ст. 19 ГК) или наименования (ст. 54 ГК) выгодоприобретателя, (3) оформляется путем выдачи страхователю страхового полиса на предъявителя. Причем значение этого документа не только удостоверительное (подтверждает факт заключения договора страхования). Наряду с этим страховой полис на предъявителя необходим на стадии осуществления прав, следующих из договора страхования: при осуществлении данных прав страхователем или выгодоприобретателем он должен предъявляться страховщику. Такое предъявление не является единственной удостоверительной процедурой. В целях осуществления своих прав (получения страхового возмещения) страхователь или выгодоприобретатель должны традиционно подтвердить и факт наступления страхового случая, и факт наличия соответствующего страхового интереса (статус собственника и пр.).

5. Одним из спорных вопросов в области имущественного страхования, в том числе и страхования имущества физических лиц (непредпринимателей), является вопрос о применении к этим отношениям Закона о защите прав потребителей. Учитывая, что слабой стороной в страховых отношениях выступает, как принято считать, страхователь, одной из главнейших задач законодателя в области правового регулирования названных отношений, а также в рамках правоприменительной практики по страховым делам являются, соответственно, организация и реальное осуществление повышенной правовой защиты именно страхователя. Тем не менее в последнее время совершенно очевидной тенденцией стало снижение уровня указанной защиты для ситуаций, когда в роли страхователей выступают обычные физические лица (не индивидуальные предприниматели).

Такая тенденция в значительной степени обусловлена позицией Верховного Суда РФ в вопросе о том, применяется ли Закон о защите прав потребителей к правоотношениям, вытекающим из договоров имущественного страхования . Ее суть сводится к тому, что названный Закон регламентирует отношения, связанные с защитой прав потребителей товаров, работ и услуг, а в случае с имущественным страхованием страхователь (физическое лицо) не является указанным субъектом (потребителем услуг). Это, в свою очередь, обусловлено тем, что, очевидно, по мнению Верховного Суда РФ, имущественное страхование не относится к услугам. По крайней мере напрашивается такой вывод. Получается, что в правоотношениях по имущественному страхованию нет оказания услуг, отсюда — нет такого субъекта, как потребитель услуг, а следовательно, нет и применения Закона о защите прав потребителей.

———————————
См. вопрос 2 и ответ на него в разделе «Ответы на вопросы» Обзора законодательства и судебной практики Верховного Суда РФ за I квартал 2008 г., утв. Постановлением Президиума Верховного Суда РФ от 28 мая 2008 г. // СПС «Гарант». По сведениям СПС «Гарант», данный акт официально не опубликован.

Думается, что подобная позиция не должна быть взята за основу существующей судебной практики по спорам между страхователями (физическими лицами) и страховыми организациями. Это подтверждается следующими аргументами.

Во-первых, сначала ответим на вопрос: является ли имущественное страхование областью оказания услуг? Общее определение услуги в ГК РФ, как известно, содержится в п. 1 ст. 779: это совершение определенных действий или осуществление определенной деятельности. Хотя формально сфера действия нормы, содержащей данное определение, ограничена, о чем свидетельствует содержание п. 2 ст. 779 ГК РФ, представляется, что указанная дефиниция в силу ее универсального характера может быть использована для определения практически всех услуг — подпадающих и не подпадающих под действие договора возмездного оказания услуг, т.е. под действие правила гл. 39 ГК РФ о возмездном оказании услуг.

Соответственно, встает вопрос: можно ли считать имущественным страхованием совершение страховщиком определенных действий или осуществление определенной деятельности? Представляется, что на данный вопрос нужно дать положительный ответ. Действительно, предоставляя в рамках имущественного страхования страховую защиту, страховщик выполняет в пользу страхователей конкретные действия: формирует и в установленных пределах управляет специальными денежными фондами, принимает на себя на определенное договором страхования время имущественные риски страхователя (имущественную ответственность перед другими лицами либо возникновение убытков), при наступлении страхового случая осуществляет в рамках специальной юридической процедуры выплату страхового возмещения. Таким образом, имущественное страхование нужно оценивать в качестве деятельности по организации и осуществлению страховой защиты страхователя от указанных имущественных рисков. Другими словами, имущественное страхование есть страховая услуга. А если это услуга, то физическое лицо, которому она оказывается, нужно именовать потребителем услуги. Поэтому в том случае, если физическое лицо обладает всеми правовыми признаками потребителя, указанными в преамбуле Закона о защите прав потребителей (данное лицо заказывает конкретную услугу для непредпринимательских нужд и др.), нужно распространять на отношения с его участием действие названного Закона.

Характеристика страхования как особой сферы оказания услуг находит свое подтверждение в действующем законодательстве. При этом в ряде нормативных правовых актов прямо использован термин «страховая услуга». Приведем несколько примеров: в ст. 28 Федерального закона от 13 марта 2006 г. N 38-ФЗ «О рекламе» устанавливаются специальные требования к рекламе финансовых услуг, в числе которых названы и страховые услуги. В ст. 4 Федерального закона от 26 июля 2006 г. N 135-ФЗ «О защите конкуренции» сформулирован аналогичный подход: страховая услуга отнесена к разряду финансовых услуг.

———————————
Собрание законодательства РФ. 2006. N 12. Ст. 1232.

Собрание законодательства РФ. 2006. N 31 (ч. I). Ст. 3434.

В центральном акте отечественного законодательства о налогах и сборах — Налоговом кодексе — законодатель исходит из представления о страховании как о деятельности в области оказания услуг. В соответствии с п. 3 статьи 149 НК РФ не подлежит обложению налогом на добавленную стоимость (освобождается от налогообложения) на территории РФ оказание услуг по страхованию, сострахованию и перестрахованию страховыми организациями, а также оказание услуг по негосударственному пенсионному обеспечению негосударственными пенсионными фондами.

Аналогичный подход к страхованию как особого рода услугам имеет место и в ряде федеральных подзаконных актов. Так, например, отмеченный подход, формально выраженный в использовании термина «страховая услуга», применен в Концепции развития страхования в Российской Федерации, одобренной распоряжением Правительства РФ от 25 сентября 2002 г. N 1361-р , в п. 2.4 Общих требований к бизнес-инкубатору и порядку предоставления помещений и оказанию услуг субъектам малого предпринимательства в бизнес-инкубаторе .

———————————
Собрание законодательства РФ. 2002. N 39. Ст. 3852.

Приложение N 5 к Приказу Минэкономразвития России от 25 апреля 2008 г. N 119 «О мерах по реализации в 2008 году мероприятий по государственной поддержке малого предпринимательства» // СПС «Гарант».

Кроме актов российского законодательства использование термина «страховая услуга» можно встретить в отдельных международно-правовых актах. Например, в п. 69 Международной стратегии развития на третье десятилетие развития Организации Объединенных Наций, принятой Резолюцией Генеральной Ассамблеи ООН от 5 декабря 1980 г. N 35/56 , в ряде двусторонних соглашений, подписанных Россией .

———————————
СПС «Гарант».

См., например: Договор между Российской Федерацией и Азербайджанской Республикой о долгосрочном экономическом сотрудничестве на период до 2010 года (Москва, 25 января 2002 г.) // Бюллетень международных договоров. 2004. N 1; Договор между Российской Федерацией и Республикой Армения о долгосрочном экономическом сотрудничестве на период до 2010 года (Ереван, 15 сентября 2001 г.) // Бюллетень международных договоров. 2005. N 10.

Наряду с действующим отечественным законодательством, международно-правовыми актами и в нашей судебной практике также часто исходят из понимания сферы страхования как специальной области оказания услуг. По существу, знак равенства между имущественным страхованием и услугами поставлен в п. 3.3 Постановления Конституционного Суда РФ от 31 мая 2005 г. N 6-П «По делу о проверке конституционности Федерального закона «Об обязательном страховании гражданской ответственности владельцев транспортных средств» в связи с запросами Государственного Собрания — Эл Курултай Республики Алтай, Волгоградской областной Думы, группы депутатов Государственной Думы и жалобой гражданина С.Н. Шевцова» , в котором указано: «Исходя из того что договор обязательного страхования гражданской ответственности является институтом частного права, а участниками страхового правоотношения — независимые, имущественно самостоятельные, равноправные субъекты, страховая премия, представляющая собой плату за оказание страховщиком — организацией, занимающейся предпринимательской деятельностью, услуги (страхование), т.е. эквивалентную, возмездно-индивидуальную цену договора, имеет, вопреки мнению заявителей, гражданско-правовую, а не налоговую природу».

———————————
Вестник Конституционного Суда РФ. 2005. N 4.

Не только в практике Конституционного Суда РФ, но и в соответствующей судебно-арбитражной практике употребляется (и довольно часто) термин «страховая услуга» . Вместе с тем в опубликованных материалах практики судов общей юрисдикции использование данного термина не обнаруживается.

———————————
См., например, Постановления: ФАС Северо-Кавказского округа от 21 февраля 2008 г. N Ф08-520/08, ФАС Центрального округа от 3 июля 2008 г. N А64-5709/07-8 // СПС «Гарант».

Исследуемая категория «страховая услуга», кроме различных нормативных правовых актов разной отраслевой принадлежности и судебной практики, используется в научной и практической литературе, в том числе в той, которая представлена в СПС «Гарант» . Например, профессор Л.В. Санникова отмечает, что с экономических позиций страховая деятельность причисляется к отношениям по оказанию услуг, в связи с чем в действующем законодательстве о страховании используется термин «страховые услуги». Однако, по ее мнению, поскольку объектом страхового обязательства господствующая доктрина признает страховой интерес, а не услуги, то нет оснований относить страховое обязательство к обязательствам по оказанию услуг .

———————————
См., например: Майфат А.В. Гражданско-правовые конструкции инвестирования. М.: Волтерс Клувер, 2006; Комментарий (постатейный) к главам 21 «Налог на добавленную стоимость» и 22 «Акцизы» Налогового кодекса Российской Федерации / Под ред. Н.С. Чамкиной. М.: ООО «Статус-Кво 97″, 2007; Шишкин С.Н. Государственное регулирование экономики: предпринимательско-правовой аспект. М.: Волтерс Клувер, 2007; и др.

Санникова Л.В. Услуги в гражданском праве России. М.: Волтерс Клувер, 2006.

Думается, что указанная позиция нуждается в некотором уточнении. Действительно, страховой интерес ярко выражен в страховом обязательстве, с помощью которого данный интерес, собственно говоря, и удовлетворяется. Тем не менее непосредственным объектом страхового обязательства выступает не сам интерес. Полагаем, что страховое правоотношение, возникающее из договора имущественного страхования, имеет организационный характер. Его объектом выступает юридическая процедура получения (выплаты) денежных средств. Юридическая процедура, в свою очередь, в традиционном ее понимании представляет установленную правом последовательность определенных действий. Для страхования это действия по организации страховой защиты и выплате, в соответствующих случаях, в рамках установленной процедуры страхового возмещения. Таким образом, следует исходить из того, что в рамках страхового обязательства страховщик оказывает страхователю услуги особого рода — страховые услуги.

Все изложенное позволяет сформулировать два вывода: 1) на поставленный выше вопрос нужно дать положительный ответ: да, имущественное страхование является областью оказания услуг; 2) страховая услуга с терминологических позиций представляет собой межотраслевую правовую категорию, используемую не только в области действия гражданского права, но и в других правовых областях, в частности в законодательстве о налогах и сборах. Конечно, основа представления о страховых услугах, несомненно, гражданско-правовая. Это обстоятельство подтверждает тезис о межотраслевом значении ряда гражданско-правовых терминов (например, «предпринимательская деятельность», «юридическое лицо» и др.).

Во-вторых, нужно дать оценку возможным правовым последствиям реализации рассматриваемой позиции Верховного Суда РФ в отношении имущественного страхования. Одним из таких последствий является распространение анализируемого подхода на область страхования в целом, т.е. не только на имущественное, но и на личное страхование. Другим последствием выступает изменение судебной практики.

В-третьих, приведенная позиция Верховного Суда РФ выступила в качестве нового направления судебной практики судов общей юрисдикции. Причем в данном случае судебная практика меняется не в пользу страхователей — физических лиц, что характеризует ее известную нестабильность. До появления такой позиции судебная практика в области защиты прав потребителей-страхователей формировалась в основном с учетом разъяснений, данных федеральным антимонопольным органом в 1996 г. . Суть этих разъяснений сводится к тому, что к страховым отношениям законодательство о защите прав потребителей применяется, но ограниченно. В частности, к ним не применяется гл. 3 Закона о защите прав потребителей, где содержится известное правило о взыскании 3% неустойки. Иными словами, данная неустойка неприменима к отношениям из договора страхования.

———————————
См. п. 14 разъяснений ГКАП РФ по отдельным вопросам применения Закона Российской Федерации «О защите прав потребителей» в редакции Федерального закона от 9 января 1996 года // СПС «Гарант». По сведениям СПС «Гарант», данный акт официально не опубликован. Согласно действующей в период принятия указанного акта редакции ст. 40 Закона о защите прав потребителей указанный орган был вправе давать официальные разъяснения по вопросам применения законов и иных правовых актов РФ, регулирующих отношения в области защиты прав потребителей. Вместе с тем правовая природа данных и иных подобных разъяснений, механизм их применения в судебной практике до конца неясны.

Представляется верным сохранить отмеченную прежнюю судебную практику по спорам между страховыми организациями и физическими лицами — страхователями, поскольку в ней был заложен сбалансированный подход к соблюдению интересов страхователей и страховщиков, а также к соблюдению довольно жестких (императивных) предписаний законодательства о защите прав потребителей и законодательства о страховании. Полагаем, что будет правильно, если вопрос о применении законодательства о защите прав потребителей к отношениям по страхованию, а также к иным спорным ситуациям будет решен на уровне федерального закона.

Ст. 930 ГК РФ. Страхование имущества

1. Имущество может быть застраховано по договору страхования в пользу лица (страхователя или выгодоприобретателя), имеющего основанный на законе, ином правовом акте или договоре интерес в сохранении этого имущества.

2. Договор страхования имущества, заключенный при отсутствии у страхователя или выгодоприобретателя интереса в сохранении застрахованного имущества, недействителен.

3. Договор страхования имущества в пользу выгодоприобретателя может быть заключен без указания имени или наименования выгодоприобретателя (страхование "за счет кого следует").

При заключении такого договора страхователю выдается страховой полис на предъявителя. При осуществлении страхователем или выгодоприобретателем прав по такому договору необходимо представление этого полиса страховщику.

См. все связанные документы >>>

1. Страхование имущества является разновидностью имущественного страхования. Предметом данного договора может быть любое имущество, включая имущественные права. Однако возможность страхования денег, в силу их повышенной оборотоспособности, вызывает большие сомнения.

Договор страхования имущества может быть заключен как в пользу самого страхователя, так и в пользу третьего лица (выгодоприобретателя).

Договор страхования имущества является действительным только при наличии у страхователя (выгодоприобретателя) интереса в сохранности застрахованного имущества. Согласно п. 4 информационного письма Президиума ВАС РФ от 28.11.2003 N 75 интерес представляет собой потребность лица в сохранении (сбережении) непосредственно для себя определенного (конкретно установленного) имущества от утраты (гибели), недостачи или повреждения.

Интерес в сохранности застрахованного имущества должен основываться на законе, ином правовом акте или договоре.

2. В качестве выгодоприобретателя по договору страхования имущества может выступать любое лицо, имеющее интерес в сохранении имущества. При этом данное лицо может быть как поименованным в договоре, так и не поименованным. Как правило, отсутствие указания определенного выгодоприобретателя объясняется целью повышения оборотоспособности застрахованного имущества. Например, при морской перевозке товар за время пути может неоднократно поменять собственника. Соответственно, право на страховое возмещение будет иметь последний на момент страхового события собственник груза.

В подобных случаях в подтверждение факта заключения договора страхования выдается страховой полис на предъявителя. Передача права по страховому ордеру на предъявителя осуществляется путем простого вручения уполномоченному лицу (выгодоприобретателю), наряду с передачей иных документов, подтверждающих его права на застрахованное имущество. При этом не возникает необходимость извещать страховщика о переходе права на застрахованное имущество (ст. 960 ГК РФ) и о замене выгодоприобретателя (ср. со ст. 956 ГК РФ).

3. Применимое законодательство:

- Закон РФ от 27.11.1992 N 4015-1 "Об организации страхового дела в Российской Федерации";

- в рамках реализации положений комментируемой статьи см. также перечень применимого законодательства, указанный в комментарии к ст. 927 ГК РФ.

4. Судебная практика:

- Постановление Пленума ВС РФ от 27.06.2013 N 20;

- информационное письмо Президиума ВАС РФ от 28.11.2003 N 75;

- Обзор по отдельным вопросам судебной практики, связанным с добровольным страхованием имущества граждан (утв. Президиумом ВС РФ 30.01.2013).

Ст. 930 ГК РФ. Страхование имущества

1. Имущество может быть застраховано по договору страхования в пользу лица (страхователя или выгодоприобретателя), имеющего основанный на законе, ином правовом акте или договоре интерес в сохранении этого имущества.

2. Договор страхования имущества, заключенный при отсутствии у страхователя или выгодоприобретателя интереса в сохранении застрахованного имущества, недействителен.

3. Договор страхования имущества в пользу выгодоприобретателя может быть заключен без указания имени или наименования выгодоприобретателя (страхование "за счет кого следует").

При заключении такого договора страхователю выдается страховой полис на предъявителя. При осуществлении страхователем или выгодоприобретателем прав по такому договору необходимо представление этого полиса страховщику.


1. Относительно п. п. 1 и 2 см. коммент. к ст. 928.

2. Пункт 3 предусматривает возможность заключения договора имущественного страхования без указания конкретного, прямо названного выгодоприобретателя. В этом случае выгодоприобретателем будет признан тот, кто предъявит страховой полис, выданный на предъявителя. Применение п. 3 ставит ряд вопросов, на которые прямого ответа закон в настоящее время не дает, в частности, устанавливает ли п. 3 исключение из общих правил п. п. 1 и 2. ГК нигде прямо об этом не говорит. Из систематического толкования закона и сопоставления всех трех пунктов комментируемой статьи, а также ст. 960 ГК вытекает, что и при страховании "за счет кого следует" (кому или в чью пользу следовать будет) у выгодоприобретателя, представившего страховщику предъявительский полис, должен быть "основанный на законе, ином правовом акте или договоре интерес в сохранении имущества" (п. 1), при отсутствии которого договор страхования недействителен (п. 2). Отсюда следует, что страховщик, к которому обратился владелец предъявительского полиса, вправе потребовать доказательств наличия у него страхового интереса, т.е. права на застрахованное имущество. Требовать удостоверения законности приобретения предъявительского полиса он не может, однако сам не лишен права доказывать противоправность получения такого полиса его предъявителем.

Поскольку для получения страхового возмещения необходимо представить предъявительский полис, добровольно передаваемый предыдущими его держателями, правило ст. 956 ГК о запрете замены выгодоприобретателя после того, как он выполнил какую-либо из обязанностей по договору страхования, в данном случае неприменимо, если только при передаче предъявительского полиса не были допущены какие-либо злоупотребления.

Статья 930 ГК РФ. Страхование имущества

Гражданский кодекс Российской Федерации:

Статья 930 ГК РФ. Страхование имущества

1. Имущество может быть застраховано по договору страхования в пользу лица (страхователя или выгодоприобретателя), имеющего основанный на законе, ином правовом акте или договоре интерес в сохранении этого имущества.

2. Договор страхования имущества, заключенный при отсутствии у страхователя или выгодоприобретателя интереса в сохранении застрахованного имущества, недействителен.

3. Договор страхования имущества в пользу выгодоприобретателя может быть заключен без указания имени или наименования выгодоприобретателя (страхование "за счет кого следует").

При заключении такого договора страхователю выдается страховой полис на предъявителя. При осуществлении страхователем или выгодоприобретателем прав по такому договору необходимо представление этого полиса страховщику.


Вернуться к оглавлению документа: Гражданский кодекс РФ часть 2 в действующей (последней) редакции

Комментарии к статье 930 ГК РФ, судебная практика применения

В п. 11, 53 Постановления Пленума Верховного Суда РФ от 27 июня 2013 г. N 20 "О применении судами законодательства о добровольном страховании имущества граждан" содержатся следующие разъяснения:

Страховой интерес

В силу статьи 930 ГК РФ имущество может быть застраховано по договору страхования в пользу лица (страхователя, выгодоприобретателя), имеющего основанный на законе, ином правовом акте или договоре интерес в сохранении этого имущества.

Под имуществом, подлежащим страхованию по договору добровольного страхования имущества граждан, понимаются такие объекты гражданских прав из перечисленных в статье 128 ГК РФ, в отношении которых может существовать законный интерес в сохранении, т.е. они могут быть утрачены (полностью или частично) либо повреждены в результате события, обладающего признаками вероятности и случайности его наступления, и вред, причиненный которым, имеет прямую денежную оценку.

Интерес в сохранении имущества по договору добровольного страхования состоит в его сохранении от негативных последствий, предусмотренных страховым случаем.

При страховании имущества объектом страхования выступает имущественный интерес, связанный с риском утраты (гибели), недостачи или повреждения имущества, принадлежащего страхователю (выгодоприобретателю) на основании закона, иного правового акта или сделки.

В случае, если страховщик оспаривает действительность заключенного им договора добровольного страхования имущества в связи с отсутствием у страхователя (выгодоприобретателя) интереса в сохранении застрахованного имущества (пункт 2 статьи 930 ГК РФ), обязанность доказывания отсутствия интереса у лица, в пользу которого заключен договор страхования, возлагается на страховщика.

При заключении договора страхования заложенного имущества залогодержатель должен иметь интерес в сохранении этого имущества

При заключении договора страхования заложенного имущества в соответствии со статьей 930 ГК РФ залогодержатель должен иметь интерес в сохранении имущества для себя и обеспечении его сохранности с тем, чтобы при неисполнении обязательства, обеспеченного залогом, удовлетворить свои интересы за счет стоимости заложенного имущества. В таком случае залогодержатель по договору добровольного страхования выступает выгодоприобретателем.

В случае, если при заключении договора страхования заложенного имущества предмет залога остается у залогодателя, у последнего имеется интерес в сохранении имущества для себя и обеспечении его сохранности, с тем чтобы при неисполнении обязательства, обеспеченного залогом, удовлетворить интересы кредитора за счет стоимости заложенного имущества.


В пп. 2-5 Информационного письма Президиума ВАС РФ от 28.11.2003 N 75 <Обзор практики рассмотрения споров, связанных с исполнением договоров страхования> содержатся следующие разъяснения:

При возникновении спора о действительности договора страхования имущества в связи с отсутствием интереса у лица, в пользу которого заключен договор, обязанность доказывать отсутствие интереса лежит на лице, предъявившем требование.

..Поскольку обязанность проверять наличие и характер страхуемого интереса при заключении договора лежит на страховщике, а последний не обосновал свои требования и не доказал, что при заключении договора страхования у страхователя отсутствовал интерес в сохранении застрахованного автомобиля, в иске было отказано (см. подробнее п. 2 инф. письма ВАС РФ N 75).

Интерес в сохранении имущества имеется у его собственника и в том случае, когда обязанность нести расходы по замене утраченного или восстановлению поврежденного имущества возлагается на другое лицо.

..Собственник как лицо, обладающее наиболее полным абсолютным правом на принадлежащее ему имущество, всегда имеет основанный на законе интерес в его сохранении.

Интерес в сохранении имущества имеется у его собственника и тогда, когда по условиям договора аренды обязанность по ремонту поврежденного имущества возлагается на арендатора (см. подробнее п. 3 инф. письма ВАС РФ N 75).

Суд признал, что договор страхования имущества может быть заключен в пользу лица, имеющего в сохранении этого имущества интерес, основанный на договоре безвозмездного пользования имуществом.

Поэтому ссудополучатель вправе в силу статьи 930 ГК РФ застраховать полученный по договору автомобиль на случай его угона в свою пользу и при наступлении страхового случая получить страховое возмещение в пределах тех убытков, которые он как наниматель понес в связи с невозможностью использовать автомобиль (см. подробнее п. 4 инф. письма ВАС РФ N 75).

Интерес собственника в сохранении имущества не может быть квалифицирован как противоправный исключительно на основании того, что застрахованное имущество в момент заключения договора страхования находилось на территории России с нарушением таможенных правил.

..Суд признал, что страхователь, право собственности которого на застрахованное имущество в установленном порядке ни на момент заключения договора страхования, ни на момент рассмотрения спора не было прекращено, имеет интерес в сохранении этого имущества (см. подробнее п. 5 инф. письма ВАС РФ N 75).


В п. 18 Постановления Пленума Верховного Суда РФ от 26.12.2017 N 58 "О применении судами законодательства об обязательном страховании гражданской ответственности владельцев транспортных средств" содержатся следующие разъяснения:

Новый приобретатель поврежденного транспортного средства не имеет права на страховое возмещение по договору ОСАГО, заключенному предыдущим владельцем

Право на получение страхового возмещения в связи с повреждением имущества принадлежит потерпевшему - лицу, владеющему имуществом на праве собственности или ином вещном праве. Лица, владеющие имуществом на ином праве (в частности, на основании договора аренды) либо использующие имущество в силу полномочия, основанного на доверенности, самостоятельным правом на страховую выплату в отношении имущества не обладают (абзац шестой статьи 1 Закона об ОСАГО).

Следует учитывать, что заключение договора купли-продажи транспортного средства и его передача покупателю не влекут переход к покупателю права на получение страхового возмещения в связи со страховым случаем, наступившим до момента указанной передачи (пункт 1 статьи 458 ГК РФ). В этом случае лицо, приобретшее поврежденное транспортное средство, не является потерпевшим применительно к обязательному страхованию гражданской ответственности, в связи с чем не может претендовать на получение страхового возмещения по договору обязательного страхования, заключенному предыдущим владельцем (пункт 1 статьи 930 ГК РФ).

Комментарий к статье 930 Страхование имущества Гражданского кодекса РФ

Страхование имущества

Комментарий к статье 930 Гражданского кодекса РФ

1. Под имуществом, подлежащим страхованию по договору страхования имущества следует понимать такие объекты гражданских прав из перечисленных в ст.128 ГК, в отношении которых:

может существовать интерес в их сохранении, т.е. которые могут быть утрачены (полностью или частично) либо быть повреждены в результате стечения обстоятельств;

причиненный этим вред имеет прямую денежную оценку.

(а) К таким объектам, безусловно, относятся любые вещи, включая деньги и ценные бумаги и информация. Из нематериальных благ (ст.150 ГК) к таким объектам, безусловно, относится деловая репутация, которая имеет денежную оценку и даже отражается в балансах организаций отдельной строкой. Страхование на случай причинения вреда деловой репутации является весьма распространенным в странах с развитой рыночной экономикой.

(б) К таким объектам, безусловно, не относятся работы, услуги, так как эти объекты, хотя и имеют денежную оценку, не могут быть утрачены или повреждены, а могут быть утрачены или повреждены лишь результаты выполнения работ, оказания услуг. Нематериальные блага, неотъемлемо связанные с личностью гражданина (ст.150 ГК), также не относятся к таким объектам. Вред, причиненный этим благам не имеет прямой денежной оценки и порождаемый ими страховой интерес страхуется по договору личного страхования.

(в) В отношении имущественных прав и результатов интеллектуальной деятельности, в том числе, исключительных прав на них существуют различные точки зрения на возможность их утраты или повреждения в результате случайного события. Нет сомнения в том, что с возможным нарушением имущественных прав и, в том числе, прав на результаты интеллектуальной деятельности связан страховой интерес и договоры страхования на случай их нарушения могут и будут заключаться. Однако, неясно является ли нарушение имущественных прав их утратой или повреждением и, соответственно, можно ли страховать этот интерес по договору страхования имущества.

Действительно, изготовление "пиратских" копий литературных произведений, кинофильмов, звукозаписей, контрафактных экземпляров программ, без сомнения, нарушает имущественные права правообладателей этих произведений, так как в результате незаконного использования прав их правообладатели лишаются определенных доходов. Однако, этот интерес следует страховать не как имущество, а как упущенную выгоду.

Трудно придумать такой пример, чтобы в результате события, не зависящего от воли правообладателя имущественные права на произведение были бы утрачены или повреждены. Они могут быть утрачены только путем их передачи другому лицу и повреждены только в результате естественного старения произведения и утраты к нему интереса.

По-видимому, интересы, связанные с имущественными правами следует страховать не как имущество, а как финансовые риски. Однако, окончательный ответ на этот вопрос может дать только судебная практика, но она в настоящее время отсутствует.

2. Интерес, страхуемый по договору страхования имущества может состоять только в сохранении самого этого имущества, но не в получении каких-то выгод или преимуществ, связанных с владением, пользованием, распоряжением имуществом. Также не страхуется по договору страхования имущества интерес, связанный с возможными расходами при утрате или повреждении имущества. Иными словами, по договору страхования имущества подлежит возмещению только первая составляющая страховых убытков — утрата или повреждение имущества.

Иногда при страховом случае имущество физически не утрачивается и не повреждается, но оказывается в таком состоянии, что не может больше выполнять свои функции. Это случается, например, при страховании строительных рисков. При страховом случае какая-то из конструкций, созданных в процессе строительства может физически оставаться целой, но переместиться и в результате утратить, например, свою несущую способность. Для восстановления прежнего ее состояния требуется произвести расходы. Подобные расходы подлежат возмещению по договору страхования имущества, так как интерес в сохранении имущества состоит в том, чтобы имущество находилось в неизменном состоянии не только с точки зрения его физической сохранности, но и с точки зрения его функционального назначения. Утрата возможности выполнять определенные функции является повреждением имущества.

При страховании грузов часто случается, что цена на товар, являющийся предметом договора купли-продажи в месте его отправления существенно отличается от цены в месте получения этого товара. Денежной оценкой страхового интереса, в сохранении товара является его страховая стоимость, т.е. его действительная стоимость в месте его нахождения в момент заключения договора страхования (п.2 ст.947 ГК). Договор страхования заключается в момент, когда товар еще находится в месте отправления. Следовательно, по договору страхования имущества его можно страховать только по цене места отправления, но не по цене места получения. Интерес, связанный с разницей в ценах не является интересом в сохранении имущества. Страхование товара, находящегося в месте отправления по цене места получения в части разницы в ценах следует страховать по договору страхования финансового риска. Когда тот же товар окажется в месте получения его можно будет застраховать по договору страхования имущества по цене этого места.

Для того, чтобы товар, находящийся в месте отправления можно было страховать по цене места получения, в договоре страхования должны быть застрахованы два объекта страхования — имущество и финансовый риск. Это не противоречит закону и соответствующие правила страхования грузов могут быть разработаны аналогично тому, как по одним правилам страхуют одновременно и саму автомашину и ответственность за вред третьим лицам, причиненный при ее эксплуатации.

Весьма сложно решить по какому договору следует страховать на случай утраты товарного вида автомашины. С одной стороны, утрату товарного вида можно рассматривать, как повреждение автомашины и страховать по договору страхования имущества, тем более, что существуют методики составления калькуляций на восстановление товарного вида. Однако, с другой стороны, товарный вид автомашины можно восстановить только теоретически, так как утрата товарного вида никак не повреждает автомашину физически и не влияет на ее функционирование. Утрата товарного вида лишь снижает продажную цену автомашины и, следовательно, интерес здесь состоит не в сохранении автомашины, а в выгоде, которую можно получить от ее продажи. На мой взгляд, более правильно страховать такой интерес, как финансовый риск. Окончательный ответ может дать только судебная практика, которой пока нет, так как пока в судах еще не рассматриваются тонкости, связанные с различиями между страхованием самого имущества и страхованием выгод, связанных с его распоряжением.

Лицо, несущее перед собственником ответственность за сохранность имущества также заинтересовано в сохранении имущества, но этот интерес иной, чем у собственника, так как у него возникает только вторая составляющая страховых убытков — расходы, которые ответственное лицо должно будет понести, если имущество будет утрачено или повреждено и на него будет возложена ответственность за эту утрату или повреждение. Ответственность возлагается не всегда, а лишь по основаниям ст.401 ГК, т.е. при наличии вины, или если не действовала непреодолимая сила. Иными словами, собственник лишается вещи, а ответственное за это лицо возмещает ему его потерю не всегда, а только при определенных обстоятельствах. Поэтому интерес собственника отличается от интереса ответственного лица — у собственника возникает первая составляющая страховых убытков, а не вторая. Если риск утраты и повреждения имущества лежит не на собственнике или перенесен собственником на другое лицо по договору (ст.211 ГК), то первая составляющая страховых убытков возникает не у собственника, а у лица, несущего риск утраты и повреждения имущества.

Поскольку по договору страхования имущества возмещается только первая составляющая убытков, следовательно, интерес, страхуемый по договору страхования имущества — это интерес лица, несущего риск утраты и повреждения имущества. Это подтверждается также и подпунктом 1 п.2 ст.929 ГК, в которой сказано, что по договору страхования имущества страхуется риск его утраты или повреждения.

Таким образом, понятие интерес в сохранении имущества, которое использовано в комментируемой статье означает не любой интерес, связанный с тем, чтобы это имущество не было утрачено или повреждено, а только интерес того единственного лица, которое несет риск утраты и повреждения этого имущества.

В Постановлении Президиума ВАС РФ #1540/98 от 21.04.98 (Вестник ВАС РФ #7, 1998 г.) высказана совершенно иная позиция. Надзорная инстанция считает, что понятие интерес в сохранении имущества, использованное в комментируемой статье означает интерес любого лица, так или иначе заинтересованного в том, чтобы это имущество не было утрачено или повреждено. Таким интересом, по мнению Президиума, является, в частности, и интерес лица, ответственного за утрату или повреждение имущества. Однако эта позиция надзорной судебной инстанции нормативно никак не обоснована и можно показать, что она, кроме того, внутренне противоречива (Ю.Б. Фогельсон Страховой интерес при страховании имущества. — Хозяйство и право, #9, 1998). Поэтому моя точка зрения остается той, что изложена выше. Тем более, что именно в силу внутренней противоречивости позиции, практический вывод надзорной инстанции относительно лица, имеющего право на получение выплаты совпадает с тем, который изложен ниже.

3. Договор страхования имущества может быть заключен только в пользу того, кто имеет интерес в сохранении имущества, т.е. в пользу лица, несущего риск утраты или повреждения застрахованного имущества, иначе он недействителен.

Таким образом, имущество, имеющее собственника может быть застраховано только в пользу собственника, если иное не установлено законом или если собственник не переместил этот риск на другое лицо по договору.

Когда товарный склад страхует товары, переданные ему на хранение возникает вопрос о страховом интересе. В гл.47 ГК, регулирующей отношения хранения не содержится прямого указания на лицо, несущее риск утраты или повреждения имущества, однако имеются нормы, устанавливающие обязанность хранителя обеспечить сохранность вещи (ст.891 ГК), обязанность хранителя возвратить вещь (ст.900 ГК), ответственность хранителя за утрату или повреждение (ст.901 ГК). Из всех этих норм не вытекает наличие страхового интереса в сохранении имущества у хранителя. Поэтому, если в договоре хранения отсутствует условие о переходе риска к товарному складу, склад может страховать товары только в пользу того, кто несет риск утраты или повреждения имущества, а это, в большинстве случаев, товаровладелец.

Этот вывод подтверждается п.4 ст.919 ГК, в которой в отношении хранителя другого вида — ломбарда — установлена обязанность страховать принятые на хранение вещи не в свою пользу, а в пользу поклажедателя.

При страховании заложенного имущества, как правило, страхуется имущество, заложенное банку-кредитору заемщиком в обеспечение возврата кредита и практически всегда заложенное имущество страхуется в пользу банка. Наличие интереса у банка обосновывается ссылкой на абзац второй п.1 ст.334 ГК, где установлено право залогодержателя получить удовлетворение из страхового возмещения. Когда имущество находится у залогодержателя, норма подпункта 1 п.1 ст.343 ГК прямо обязывает залогодержателя страховать заложенное имущество. Считают, что раз есть такие нормы закона, то есть и основанный на законе интерес, следовательно, правило п.1 ст.930 ГК соблюдено. Однако, это неверно ни в том ни в другом случае. Ни право получить удовлетворение из возмещения не означает наличие интереса, ни факт нахождения имущества у залогодержателя и обязанность его страховать этого не означают (так как обязанность страховать вовсе не означает обязанность страховать в свою пользу).

В соответствии с п.1 ст.344 ГК риск утраты или повреждения заложенного имущества несет залогодатель, если иное не установлено договором. И даже то, что в некоторых случаях залогодержатель отвечает за утрату или повреждение (п.2 ст.344 ГК) не ведет к возникновению у него страхового интереса в сохранении имущества. Наличие или отсутствие у банка-кредитора страхового интереса в сохранении заложенного имущества зависит от того, указано ли в договоре залога, что банк несет риск его утраты или повреждения.

Аналогична ситуация и при страховании имущества, сданного в аренду. Гл.34 ГК, в которой отрегулированы отношения по аренде также, как и гл.47 не содержит норм, дословно устанавливающих переход риска утраты или повреждения имущества от собственника к арендатору, нет в ней норм и об ответственности арендатора за утрату или повреждение имущества. Следовательно, в силу закона риск утраты или повреждения арендованного имущества к арендатору не переходит и арендатор может страховать арендованное имущество только в пользу арендодателя-собственника, если переход риска не обусловлен договором аренды.

Арендодателями могут выступать не только собственники, но и иные управомоченные лица (ст.608 ГК). Часто такими лицами являются государственные предприятия, учреждения, получившие имущество в полное хозяйственное ведение или оперативное управление с правом сдавать его в аренду. Нормы гл.19 ГК, регулирующие права хозяйственного ведения и оперативного управления не содержат указаний о переходе риска утраты или повреждения от собственника к соответствующему предприятию или учреждению. Если в договорах, по которым имущество передано этому предприятию или учреждению отсутствует условие о переходе риска, то риск остается на собственнике. В пользу такого арендодателя страховать арендованное имущество также нельзя, так как страховой интерес в сохранении имущества у него отсутствует.

Очень часто арендаторы, отремонтировав помещение, страхуют в свою пользу его отделку. Такие договоры недействительны, так как отделка, являясь, в большинстве случаев, неотделимым улучшением помещения, не может иметь отдельного владельца — помещение в целом, вместе с неотделимыми улучшениями принадлежит его собственнику и может страховаться только в его пользу. Это относится и к случаю, когда ремонт произведен за счет арендатора, не говоря уж о тех случаях, когда ремонт произведен в счет арендной платы. Выход здесь простой — страховать не имущество, а финансовый риск, т.е. те расходы, которые придется произвести для того, чтобы восстановить отделку. В этом случае, если расходы на восстановление будет производить арендатор, договор вполне может быть заключен в его пользу независимо от того за чей счет выполнялась предыдущая отделка.

Исключением из этих правил является лизинг, при котором риск переходит к арендатору в момент передачи ему арендованного имущества (ст.669 ГК). Соответственно, страховать имущество, полученное по лизингу следует в пользу арендатора.

В договорах страхования строительно-монтажных рисков одним из объектов страхования является имущество незавершенного строительства. В соответствии со ст.25 Федерального закона "О государственной регистрации прав на недвижимое имущество и сделок с ним" (СЗ РФ #30, 1997, ст. 3594) объект незавершенного строительства относится к недвижимому имуществу и право собственности на него подлежит государственной регистрации. Следовательно в процессе строительства это имущество не имеет собственника, однако, п.1 ст.741 ГК устанавливает, что риск его утраты или повреждения до приемки заказчиком несет подрядчик. В п.3 ст.753 ГК предусмотрен переход риска к заказчику в отношении имущества, являющегося результатом принятых им работ. Таким образом, несмотря на отсутствие собственника, лицами, заинтересованными в сохранении имущества незавершенного строительства являются подрядчик в отношении имущества, являющегося результатом выполненных, но не переданных заказчику работ и заказчик, в отношении имущества, являющегося результатом принятых им по акту работ.

При страховании грузов в отношении страхуемого имущества действует договор поставки, а риск утраты или повреждения товара в процессе исполнения договора поставки переходит от продавца к покупателю. Норма, определяющая распределение риска при купле-продаже (ст.459 ГК) диспозитивна, т.е. распределение риска, установленное в этой норме может быть изменено договором. Правила ИНКОТЕРМС 90, на которые имеется ссылка практически во всех договорах поставки, регулируют договорное распределение риска между сторонами. Причем переход риска не всегда совпадает с переходом собственности на груз.

4. По договору страхования имущества может быть застрахован интерес, основанный только на федеральном законе, Указе Президента РФ, Постановлении Правительства РФ, или договоре.

Интерес в сохранении определенного имущества, который, например, явствует из обстановки или основан на законе субъекта федерации не должен страховаться по договору страхования имущества. Это не означает, однако, что он вообще не может быть застрахован.

Как следует из предыдущего параграфа, интерес в сохранении имущества, имеющего собственника всегда основан либо на законе (когда договор не предусматривает перемещение риска утраты или повреждения) либо на договоре (когда договор предусматривает перемещение риска). Следовательно, интерес в сохранении имущества, основанный на иных правовых актах может существовать только в отношении имущества, не имеющего собственника.

5. В случае страхования имущества в пользу третьего лица, не указанного в договоре страхователю должен быть выдан полис на предъявителя, в отличие от других видов страхования, когда выдача полиса возможна, но не обязательна. Полис в данном случае необходим для того, чтобы страхователь мог передать его третьему лицу для предъявления страховщику требования о выплате.

Полис на предъявителя позволяет требовать страховую выплату своему держателю, однако, не любому держателю, а только тому, у которого в момент наступления страхового случая имелся интерес в сохранении имущества, застрахованного по соответствующему договору (см. ниже). Этим полис на предъявителя отличается от ценной бумаги на предъявителя, которая позволяет осуществить основанные на ней права любому законному владельцу. Правомерность требования держателя полиса о страховой выплате основана на наличии интереса, а не на законности владения документом.

Появление такого инструмента, как страховой полис на предъявителя связано с тем, что при страховании имущества защита заинтересованного лица не прекращается с передачей прав на имущество от одного лица к другому (ст.960 ГК) и передача полиса на предъявителя является материальным актом, обозначающим "передачу" соответствующей защиты.

Иногда полис на предъявителя истолковывают, как признание того, что интерес не связан с каким-то определенным лицом, а обезличен, оборотоспособен и может передаваться от одного лица к другому. Однако это неверно — при передаче полиса на предъявителя передается не интерес, а защита интереса (см. введение п.2В).

При страховании по полису на предъявителя, в договоре, тем не менее, должно быть указано, что он заключен в пользу третьего лица, хотя это третье лицо и не называется в договоре. В судебной практике не раз встречались случаи, когда предъявившее полис лицо не могло доказать, что договор страхования был заключен в пользу третьего лица и следовал отказ в выплате (см. Постановления Президиума ВАС РФ #6802/95 от 21.11.95 (Вестник ВАС РФ #3, 1996 г.), #8639/95 от 14.05.96 (Вестник ВАС РФ #8, 1996 г.), #953/96 от 09.07.96 (Вестник ВАС РФ #10, 1996 г.), #6990/95 от 06.05.97 (Вестник ВАС РФ #7, 1997 г.))

6. Если выгодоприобретатель назван в договоре, интерес, который страхуется по договору страхования имущества должен существовать у него в момент заключения договора страхования. Если выдан полис на предъявителя, интерес у лица, предъявившего полис, должен существовать в момент наступления страхового случая.

Вывод о том, что интерес должен существовать в момент заключения договора страхования вытекает из п.2 комментируемой статьи. Однако, данная норма применима только к случаю, когда лицо, в пользу которого заключен договор названо в договоре. Ее нельзя применить в ином случае, поскольку при страховании в пользу третьего лица, не названного в договоре в момент заключения договора лицо, в отношении которого следует проверять наличие интереса неизвестно. В этом случае проверку наличия интереса можно осуществить только при предъявлении требования о выплате, так как только в этот момент страховщику становится известным лицо требующее произвести выплату в свою пользу. Из п.1 комментируемой статьи вытекает, что у лица, предъявившего полис на предъявителя должен существовать интерес, т.е. для того, чтобы выплата была правомерной, страховой случай должен причинить убытки именно тому, кто предъявил полис. Отсюда у лица, предъявившего полис на предъявителя интерес должен существовать в момент наступления страхового случая.

В случае, если в момент заключения договора страхования в пользу конкретно названного в договоре выгодоприобретателя интерес существовал, но затем перестал существовать, последствия, предусмотренные в п.2 ст.930 ГК не возникают. В зависимости от причин, по которым у заинтересованного лица перестал существовать интерес, имевшийся при заключении договора, возникают последствия, предусмотренные либо п.1 ст.958 ГК либо ст.960 ГК.

Полис на предъявителя очень удобен для того, чтобы заблокировать действие п.1 ст.958 ГК и страховать интересы тех лиц, у которых при заключении договора они отсутствовали, но появились в период действия договора по основаниям иным, чем предусмотрено в ст.960 ГК. Например, страхование имущества незавершенного строительства в период стройки следует проводить только в пользу третьего лица, не названного в договоре. Действительно, в период стройки интерес (вместе с риском утраты или повреждения имущества) переходит от одного лица к другому, но ст.960 ГК не применима, так как права на имущество не переходят, поскольку никто не обладает правами на имущество незавершенного строительства до их регистрации (см. выше).

Таким образом, существует несколько вариантов:

выгодоприобретатель назван в договоре (или это сам страхователь) и он не имел интереса в сохранении имущества при заключении договора — договор недействителен по основанию п.2 ст.930 ГК;

выгодоприобретатель назван в договоре (или это сам страхователь) и он имел интерес в сохранении имущества при заключении договора, который сохраняется у него и в момент наступления страхового случая — договор действует и право на получение выплаты имеет заинтересованное лицо;

выгодоприобретатель назван в договоре (или это сам страхователь), он имел интерес в сохранении имущества при заключении договора, но к моменту наступления страхового случая интерес и права по договору перешли по основаниям ст.960 ГК — договор действует и право на получение выплаты имеет заинтересованное лицо;

выгодоприобретатель назван в договоре (или это сам страхователь) и он имел интерес в сохранении имущества при заключении договора, но интерес перешел от него к другому лицу по основаниям иным, чем предусмотрено в ст.960 ГК — договор прекращается по основаниям п.1 ст.958 ГК в момент перехода интереса;

в договоре указано, что он заключен в пользу третьего лица, не названного в договоре и выдан полис на предъявителя, который предъявлен лицом, имевшим интерес в сохранении имущества при наступлении страхового случая — договор действует и право на получение выплаты имеет заинтересованное лицо;

в договоре указано, что он заключен в пользу третьего лица, не названного в договоре и выдан полис на предъявителя, который предъявлен лицом, не имевшим интереса в сохранении имущества при наступлении страхового случая — договор действует, но лицо предъявившее полис не имеет права на получение выплаты, так как договор страхования был заключен не в его пользу.

В общем случае, право на получение страховой выплаты по договору страхования имущества имеет только то лицо, которое имело интерес в сохранении этого имущества (несло риск его утраты и повреждения) в момент наступления страхового случая и у которого возникла первая составляющая страховых убытков.

СТРАХОВАНИЕ ИМУЩЕСТВА (PROPERTY INSURANCE) | СТРАХОВАНИЕ СЕГОДНЯ

   Недавно искали: seizure, breach, addendum, тариф, misappropriation, sub, adjuster, commodity, reimbursement, interest in property, устав, уставной, reimburse, warranty, inspection, retention, gross claim
22104 страховых терминов из 17 источников.








СТРАХОВАНИЕ ИМУЩЕСТВА

PROPERTY INSURANCE

Отрасль страхования: 1) имущество может быть застраховано по договору страхования в пользу лица (страхователя) или выгодоприобретателя, имеющего основанный на законе, ином правовом акте или договоре интерес в сохранении этого имущества; 2) договор страхования имущества, заключённый при отсутствии у страхователя или выгодоприобретателя интереса в сохранении застрахованного имущества, недействителен; 3) договор страхования имущества в пользу выгодоприобретателя может быть заключён без указания имени или наименования выгодоприобретателя (страхование «за счёт кого следует»). При заключении такого договора страхователю выдаётся страховой полис на предъявителя. При осуществлении страхователем или выгодоприобретателем прав по такому договору необходимо представление этого полиса страховщику (см. ст. 930 ГК РФ). Во внешнеторговых отношениях C.и. имеет особенно широкое распространение при перевозке морским путём товаров (карго), поставляемых во исполнение договоров купли-продажи. Страхование перевозимых товаров производится продавцом или покупателем в зависимости от условий договора купли-продажи. Условия, на которых произведено страхование, указываются в страховом полисе. Страховщик получает условное вознаграждение — страховую премию, выплачиваемую страхователем или лицом, в интересах которого страхование заключено, если обязанность уплаты страховой премии лежит на этом лице. Размер страховой премии зависит от условий, на которых заключено страхование. При страховании, включающем ответственность страховщика за убытки от военных рисков, уплачивается дополнительная страховая премия.

Другие источники:

GSP-930-Продукт-GW Instek

GSP-930 - анализатор спектра 3 ГГц, разработанный на платформе нового поколения. Высокая стабильность, большой экран, малый вес и компактный размер GSP-930 являются эталоном нового рыночного стандарта для анализаторов спектра 3GHz. Его расширенные функции, Spectrogram и Topography, значительно расширяют область применения и повышают важность анализатора спектра как незаменимого прибора для анализа радиочастот.

GSP-930 обеспечивает высокую стабильность частоты 25ppb (0,025ppm) и очень низкий уровень шума -142dBm (предварительный усилитель включен) в качестве основы для измерения высокой чувствительности. Гибкий выбор из 58 диапазонов разрешения, а также функции спектрограммы и топографии позволяют GSP-930 детально фиксировать и отображать переходные, дрейфующие и скачкообразные сигналы. Сочетание информации частотной области и информации временной области облегчает отслеживание изменений радиочастотного сигнала во времени. Другие замечательные функции, такие как спектральная маска излучения (SEM), измерения мощности, анализ AM / FM и измерения TOI / CNR / CSO / CTB, делают GSP-930 полезным инструментом, подходящим для широкого круга приложений.

Удобный дизайн GSP-930 помогает снизить стресс и беспокойство пользователя при использовании высокотехнологичного инструмента. Чтобы помочь пользователю легко получить доступ к правилам и определениям терминов измерения при текущей операции, встроенная экранная справка предоставляет описание определения на экране, чтобы направлять пользователя через процессы измерения, не заглядывая в документы. Широко используемые значки на дисплее четко указывают на текущие настройки и рабочее состояние продукта, позволяя пользователю с первого взгляда справиться со сценарием измерения.Часы-будильник автоматически включают питание GSP-930 в заранее установленное пользователем время, которое можно использовать для предварительного прогрева прибора перед проведением измерений, чтобы обеспечить точность результатов измерений. Функция ограничения годен / не годен позволяет пользователю выполнять повторяющиеся измерения «годен / не годен» путем проверки шаблона вместо трудоемкого считывания значений. Функция «Последовательность» обеспечивает простую функцию программирования, позволяющую пользователю редактировать и запускать процедуры измерения на экране GSP-930 без использования ПК.

GSP-930 оснащен различными интерфейсами, включая LXI, USB, RS-232 и GPIB (опционально). Драйвер IVI доступен для разработки программного обеспечения дистанционного управления с помощью LabVIEW или LabWindows / CVI. Слот Micro SD и интерфейс USB Host позволяют увеличить объем памяти для хранения данных. Выход ПЧ (886 МГц) предоставляется в качестве сигнала промежуточной частоты входного ВЧ-сигнала для пользователей, которые могут разрабатывать свои собственные приложения. Обладая множеством интерфейсов связи, удобным управлением, большим экраном, малым весом, компактными размерами и питанием от батареи (1) , GSP-930 разработан на основе высокотехнологичной платформы, чтобы обеспечить максимальные преимущества для клиентов.

Примечание (1): Аккумулятор не является обязательным.

% PDF-1.6 % 98 0 объект > эндобдж 97 0 объект > эндобдж 99 0 объект > эндобдж 101 0 объект [142 0 R] эндобдж 100 0 объект [145 0 R] эндобдж 93 0 объект > эндобдж 92 0 объект > эндобдж 94 0 объект > эндобдж 96 0 объект > эндобдж 95 0 объект > эндобдж 108 0 объект [121 0 R] эндобдж 107 0 объект [124 0 R] эндобдж 109 0 объект [118 0 R] эндобдж 111 0 объект [112 0 R] эндобдж 110 0 объект [115 0 R] эндобдж 103 0 объект [136 0 R] эндобдж 102 0 объект [139 0 R] эндобдж 104 0 объект [133 0 R] эндобдж 106 0 объект [127 0 R] эндобдж 105 0 объект [130 0 R] эндобдж 78 0 объект > эндобдж 77 0 объект > эндобдж 79 0 объект > эндобдж 81 0 объект > эндобдж 80 0 объект > эндобдж 73 0 объект > эндобдж 72 0 объект > эндобдж 74 0 объект > эндобдж 76 0 объект > эндобдж 75 0 объект > эндобдж 88 0 объект > эндобдж 87 0 объект > эндобдж 89 0 объект > эндобдж 91 0 объект > эндобдж 90 0 объект > эндобдж 83 0 объект > эндобдж 82 0 объект > эндобдж 84 0 объект > эндобдж 86 0 объект > эндобдж 85 0 объект > эндобдж 138 0 объект > эндобдж 137 0 объект > эндобдж 139 0 объект > эндобдж 141 0 объект > эндобдж 140 0 объект > эндобдж 133 0 объект > эндобдж 132 0 объект > эндобдж 134 0 объект > эндобдж 136 0 объект > эндобдж 135 0 объект > эндобдж 148 0 объект > эндобдж 147 0 объект > эндобдж 149 0 объект > эндобдж 151 0 объект > эндобдж 150 0 объект > эндобдж 143 0 объект > эндобдж 142 0 объект > эндобдж 144 0 объект > эндобдж 146 0 объект > эндобдж 145 0 объект > эндобдж 118 0 объект > эндобдж 117 0 объект > эндобдж 119 0 объект > эндобдж 121 0 объект > эндобдж 120 0 объект > эндобдж 113 0 объект > эндобдж 112 0 объект > эндобдж 114 0 объект > эндобдж 116 0 объект > эндобдж 115 0 объект > эндобдж 128 0 объект > эндобдж 127 0 объект > эндобдж 129 0 объект > эндобдж 131 0 объект > эндобдж 130 0 объект > эндобдж 123 0 объект > эндобдж 122 0 объект > эндобдж 124 0 объект > эндобдж 126 0 объект > эндобдж 125 0 объект > эндобдж 71 0 объект [/ ICCBased 48 0 R] эндобдж 68 0 объект [/ ICCBased 48 0 R] эндобдж 69 0 объект [/ ICCBased 48 0 R] эндобдж 70 0 объект [/ ICCBased 48 0 R] эндобдж 152 0 объект > эндобдж 158 0 объект значение NULL эндобдж 159 0 объект > ручей hb``a`Rc`d` ̀

(PDF) Нейробиология психоактивных веществ и поведенческих зависимостей.CNS Spectrums, 11 (12), 924-930

930

29. Kim SW, Grant JE, Adson D, Shin YC. Двойное слепое сравнение налтрексона и плацебо

Исследование

в лечении патологической склонности к азартным играм. Биол Психиатрия. 2001; 49: 914-921.

30. Вольпичелли Дж. Р., Альтерман А. И., Хаясида М., О’Брайен С. П.. Налтрексон в лечении

алкогольной зависимости Arch Gen Psychiatry. 1992; 49: 876-880.

31. Мейсон Б.Дж., Сальвато Ф.Р., Уильямс Л.Д., Ритво Е.К., Катлер РБ. Двойное слепое контролируемое плацебо-

исследование перорального приема налмефена при алкогольной зависимости.Arch Gen Psychiatry.

1999; 56: 719-724.

32. Шмитт Л.Х., Харрисон Г.А., Спарго Р.М. Изменения в уровнях экскреции адреналина и кортизола, связанные с поведением в сообществе австралийских аборигенов. Am J

Phys Anthropol. 1998; 106: 249-253.

33. Рамирес Л.Ф., Маккормик Р.А., Лоуи М.Т. Плазменный кортизол и депрессия у патологоанатомов

кал. Br J Psychiatry. 1988; 153: 684-686.

34. Рой А., Адинофф Б., Рохрих Л. и др.Патологическая азартная игра. Психобиологическое исследование.

Arch Gen Psychiatry. 1988; 45: 369-373.

35. Мейер Г., Хауффа Б.П., Щедловски М., Павлак С., Стадлер М.А., Экстон М.С. Казино

азартные игры увеличивают частоту сердечных сокращений и уровень кортизола в слюне у обычных игроков. Биол

Психиатрия. 2000; 48: 948-953.

36. Крюгер THC, Щедловски М., Мейер Г. Измерения кортизола и частоты сердечных сокращений во время игры в казино

в зависимости от импульсивности. Нейропсихобиология.2005; 52: 206-211.

37. Meyer G, Schwertfeger J, Exton MS, et al. Нейроэндокринный ответ на казино

азартные игры у проблемных игроков. Психонейроэндокринология. 2004; 29: 1272-1280.

38. Potenza MN, Steinberg MA, Skudlarski P, et al. Азартные игры побуждают к патологическим

азартным играм: исследование функциональной магнитно-резонансной томографии. Arch Gen Psychiatry.

2003; 60: 828-836.

39. Potenza MN, Leung HC, Blumberg HP и др.Исследование FMRI Stroop задачи вен-

тромедиальной префронтальной кортикальной функции у патологических игроков. Am J Psychiatry.

2003; 160: 1990–1994.

40. Рейтер Дж., Рэдлер Т., Роуз М., Хэнд I, Глашер Дж., Бучел К. Патологическая азартная игра

связана со сниженной активацией мезолимбической системы вознаграждения. Nat Neurosci.

2005; 8: 147-148.

41. Лондонский ED, Эрнст М., Грант С., Бонсон К., Вайнштейн А. Орбитофронтальная кора и

злоупотребление наркотиками человека: функциональная визуализация.Cereb Cortex. 2000; 10: 334-342.

42. Бехара А. Рискованный бизнес: эмоции, принятие решений и зависимость. J Gambl Stud.

2003; 19: 23-51.

43. Лим К.О., Чой С.Дж., Помара Н., Волкин А., Ротросен Дж.П. Уменьшение лобного белого вещества

целостность при кокаиновой зависимости: исследование с визуализацией с контролируемым тензором диффузии. Биол

Психиатрия. 2002; 51: 890-895.

44. Грант Дж. Э., Коррейя С., Бреннан-Крон Т. Целостность белого вещества при клептомании: пилотное исследование

.Психиатрия Res Neuroimaging. 2006; 147: 233-237. Epub 2006 7 сентября.

45. Холландер Э, Палланти С., Балдини Росси Н, Суд Э, Бейкер Б.Р., Бухсбаум М.С. Imaging

денежное вознаграждение патологическим игрокам. World J Biol Psychiatry. 2005; 6: 113-120.

46. Крокфорд Д.Н., Гудиер Б., Эдвардс Дж., Квикфолл Дж., Эль-Гебали Н. Активность мозга, индуцированная подсказкой

у патологических игроков. Биол Психиатрия. 2005; 58: 787-795.

47. Каведини П., Рибольди Дж., Келлер Р., Д’Аннуччи А., Беллоди Л.Дисфункция лобной доли у

пациентов с патологией азартных игр. Биол Психиатрия. 2002; 51: 334-341.

48. Петри Н.М. Патологическое пристрастие к азартным играм: этиология, сопутствующие заболевания и лечение.

Вашингтон, округ Колумбия: Американская психологическая ассоциация; 2005.

49. Ругл Л., Меламед Л. Нейропсихологическая оценка проблем внимания у

патологических игроков. J Nerv Ment Dis. 1993; 181: 107-112.

50. Specker SM, Carlson GA, Christenson GA, Marcotte M.Нарушение контроля над импульсами -

дер и синдром дефицита внимания у патологических игроков. Энн Клин Психиатрия.

1995: 7: 175-179.

51. Дискин К.М., Ходгинс, округ Колумбия. Сужение внимания и диссоциация у патологических

игроков видео лотереи. J Gambl Stud. 2000; 16: 461-467.

52. Goudriaan AE, Oosterlaan J, de Beurs E., van den Brink W. Нейрокогнитивные функции при патологической игровой зависимости: сравнение с алкогольной зависимостью, синдромом Туретта

и нормальным контролем.Зависимость. 2006; 101: 534-547

53. Кертцман С., Ловенгруб К., Айзер А., Бен Нахум З., Котлер М., Даннон П.Н. Stroop

выступление у патологических игроков. Psychiatry Res. 2006; 142: 1-10.

54. Грант Дж. Э., Одлауг Б. Л., Возняк Дж. Р. Нейропсихологическое функционирование при клептомании.

Behav Res Ther. 2006 сен 26; [Epub перед печатью].

55. Шах К.Р., Потенца М.Н., Эйзен С.А. Биологические основы патологического пристрастия к азартным играм. В

Grant JE, Potenza MN, eds.Патологическое пристрастие к азартным играм: клиническое руководство по лечению.

Вашингтон, округ Колумбия: American Psychiatric Publishing, Inc; 2004: 127-142.

56. Potenza MN, Xian H, Shah K, Scherrer JF, Eisen SA. Общие генетические вклады

в патологическое пристрастие к азартным играм и большую депрессию у мужчин. Arch Gen Psychiatry.

2005; 62: 1015-1021.

57. Comings DE, Rosenthal RJ, Lesieur HR, et al. Исследование гена рецептора дофамина D2

при патологической игровой зависимости.Фармакогенетика. 1996; 6: 223-234.

58. Comings DE, Gade R, Wu S, et al. Исследования потенциальной роли гена рецептора дофамина D1

в аддиктивном поведении. Мол Психиатрия. 1997; 2: 44-56.

59. Comings DE, Gonzalez N, Wu S, et al. Исследования полиморфизма

повторов 48 п.н. гена DRD4 при импульсивном, компульсивном, аддиктивном поведении: синдром Туретта

, СДВГ, патологические азартные игры и злоупотребление психоактивными веществами. Am J Med Genet.

1999; 88: 358-368.

60. Перес де Кастро И., Ибанес А., Торрес П., Саис-Руис Дж., Фернандес-Пикерас Дж. Генетическое исследование связи между патологическими азартными играми и функциональным ДНК-полиморфизмом

в гене рецептора D4. Фармакогенетика. 1997; 7: 345-348.

61. О’Брайен С.П., Маккей Дж. Фармакологические методы лечения расстройств, связанных с употреблением психоактивных веществ. В:

Nathan PE, Gorman JM, eds. Руководство по эффективным методам лечения. 2-е изд. Нью-Йорк,

Нью-Йорк: издательство Оксфордского университета; 2002: 125-156.

62. Grant JE, Potenza MN. Расстройства импульсного контроля: клиническая характеристика и макологическое управление фармакологией. Энн Клин Психиатрия. 2004; 16: 27-34.

63. Oslin DW, Berrettini W., Kranzler HR, et al. Функциональный полиморфизм гена опиоидного рецептора mu-

связан с ответом на налтрексон у

пациентов с алкогольной зависимостью. Нейропсихофармакология. 2003; 28: 1546-1552.

64. Potenza MN. Расстройства контроля над импульсами и сопутствующие расстройства: двойной диагноз

соображения.Журнал двойной диагностики. Под давлением.

65. Холландер Э, Каплан А., Палланти С. Фармакологические методы лечения. В: Grant JE,

Potenza MN. Патологическое пристрастие к азартным играм: клиническое руководство по лечению. Вашингтон

округ Колумбия: American Psychiatric Publishing, Inc. 2004: 189-206.

66. Hollander E, DeCaria CM, Finkell JN, Begaz T., Wong CM, Cartwright C. Случайное двойное слепое перекрестное испытание флувоксамина и плацебо в патологической игровой зависимости.

Biol Psychiatry. 2000; 47: 813-817.

67. Холландер Э, Палланти С., Аллен А., Суд Э, Балдини Росси Н. Уменьшает ли длительное высвобождение лит-

мкМ импульсивные азартные игры и аффективную нестабильность по сравнению с плацебо у патологических

игроков с расстройствами биполярного спектра? Am J Psychiatry. 2005; 162: 137-145.

68. Grant JE, Potenza MN. Эсциталопрам в лечении патологической склонности к азартным играм с сопутствующей тревогой

: открытое исследование с двойным слепым прекращением.Int

Clin Psychopharmacol. 2006; 21: 203-209.

69. Черный DW. Открытое испытание бупропиона в лечении патологической зависимости.

J Clin Psychopharmacol. 2004; 24: 108-110.

70. Stein DJ, Lochner C. Обсессивно-компульсивные расстройства спектра: многомерный подход

. Psychiatr Clin N Am. 2006; 29: 343-351.

Обзорная статья

CNS Spectr 11:12 © MBL Communications Inc. Декабрь 2006 г.

Гистопатологическая характеристика хронических поражений радиочастотной абляции для изоляции легочной вены

Цели

Это исследование описывает гистопатологические и электрофизиологические данные предсердий у пациентов с рецидивом фибрилляция (AF) после изоляции легочной вены (PV), которая подверглась последующей хирургической процедуре лабиринта.

Предпосылки

Восстановление проводимости ЛВ обычно является причиной рецидива ФП после катетерной изоляции ЛВ.

Методы

Двенадцать пациентов с рецидивирующей ФП после острой успешной катетерной изоляции антрального ЛВ подверглись хирургической операции лабиринта. Образцы полнослойной хирургической биопсии были получены из антрального отдела ЛВ в областях видимых эндокардиальных рубцов. Перед биопсией были взяты интраоперационные электрофизиологические записи эпикарда из каждой ЛВ с использованием кругового катетера для картирования.

Результаты

У 12 пациентов через 8-11 месяцев после аблации были взяты биопсии 22 ЛВ. Одиннадцать из 22 образцов (50%) показали трансмуральный рубец, а 11 (50%) показали жизнеспособный миокард с рубцом или без него. Каждый образец биопсии демонстрировал признаки повреждения, чаще всего утолщение эндокарда (n = 21 [95%]) и фиброзный рубец (n = 18 [82%]). В семи из 22 образцов (32%) во время операции была обнаружена блокада проводимости. Трансмуральный рубец с большей вероятностью можно было увидеть в образцах биопсии из ЛВ с блокадой проводимости, чем в образцах из ЛВ, показывающих повторное соединение.Однако жизнеспособный миокард сам по себе или смешанный со рубцом был обнаружен в 2 образцах из ЛВ с блокадой проводимости.

Выводы

ЛВ, показывающие электрическое воссоединение после катетерной антральной абляции, часто выявляют анатомические промежутки или нетрансмуральные поражения в местах катетерной абляции. Нетрансмуральные поражения отмечаются в некоторых ЛВ со стойкой блокадой проводимости, что позволяет предположить, что геометрия поражения может влиять на проводимость ЛВ. Гистологические данные показывают, что нетрансмуральная абляция может создавать динамический клеточный субстрат с признаками обратимого повреждения.Отсроченное восстановление после травмы может объяснить поздние рецидивы ФП после изоляции ЛВ.

Ключевые слова

абляция

фибрилляция предсердий

гистология

Аббревиатуры и акронимы

Рекомендуемые статьи Цитирующие статьи (0)

Copyright © 2012 American College of Cardiology Foundation. Опубликовано Elsevier Inc. Все права защищены.

Рекомендуемые статьи

Цитирующие статьи

Функциональное профилирование единичных долгосрочных гематопоэтических стволовых клеток человека с редактированием CRISPR / Cas9

Истощение линии пуповинной крови

Образцы пуповинной крови человека были получены из больниц Trillium и William Osler с информированного согласия в в соответствии с руководящими принципами, утвержденными Советом по этике исследований University Health Network (UHN).Образцы пуповинной крови обрабатывали через 24–48 ч после рождения. В этом исследовании использовались исключительно мужские образцы, поскольку GATA1 и STAG2 расположены на X-хромосоме. Это способствовало эффективности CRISPR / Cas9 из-за необходимости редактировать только одну Х-хромосому. Контрольный OR2W5 расположен на хромосоме 1. Образцы разбавляли 1: 1 фосфатно-солевым буфером (PBS), и мононуклеарные клетки обогащали, используя среду для разделения лимфоцитов (Wisent, 305-010-CL). Впоследствии эритроциты лизировали с использованием раствора хлорида аммония (StemCell Technologies, 07850).Затем клетки с положительным клонированием истощали путем отрицательной селекции с помощью набора StemSep Human Hematopoietic Progenitor Cell Enrichment Kit (StemCell Technologies, 14056) и TAC против человеческого CD41 (StemCell Technologies, 14050) в соответствии с протоколом производителя. Клетки с истощенными клонами хранили в 50% PBS, 40% фетальной бычьей сыворотке (FBS) (ThermoFisher, 12483-020) и 10% DMSO (FisherScientific, D128-500) при -150 ° C.

Сортировка пуповинной крови

Клетки с истощенными клонами размораживали путем медленного добавления по каплям X-VIVO 10 (Lonza, 04743Q) с 50% FBS (Sigma, 15A085) и DNaseI (200 мкг / мл, Roche, 10104159001).Клетки центрифугировали при 350 × г в течение 10 мин при 4 ° C, а затем ресуспендировали в PBS + 2,5% FBS. Для всех экспериментов in vitro и in vivo полная иерархия ствола и предков сортируется, как описано в Notta et al. 34 использовались для сортировки LT-HSC, ST-HSC и MEP. Истощенные клонами клетки ресуспендировали в 100 мкл на 1 × 10 6 клеток и окрашивали в двух последующих циклах по 20 мин при комнатной температуре каждый. Сначала использовали следующие антитела (объем на 1 × 10 6 клеток, все от BD Biosciences, если не указано иное): CD45RA FITC (5 мкл, 555488, HI100), CD49f PE-Cy5 (3.5 мкл, 551129, Goh4), CD10 BV421 (4 мкл, 562902, HI10a), CD19 V450 (4 мкл, 560353, HIB19) и биотин FLT3 CD135 (12 мкл, клон 4G8, индивидуальная конъюгация). После промывки клеток использовали второй набор антител (объем на 1 × 10 6 клеток, все от BD Biosciences, если не указано иное): CD45 V500 (4 мкл, 560777, HI30), CD34 APC-Cy7 (3 мкл, клон 581, индивидуальная конъюгация), CD38 PE-Cy7 (2,5 мкл, 335825, HB7), CD90 APC (4 мкл, 559869, 5E10), CD7 A700 (10 мкл, 561603, M-T701) и конъюгат стрептавидина Qdot 605 (3 мкл, ThermoFisher, Q10101MP).Сортировку клеток проводили на приборе FACSAria III (BD Biosciences). LT-HSC были отсортированы как CD45 + CD34 + CD38 - CD45RA - CD90 + CD49f + , ST-HSC как CD45 + CD34 + CD38 - CD45RA - CD90 - CD49f - и MEP как CD45 + CD34 + CD38 + CD10 / 19 - CD7 - CD45RA - FLT3 - (дополнительные рисунки.1 и 2).

Культура отсортированных клеток до электропорации

Отсортированные LT-HSC, ST-HSC или MEP культивировали в течение 36–48 часов в бессывороточной среде X-VIVO 10 (Lonza) с 1% фракцией V бычьего сывороточного альбумина (Roche , 10735086001), 1 × l-глутамин (Thermo Fisher, 25030081), 1 × пенициллин-стрептомицин (Thermo Fisher, 15140122) и следующие цитокины (все от Miltenyi Biotec): FLT3L (100 нг / мл), G-CSF ( 10 нг / мл), SCF (100 нг / мл), TPO (15 нг / мл) и IL-6 (10 нг / мл). Клетки культивировали в 96-луночных планшетах с U-образным дном (Corning, 351177).

гРНК и дизайн шаблона HDR

гРНК для GATA1 Short и Long были разработаны на Benchling (http://www.benchling.com). Для GATA1 Short рассматривались последовательности гРНК, фланкирующие 5 'и 3' конец экзона 2. Индивидуальные гРНК, нацеленные на 5 'или 3' конец, индивидуально тестировались на эффективность расщепления, и выбиралась лучшая пРНК, нацеленная на каждый конец. Совместное использование обеих гРНК позволило полностью вырезать экзон 2 (рис. 1b). Для GATA1 Long последовательности гРНК, наиболее близкие ко второму стартовому кодону ATG, были индивидуально протестированы на эффективность расщепления, и была выбрана лучшая гРНК.Шаблон GATA1 Long HDR был разработан с концами гомологии 60 п.н. с обеих сторон. Для матрицы стартовый кодон ATG (метионин) был изменен на CTC (лейцин), а последовательность PAM была изменена с GGG (глицин) на GGC (глицин), чтобы избежать повторного разрезания gRNA (рис. 1c). Контрольные гРНК, которые нацелены на экзон 1 обонятельного рецептора OR2W5, были предсказаны CRoatan algrotihm 33 . ГРНК STAG2 была предсказана с помощью того же алгоритма.

gRNA и HDR последовательности шаблона:

Управление gRNA-1: GACAACCAGGAGGACGCACT

Control gRNA-2: CTCCCGGTGTGGACGTCGCA

GATA1 Short gRNA-1: TGGAACGGGGAGATGCAGGA

GATA1 Short gRNA-2: CCACTCAATGGAGTTACCTG

GATA1 Long gRNA: CATTGCTCAACTGTATGGAG

GATA1 Длинные HDR-шаблон:

TCTTTCCTCCATCCCTACCTGCCCCCAACAGTCTTTCAGGTGTACCCATTGCTCAACTGTCTCGAGGGCATCCCAGGGGGCTCACCATATGCCGGCTGGGCCTACGGCAAGACGGGGCTCTACCCTGCC

STAG2 gRNA: AATGGTCATCACCAACAGAA

CRISPR / cas9 РНП электропорации

gRNAs были синтезированы из IDT, как Alt-R CRISPR / cas9 crRNA, которые требуют отжига с Alt-R tracrRNA (IDT), чтобы образуют функциональный дуплекс гРНК.Шаблон HDR был синтезирован из IDT как одноцепочечный Ultramer. crRNA и tracrRNA ресуспендировали до 200 мкМ в TE Buffer (IDT). Оба олигонуклеотида РНК смешивали 1: 1 до конечной концентрации 100 мкМ и отжигали при 95 ° C в течение 5 мин в термоциклере, затем охлаждали до комнатной температуры на столе. При одновременном использовании двух gRNA обе crRNA отжигались с tracrRNA в одной пробирке. Для каждой реакции 1,2 мкл crRNA: tracrRNA, 1,7 мкл белка Cas9 (IDT) и 2,1 мкл PBS объединяли в пробирке Eppendorf с низким связыванием (Axygen, MCT-175-C-S) и инкубировали в течение 15 мин при комнатной температуре.Затем добавляли 1 мкл 100 мкМ усилителя электропорации (IDT). Клетки, культивированные перед электропорацией, промывали теплым PBS и центрифугировали при 350 × г в течение 10 мин при комнатной температуре. От 1 × 10 4 –5 × 10 4 клеток на условие ресуспендировали в 20 мкл буфера P3 (Lonza) на реакцию и быстро добавляли в пробирку Эппендорфа, содержащую комплекс Cas9 gRNA RNP. Смесь кратковременно перемешивали пипетированием, а затем добавляли в камеру для электропорации (Lonza, V4XP3032).Клетки подвергали электропорации с помощью программы DZ-100 с использованием Lonza Nucleofector и сразу же после этого добавляли 180 мкл предварительно нагретой среды X-VIVO 10 (как описано выше). Клетки собирали в инкубаторе в течение ночи перед их использованием в анализах in vivo или одиночных клеток in vitro.

Установка анализа одиночных клеток in vitro

Анализы одиночных клеток in vitro проводили в соответствии с Notta et al. 34 с небольшими изменениями. Вкратце, за 3 дня до анализа отдельных клеток 96-луночные планшеты с плоским дном Nunc (Thermo Fisher, 167008) покрывали 50 мкл на лунку 0.2% желатин (G1393, Sigma-Aldrich) с помощью многоканальной пипетки. Первую и последнюю колонку каждого 96-луночного планшета не использовали и вместо этого заполняли 150 мкл PBS на лунку для поддержания надлежащей влажности внутри планшета. Через 1 час удаляют 0,2% желатин и мышиные клетки стромы MS-5 58 засевают с плотностью 1500 клеток на лунку в 100 мкл среды H5100 (StemCell Technologies, 05150). За день до этого среду H5100 удаляли и заменяли 100 мкл среды для дифференцировки эритромиелоидов.Для этого используется среда StemPro-34 SFM (Thermo Fisher, 10639011) с прилагаемой добавкой, 1 × l-глутамин (Thermo Fisher, 25030081), 1 × пенициллин-стрептомицин (Thermo Fisher, 15140122), 10 мкл человеческого ЛПНП ( StemCell Technologies, 02698) на каждые 50 мл среды и следующие цитокины (все от Miltenyi Biotec, если не указано иное): FLT3L (20 нг / мл), GM-CSF (20 нг / мл), SCF (100 нг / мл), ТПО (100 нг / мл), ЭПО (3 нг / мл, Эпрекс), ИЛ-2 (10 нг / мл), ИЛ-3 (10 нг / мл), ИЛ-6 (50 нг / мл), ИЛ- 7 (20 нг / мл) и IL-11 (50 нг / мл).В день эксперимента электропорированные клетки окрашивали 1: 2000 Sytox Blue (ThermoFisher, S34857) в PBS + 2,5% FBS, и жизнеспособные отдельные клетки были отсортированы и депонированы в засеянный 96-луночный планшет MS-5 с использованием FACSAria II ( BD Biosciences). Единичные клетки культивировали в течение 16-17 дней с добавлением 100 мкл эритромиелоидной среды для дифференцировки на лунку на 8-й день.

Проточная цитометрия анализа одиночных клеток in vitro

Лунки с содержанием гемопоэтических клеток помечали за 1 день до общее количество лунок с колониями использовали для расчета эффективности CRISPR / Cas9 и отдельных колоний.В день анализа из каждой лунки с помощью многоканальной пипетки удаляли 140 мкл среды и содержимое хорошо перемешивали. После дополнительной промывки лунок PBS содержимое каждой лунки переносили в 96-луночный фильтровальный планшет (8027, Pall) для удаления стромальных клеток. Для этого фильтровальный планшет помещали поверх 96-луночного планшета с U-образным дном (Corning, 351177) и центрифугировали при 300 × g в течение 7 минут при комнатной температуре. После того, как клетки осаждали на дне планшета с U-образным дном, среду перебрасывали, быстро переворачивая планшет с U-образным дном (оставалось ~ 20 мкл жидкости на лунку).Затем 30 мкл PBS + 2,5% FBS добавляли и перемешивали в каждую лунку с помощью многоканальной пипетки, и 25 мкл (половину) переносили в 96-луночный планшет для ПЦР (Eppendorf, 951020362) для последующей экстракции геномной ДНК (планшет для ПЦР). был запечатан и хранился при -80 ° C). После этого 25 мкл смеси антител в PBS + 2,5% FBS добавляли в каждую лунку, содержащую 25 мкл гемопоэтических клеток, и окрашивали в течение 45 мин при 4 ° C. Были использованы следующие антитела (все антитела от BD Biosciences, если не указано иное): CD45 APC (1: 100, 560777, HI30), CD34 APC-Cy7 (1: 250, клон 581, индивидуальная конъюгация), CD33 BV421 (1: 50, Biolegend, 303416, WM53), CD71 FITC (1: 100, 347513, L01.1), CD41 PE-Cy5 (1: 200, Beckman Coulter, 6607116, P2) и GlyA PE (1: 200, Beckman Coulter, IM2211U, KC16). Наконец, 150 мкл PBS + 2,5% FBS добавляли в каждую лунку с помощью многоканальной пипетки, и клетки анализировали на FACSCelesta с помощью высокопроизводительного пробоотборника (HTS, BD Biosciences). Все количественные оценки проточной цитометрии выполнялись слепым методом. Как правило, для вызова положительной линии требовалось более десяти клеток. Эритроидные клетки были определены как положительные по экспрессии CD71, с экспрессией GlyA или без нее.

Генотипирование одиночных клеток в анализе in vitro

ПЦР-планшеты, содержащие 25 мкл клеток на лунку, оттаивали и использовали модифицированный протокол Agencourt GenFind V2 (Beckman Coulter, A41499) для выделения геномной ДНК. Лунки с содержимым клеток переносили в новый 96-луночный планшет для ПЦР (Eppendorf, 951020362), чтобы использовать многоканальное пипетирование на каждом этапе в будущем. Всего в каждую лунку пипеткой вносили 25 мкл буфера для лизиса и 1,2 мкл протеиназы К (Zymo Research, D3001220).Через 30 мин при комнатной температуре добавляли 50 мкл магнитных частиц. Через 5 мин планшет для ПЦР помещали на магнитную подставку (ThermoFisher, AM10027) на 10 мин. Супернатант удаляли многоканальной пипеткой и планшет снимали с магнита. Всего в каждую лунку смешали 200 мкл промывочного буфера 1 и планшет для ПЦР снова поместили на магнитную подставку. Через 10 мин супернатант удаляли и каждую лунку промывали 125 мкл промывочного буфера 2. Наконец, после удаления последнего промывочного буфера магнитные частицы ресуспендировали в 60 мкл ТЕ-буфера (IDT).Планшет для ПЦР снова помещали на магнитную подставку и через 10 мин удаляли 57 мкл элюированной геномной ДНК и помещали в новый планшет для ПЦР.

Сконструированный геномный локус CRISPR / Cas9 амплифицировали с помощью ПЦР. Для каждой реакции ПЦР 23 мкл элюированной геномной ДНК смешивали с 1 мкл прямого и обратного праймера (10 мкМ) и 25 мкл смеси AmpliTaq Gold 360 Master Mix (ThermoFisher, 4398881). Программа ПЦР была следующей: 95 ° C в течение 10 минут, затем 95 ° C в течение 30 секунд, 56 ° C в течение 30 секунд и 72 ° C в течение 1 минуты (40 циклов), а затем 72 ° C в течение 7 минут.Для идентификации колоний с генотипом GATA1-Short 15 мкл продукта ПЦР обрабатывали на 1,5% агарозном геле (ThermoFisher, 16500500). Колонии контрольной гРНК подвергали скринингу на гомозиготную делецию OR2W5 (делеция в экзоне 1, от 700 до 500 п.н. (дополнительный рис. 4а)). Аналогичным образом колонии GATA1-Short были проверены на изменение размера продукта ПЦР (делеция экзона 2, от 1000 до 550 п.н., дополнительный рисунок 4b). Чтобы идентифицировать колонии с генотипом GATA1-Long, продукты ПЦР очищали на колонке с использованием набора для очистки ДНК ZR-96 (Zymo Research, D4018) в соответствии с инструкциями производителя. протокол.Очищенный продукт ПЦР секвенировали по Сэнгеру с использованием праймера для обратной ПЦР, и хроматограммы проверяли для идентификации колоний, содержащих мутацию альтернативного сайта старта (дополнительный рисунок 4c). Наконец, для идентификации колоний, нокаутированных по STAG2, продукты ПЦР очищали на колонке и отправляли на секвенирование по Сэнгеру с использованием обратного праймера ПЦР. Только колонии, которые показали мутацию сдвига рамки считывания, считались положительными (дополнительный рис. 6f).

ПЦР-праймеры:

Контрольный (OR2W5) прямой праймер: 5′-TCGGCCTGGACTGGAGAAAA-3 ′

Control (OR2W5) обратный праймер: 5′-GAGACCACTGTGAGGTGAA-3 ′

GATAGAG1-прямой праймер 3 '

GATA1-Короткий обратный праймер: 5'-ATTTCCAAGTGGGTTTTGAGGAT-3'

GATA1-Длинный прямой праймер: 5'-GCCACACTGAGAGGCAATACT-3 '

GATA1-Длинный обратный праймер 9AGGATA 9'-AACCAAGTC9GATA 9' -ACCAAGTC9 -прямой праймер: 5'-CCACAAAGAGGCTGTCACAGTT-3 '

STAG2-обратный праймер: 5'-CATGCAGCAGAAAATGAATCAAAAC-3'

Вестерн-анализ

MEP были отсортированы и CRISPR / Cas9 электропорировали, как описано выше.После электропорации MEP культивировали в среде для дифференцировки эритромиелоидов (как описано выше для анализов отдельных клеток in vitro) в течение 3 дней. Затем 1 × 10 5 клеток лизировали в буфере RIPA (ThermoFisher, 899000), содержащем ингибиторы протеаз и фосфатаз (ThermoFisher, 78446). Затем образцы центрифугировали при 12000 г в течение 5 минут при 4 ° C и супернатанты использовали для Вестерн-анализа. Вестерн-анализ выполняли на капиллярной платформе Wes на основе размера (ProteinSimple) с использованием капиллярного картриджа 12–230 кДа в соответствии с протоколом производителя.Чтобы определить оптимальное разведение антител, антитело против GATA-1 (Cell Signaling D24E4) титровали перед использованием на лизате из CD34 + пуповинной крови, и в образцах использовали разведение 1: 5.

Исследования на животных

Все эксперименты на мышах были одобрены Комитетом по уходу за животными Университетской сети здравоохранения (UHN), и мы соблюдали все соответствующие этические нормы для испытаний и исследований на животных. Все трансплантаты мыши были выполнены самкам NOD в возрасте от 8 до 12 недель.Cg-Prkdc scid Il2rg tm1Wjl / SzJ (NSG) мыши (JAX), которые были сублетально облучены 225 сГр за 24 ч до трансплантации или в течение 8–12 недель. старая самка NOD.Cg-Prkdc scid Il2rg tm1Wjl Kit em1Mvw / SzJ (NSGW41) мыши, которые не были облучены. Размер выборки был выбран так, чтобы дать достаточную мощность для определения значимости с помощью стандартных статистических тестов.Внутрибедренные инъекции выполняли, как описано в Mazurier et al., 59 . Для этого мышей анестезировали изофлураном, а правое колено фиксировали в согнутом положении, чтобы просверлить отверстие в RF с помощью иглы 27 калибра. Затем 100–250 LT-HSC, редактируемых CRISPR / Cas9, вводили в 30 мкл PBS с использованием шприца ½ см 3 калибра 28 (Becton Dickinson, 329461). Количество клеток LT-HSC основано на количестве клеток, отсортированных с помощью проточной цитометрии, в день 0. Через 12 или 24 недели мышей умерщвляли для получения RF и BM (левой бедренной кости и обеих большеберцовых костей, BM).Кости промывали 1 мл PBS + 2,5% FBS и клетки центрифугировали при 350 × g в течение 10 мин. Клетки ресуспендировали в 500 мкл PBS + 2,5% FBS. Затем клетки BM и RF подсчитывали в хлориде аммония (StemCell Technologies, 07850) с использованием Vicell XR (Beckman Coulter). Всего для анализа проточной цитометрии использовали 25 мкл клеток, а еще 25 мкл заморозили для выделения геномной ДНК, чтобы проверить изменения CRISPR / Cas9 (тот же протокол, что и выше для анализов одиночных клеток in vitro).

Анализы с ограниченным разведением in vivo

Для анализов трансплантации с ограниченным разведением контрольные гРНК CRISPR / Cas9, электропорированные LT-HSC, вводили в определенных дозах (эквивалентных 25, 50, 100 и 200 LT-HSC) в 8-12 клеток. недельных самок мышей NSG или NSGW41. Количество клеток LT-HSC было основано на количестве клеток, отсортированных с помощью проточной цитометрии в день 0. Частоту LT-HSC оценивали с помощью онлайн-инструмента ELDA (http://bioinf.wehi.edu.au/software/elda/index.html ) 36 .

Проточная цитометрия анализов in vivo

Клетки из RF и BM трансплантированных мышей окрашивали в 96-луночных планшетах с U-дном (Corning, 351177) в течение 45 минут при 4 ° C.Были использованы следующие антитела (все от BD Biosciences, если не указано иное): CD45 APC-Cy7 (1: 100, 348795560566), CD45 A700 (1: 100, 560566), CD33 APC (1: 100, 340474) и CD19. V450 (1: 100, 560353), CD41 PE-Cy5 (1: 200, Beckman Coulter, 6607116), GlyA PE (1: 100, Beckman Coulter, IM2211U) и CD3 FITC (1: 100, 349201). Для мышей NSGW41 через 12 недель окрашивание CD3 FITC не проводили. Клетки анализировали на FACSCelesta (BD Biosciences).

Эффективность CRISPR / Cas9 в клетках и прививаемых мышах

После каждой электропорации CRISPR / Cas9 RNP небольшую субпопуляцию клеток культивировали в среде X-VIVO 10 (как описано выше) в течение 5-7 дней для проверки CRISPR / Эффективность Cas9.Геномную ДНК выделяли из основной массы клеток, а сконструированный геномный локус CRISPR / Cas9 амплифицировали с помощью ПЦР, как описано выше. Секвенирование по Сэнгеру проводили с использованием праймера для обратной ПЦР, а хроматограммы анализировали с помощью онлайн-инструмента TIDE (https://tide.deskgen.com/) 60 для проверки редактирования CRISPR / Cas9 в контроле, GATA1-Short и GATA1-Долго редактируемые объемные ячейки. Из-за большого размера делеции контрольных (200 п.н.) и клеток, отредактированных GATA1-Short (400 п.н.), эффективность CRISPR / Cas9 оценивалась на основе процента аберрантных последовательностей после сайта разрезания гРНК (дополнительный рис.7д).

Для каждой трансплантированной мыши эффективность контрольных клеток CRISPR / Cas9 и клеток, отредактированных GATA1-Short, оценивали в РФ с использованием того же подхода. В анализе использовали только мышей, которые показали эффективность нокаута CRISPR / Cas9> 90%, как определено процентом аберрантных последовательностей после участка разрезания гРНК и уровнем приживления CD45 + в РФ> 5%. Поскольку для GATA1-Short требовалось отредактировать только одну Х-хромосому, приживление одного клона было видно на основе отдельных хроматограмм (дополнительный рис.7f). LT-HSC с коротким редактированием GATA1, которым трансплантировали мышей с более чем одним клоном, были включены в наш анализ ксенотрансплантации, близкий к клональному, при условии, что эффективность нокаута CRISPR / Cas9> 90% и критерии приживления> 5%.

Анализ образования колоний с метилцеллюлозой

Всего 1 × 10 5 клеток из РФ ксенотрансплантированных мышей переносили в 1 мл метилцеллюлозной среды MethoCult h5034 Optimum (StemCell Technologies, 04034) и высевали на 35-миллиметровую чашку для человека. специфическое колониеобразование.Через 10–11 дней отдельные колонии собирали, промывали в PBS и выделяли геномную ДНК, как описано выше. Индивидуальные изменения CRISPR / Cas9 определяли с помощью амплификации ПЦР и секвенирования по Сэнгеру с обратным праймером ПЦР, как описано выше.

Морфология клетки

RF и BM генетически верифицированных контрольных мышей и мышей NSGW41 с коротко отредактированными LT-HSC, отредактированными GATA1, размораживали и пять образцов для каждого условия объединяли вместе. Мышиные клетки истощали из каждого объединенного образца с использованием набора Mouse Depletion Kit (Miltenyi Biotec).Клетки окрашивали в течение 30 мин при 4 ° C следующими антителами: CD45 V500 (1: 100, 560777, HI30), GlyA PE (1: 100, Beckman Coulter, IM2211U) и CD41 PE-Cy5 (1: 200, Бекман Коултер, 6607116, P2). Отсортированные GlyA + CD45 - клетки из РФ промывали в PBS с 2,5% FBS, а затем подвергали цитоспиннированию с использованием прибора CytoSpin 4 (112 × г в течение 10 мин, высокое ускорение, ThermoFisher) в соответствии с инструкциями производителя. Отсортированные по CD41 + клетки из BM цитоспиннировали при 55 × g в течение 10 мин со средним ускорением.

Анализ нецелевых CRISPR / Cas9

Геномные локусы, которые были подобны целевой последовательности гРНК, были идентифицированы с помощью Cas0-OFFinder (http://www.rgenome.net/cas-offinder) 61 с использованием номера несоответствия 2–4 и размер выпуклости ДНК / РНК, равный 0. Два геномных локуса с 2 несовпадениями и 10 геномных локусов с 3 несовпадениями были выбраны для GATA1-Short gRNA-1, 8 геномных локусов с 3 несовпадениями и 1 геномный локус с 4 несовпадениями. для GATA1-Short gRNA-2, 4 геномных локуса с 3 несовпадениями и 7 геномных локусов с 4 несовпадениями для GATA1-Long gRNA-1, 3 геномных локуса с 2 несовпадениями, 2 геномных локуса с 3 несовпадениями и 6 геномных локусов с 4 несовпадениями для Контрольная гРНК-1 и 1 геномный локус с 3 несовпадениями и 11 геномных локусов с 4 несовпадениями для контрольной гРНК-2.Праймеры для ПЦР были разработаны для амплификации 500 п.н. вокруг этих геномных локусов. 20–30 колоний одиночных клеток, которые были положительно идентифицированы с помощью правильного редактирования CRISPR / Cas9, были отобраны из каждого типа клеток и генотипированы для амплификации с помощью ПЦР. Продукты ПЦР очищали на колонке и проводили последующее секвенирование по Сэнгеру с использованием как прямого, так и обратного праймера для ПЦР. Анализ TIDE использовали для оценки эффективности расщепления CRISPR / Cas9.

ПЦР-праймеры:

FW_GATA1Short_gRNA1_chr4_118059061: 5'-CCCTCAAACTTCCCGACTAAGG-3 '

RV_GATA1Short_gRNA1_chr4_118059061: 5'-GCTCAGATGTGACTGGGCG-3'

FW_GATA1Short_gRNA1_chr16_35544187: 5'-CGCAGGTTTAGCAAAGTTCCC-3 '

RV_GATA1Short_gRNA1_chr16_35544187: 5'-CCAGATGGGTTTCTGCTTTTACGA-3'

FW_GATA1Short_gRNA1_chr22_44756609: 5'-GGGTTTTTCTGGGCTGCAAG-3 '

RV_GATA1Short_gRNA1_chr22_44756609: 5'-ACATAATAGTATTGCAGTAATGCGG-3'

FW_GATA1Short_gRNA1_chr19_32673314: 5'-CTCTAGGGCCGCTTCTCAGT-3 '

RV_GATA1Short_gRNA1_chr19_32673314: 5'-ACGCTACATAGGGTCGTTCC-3'

FW_GATA1Short_gRNA1_chr15_52109094: 5'- GTTTGGACTGGTCGAGCCT-3 '

RV_GATA1Short_gRNA1_chr15_52109094: 5'-GAGTGCGAACCTCTCATCTCTC-3'

FW_GATA1Short_gRNA1_chr10_53712490: 5'-CCAGTCAAGCACCTAGCGTA-3 '

RV_GATA1Short_gRNA1_chr10_53712490: 5'-GACTAGAAAGGCCTGAACCTCT-3'

FW_GATA1Short_gRNA1_chr14_72742463: 5'-GGTCCCTTCCAGCACGTAAT-3 '

RV_GATA1Short_gRNA1_chr14_72742463: 5'-CCTCCCAATCCGGGAACAAC-3'

FW_GATA1Short_gRNA1_chr16_71816748: 5'-TCTGGGGTACTAGAGGGGAAC-3 '

RV_GATA1Short_gRNA1_chr16_71816748: 5'-TCAGGCCAGCATACATCGTG-3'

FW_GATA1Short_gRNA1_chr1_223704955: 5'-CTGAAATGTCGGCCCTGCAA-3 '

RV_GATA1Short_gRNA1_chr1_223704955: 5'-CCGAGGATGTAGTCATGGTGG-3'

FW_GATA1Short_gRNA1_chr17_80332977: 5'-CCTTGGGTCTGCGTGAAGAT-3 '

RV_GATA1Short_gRNA1_chr17_80332977: 5'-AGTCACCTCTTAACTCTAACAGAAA-3'

FW_GATA1Short_gRNA1_chr10_20221643: 5'-AGTGCAGTTAGAACAGACCAGC-3 '

RV_GATA1Short_gRNA1_chr10_20221643: 5 '-GACAGACCTGTCAATCTGCTTTAT-3'

FW_GATA1Short_gRNA1_chr18_8376641: 5'-GAGGACTGGCTGTTTCATCG-3 '

RV_GATA1Short_gRNA1_chr18_8376641: 5'-CACTATTCTCAGGAGCGGTCT-3'

FW_GATA1Short_gRNA2_chr5_178537945: 5'-CATGACAGGCGCCTTCTTTACT-3 '

RV_GATA1Short_gRNA2_chr5_17853794 5: 5'-GAACATCTCCCCTTCAGCTCCT-3 '

FW_GATA1Short_gRNA2_chr13_113094529: 5'-TAGGTGTTGAACATGACCGTGG-3'

RV_GATA1Short_gRNA2_chr13_113094529: 5'-ACAAAGTGCTGCTGAGACAGAG-3 '

FW_GATA1Short_gRNA2_chr21_42868084: 5'-AGCACACAACCTTCAAAAGACG-3'

RV_GATA1Short_gRNA2_chr21_42868084: 5'-GTGGGTGGAATGTCACCTTACT -3 '

FW_GATA1Short_gRNA2_chr10_123397080: 5'-AATGCTGAGAGGCTTCCATTCC-3'

RV_GATA1Short_gRNA2_chr10_123397080: 5'-CAAGATGTGCCTCCTCTCTGTG-3 '

FW_GATA1Short_gRNA2_chr8_35663175: 5'-TCACAAGTTTGTTAGAGCGGTG-3'

RV_GATA1Short_gRNA2_chr8_35663175: 5'-TGCTCTCAGCAGTAGATCTGG-3 '

FW_GATA1Short_gRNA2_chr8_107174119 : 5'-CTCAGCGAGGCACAGAATTG-3 '

RV_GATA1Short_gRNA2_chr8_107174119: 5'-AGCGGCTACCCCATAATAGC-3'

FW_GATA1Short_gRNA2_chr12_2085541: 5'-TTAAGGCAATGTCAACCTTTTCCA-3 '

RV_GATA1Short_gRNA2_chr12_2085541: 5'-AGACGATGCAGGACCACCTA-3'

FW_GATA1Short_gRNA2_chr3 _127784219: 5'-TAACCCCCTTTGGGAGCACA-3 '

RV_GATA1Short_gRNA2_chr3_127784219: 5'-GCAGTGGGACGGCTATATCT-3'

FW_GATA1Short_gRNA2_chr7_17679912: 5'-AGTATGCACATCCAGTTGGGG-3 '

RV_GATA1Short_gRNA2_chr7_17679912: 5'-CTGCTTGCACTGCTTAACGA-3'

FW_GATA1Long_gRNA_chr8_109403836: 5'-CCCAAATATCAGTTCCATTGGGC -3 '

RV_GATA1Long_gRNA_chr8_109403836: 5'-GCAGCTGTTAACAAGAGAGTGC-3'

FW_GATA1Long_gRNA_chr3_77895170: 5'-TTCCTCGCATCACATACGCC-3 '

RV_GATA1Long_gRNA_chr3_77895170: 5'-ACCAGATTTCAGCCACTTGGA-3'

FW_GATA1Long_gRNA_chr4_22175316: 5'-AGCGCTTGAATACCTTCAGCAT-3 '

RV_GATA1Long_gRNA_chr4_22175316 : 5'-GGAGGTGGCACAAGGTAGGTA-3 '

FW_GATA1Long_gRNA_chr13_51458879: 5'-AGAATGGTGACCCTGGCTTA-3'

RV_GATA1Long_gRNA_chr13_51458879: 5'-ATTGGCTGGACAGTTTCGC-3 '

FW_GATA1Long_gRNA_chr15_62326516: 5'-TAGGCGGGAATGTCAAAGCC-3'

RV_GATA1Long_gRNA_chr15_62326516: 5'-GAGCTGGGACCCAC GATAAAA-3 '

FW_GATA1Long_gRNA_chr8_812

  • : 5'-AACGGGCACTTTAACAGGGAA-3'

    RV_GATA1Long_gRNA_chr8_812

  • : 5'-AACCTTTGTCAGACCAACTCTGT-3 '

    FW_GATA1Long_gRNA_chr7_40859472: 5'-AAGCTCGTTTGCTGCTTTACTG-3'

    RV_GATA1Long_gRNA_chr7_40859472: 5'-CTCCGCTCTTATGCTCTCTAGC-3 '

    FW_GATA1Long_gRNA_chr12_20017977: 5'-ATTAGGTCAGTCCAAGCCAACA-3 '

    RV_GATA1Long_gRNA_chr12_20017977: 5'-TCTCCCTCTTATCAATACCCCCAAC-3'

    FW_GATA1Long_gRNA_chr12_94844478: 5'-TTGCTAGATACAGTCCTTGCCTG-3 '

    RV_GATA1Long_gRNA_chr12_94844478: 5'-CCATTGTCTTGCAGATGTTCTCA-3'

    FW_GATA1Long_gRNA_chr2_15662510: 5'-ACCGACATGGGCCTAAGGATA -3 '

    RV_GATA1Long_gRNA_chr2_15662510: 5'-GGCAGCTTGTCTTGAGAATGG-3'

    FW_GATA1Long_gRNA_chr9_76619884: 5'-ATCCCTCTCAAGCAGCCTAAT-3 '

    RV_GATA1Long_gRNA_chr9_76619884: 5'-ATTTGCTCACAGAGAAATCACACCA-3'

    FW_Control_gRNA1_chr7_3081168: 5'-AAATTATCCACATTAATCGGGAAGCC-3 '900 09

    RV_Control_gRNA1_chr7_3081168: 5'-TTGTTTCAAAATATCACCGTTGGCA-3 '

    FW_Control_gRNA1_chr7_1356

  • : 5'-CTTTGAGTCTTTCCTCCCATGC-3'

    RV_Control_gRNA1_chr7_1356

  • : 5'-ACTGGGGGTAGCTCTAGTTGAA-3 '

    FW_Control_gRNA1_chr3_55088990: 5'-CTGTGTCACTTGGCTCGTCT-3'

    RV_Control_gRNA1_chr3_55088990: 5 ' -CATGTAGTGAGTACCGGGGC-3 '

    FW_Control_gRNA1_chr5_4882788: 5'-AGCAGCCAACTTGGAAACATAAG-3'

    RV_Control_gRNA1_chr5_4882788: 5'-AATCAGGCCTCAGAACCATCTT-3 '

    FW_Control_gRNA1_chr16_48579049: 5'-TTACCACACTCCACTCCTCTGT-3'

    RV_Control_gRNA1_chr16_48579049: 5'-CCTGTGTTCCTGAACCTCCTAAT-3 '

    FW_Control_gRNA1_chr1_1

  • 674: 5'-ATCCAAGCATACATGACAGAGAT-3 '

    RV_Control_gRNA1_chr1_1674: 5'-GTATCTTGTGGGCACAACCTTT-3'

    FW_Control_gRNA1_chr12_114950867: 5'-CAATCCTGCCACATTTCTGCATAC-3 '

    RV_Control_gRNA1_chr12_114950867: 5'-CTTGCCTGTCTCTCAAAGCATC-3'

    FW_Control_gRNA1_ chr21_34622361: 5'-AGGATTTCAGCTCTAGCAACCA-3 '

    RV_Control_gRNA1_chr21_34622361: 5'-CCCCATTTTAGACTTATGCCCCC-3'

    FW_Control_gRNA1_chr2_30448683: 5'-CGTAATAGCGCTTGTGTTTCAGT-3 '

    RV_Control_gRNA1_chr2_30448683: 5'-GCTAGATGACTGAGTTGGCAC-3'

    FW_Control_gRNA1_chr6_169886852: 5'-AACAGATGATTCTGCAGGCAAAC -3 '

    RV_Control_gRNA1_chr6_169886852: 5'-GACGATCTTTTAGCTGTCCCCA-3'

    FW_Control_gRNA1_chr20_52425093: 5'-CAACCTGTACTCTGGGACGTAG-3 '

    RV_Control_gRNA1_chr20_52425093: 5'-CGTGGAAACTTCTTCCTTGTCG-3'

    FW_Control_gRNA2_chr4_1100146: 5'-TGTAAAGGCGTGCTGTTGGT-3 '

    RV_Control_gRNA2_chr4_1100146 : 5'-ATCTGACGGTGTTGTGACTGG-3 '

    FW_Control_gRNA2_chr16_85653916: 5'-GTGTGTGTGAAGGCCGGTA-3'

    RV_Control_gRNA2_chr16_85653916: 5'-CTCCACAATGAGGCGTTCCC-3 '

    FW_Control_gRNA2_chr2_118858930: 5'-CAGGAGACGCTCCAAGTCG-3'

    RV_Control_gRNA2_chr2_118858930: 5'-TCCCTCACGTACCAGTCGG- 3 '

    FW_Control_gRNA2_chr21_42232307: 5'-ATGGACCAACTCTCACAGCA-3'

    RV_Control_gRNA2_chr21_42232307: 5'-GGCCTCCATTTGAGAACGTG-3 '

    FW_Control_gRNA2_chr12_12496109: 5'-TGTGGCGTGTAGGTAAAGAGAC-3'

    RV_Control_gRNA2_chr12_12496109: 5'-TGTATCTGAGGTGAACCACTGC-3 '

    FW_Control_gRNA2_chr19_18226209: 5 '-GACACCCAGAGTTCATTGTGAG-3'

    RV_Control_gRNA2_chr19_18226209: 5'-GCTTTTGGTGAATCAGAGCATCC-3 '

    FW_Control_gRNA2_chr14_96046026: 5'-CATGGTGTGGACTGTTTCTGTT-3'

    RV_Control_gRNA2_chr14_96046026: 5'-AGGTTTTGCCAAGCTCTACACA-3 '

    FW_Control_gRNA2_chr5_2514714: 5'-CACAGGGTTTGGTGTTTGTAGG-3'

    RV_Control_gRNA2_chr5_2514714: 5'-TGATCTGGCTTGACTTGCTTCC-3 '

    FW_Control_gRNA2_chr8_10811909: 5'-AGGAAGACAAATCCTAAGACAGCC-3'

    RV_Control_gRNA2_chr8_10811909: 5'-AAGTTTTACGTTTTCCTCGACCAC-3 '

    FW_Control_gRNA2_chr3_122079794: 5'-AGATAAGCCAAGCCAGATTCTTCA-3'

    RV_Control_gR NA2_chr3_122079794: 5'-CTGCTTGGAATTCCCACATTACTC-3 '

    FW_Control_gRNA2_chr7_2644811: 5'-GTTTATAGACAACCCACTGAGCAC-3'

    RV_Control_gRNA2_chr7_2644811: 5'-CTCATTGGCACTACTGCAGAGAAA-3 '

    FW_Control_gRNA2_chr15_54082949: 5'-ACTCATCTTAAGGAACCGTCGC-3'

    RV_Control_gRNA2_chr15_54082949: 5'-CATAGCCACATCCAAAGGTCCA -3 ′

    Анализ кариотипа

    Клетки пуповинной крови с истощенными клонами были разморожены и клетки CD34 + CD38 - были отсортированы с использованием CD34 APC-Cy7 (клон 581, индивидуальная конъюгация) и CD38 PE-Cy7 (335825, HB7) .Клетки предварительно культивировали в течение 36–48 ч в бессывороточной среде и затем подвергали электропорации, как описано выше. После инкубации в течение ночи среду меняли на IMDM (Thermo Fisher, 12440061) с 10% FBS (Sigma, 15A085), 1 × l-глутамин (Thermo Fisher, 25030081), 1 × пенициллин-стрептомицин (Thermo Fisher, 15140122) и следующие цитокины (все от Miltenyi Biotec): FLT3L (100 нг / мл), G-CSF (10 нг / мл), SCF (100 нг / мл), TPO (15 нг / мл) и IL-6 (10 нг) / мл), чтобы обеспечить рост клеток. В дальнейшем было выполнено кариотипирование хромосом по стандартным методикам.Готовили метафазные слайды, затем связывали трипсином и окрашивали красителем Лейшмана. Слайды с G-полосой сканировали и метафазы фиксировали с помощью автоматизированной системы визуализации (MetaSystems). Метафазы анализировали с помощью программного обеспечения для анализа изображений Ikaros (MetaSystems). Для каждого состояния 20 метафаз были проанализированы кариотипированием с G-полосой на числовые и структурные аномалии.

    Статистический анализ

    Планки погрешностей представляют собой стандартные отклонения. Статистическая значимость оценивалась с помощью двустороннего непарного теста студента t .

    Сводка отчетов по наукам о жизни

    Дополнительная информация о дизайне экспериментов доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

    Сводка отчетов

    Дополнительная информация о дизайне исследований доступна в Сводке отчетов о научных исследованиях, связанных с этой статьей.

    T. Конрад Гиллиам | Комитет по генетике, геномике и системной биологии

  • Kara S, Hanna A, Pirela-Morillo GA, Gilliam CT, Wilson GD.Сетевой подход к молекулярному взаимодействию (MINA) определяет ассоциацию новых генов-кандидатов болезней. МетодыX. 2019; 6: 1286-1291. Просмотр: PubMed

  • Sulakhe D, D'Souza M, Wang S, Balasubramanian S, Athri P, Xie B, Canzar S, Agam G, Gilliam TC, Maltsev N. Изучение функционального воздействия альтернативного сплайсинга на изоформы белков человека с использованием доступных источников аннотаций. Краткий биоинформ. 2019 09 27; 20 (5): 1754-1768. Смотреть в: PubMed

  • Xie B, Laxman B, Hashemifar S, Stern R, Gilliam TC, Maltsev N, White SR.Экспрессия хемокинов в раннем ответе на повреждение эпителиальных клеток дыхательных путей человека. PLoS One. 2018; 13 (3): e0193334. Смотреть в: PubMed

  • Bainer RO, Trendowski MR, Cheng C, Pei D, Yang W, Paugh SW, Goss KH, Skol AD, Pavlidis P, Pui CH, Gilliam TC, Evans WE, Onel K. Сигнатура гена апоптоза, регулируемая p53, предсказывает лечение ответ и исход при остром лимфобластном лейкозе у детей. Cancer Manag Res. 2017; 9: 397-410. Смотреть в: PubMed

  • Sulakhe D, Xie B, Taylor A, D'Souza M, Balasubramanian S, Hashemifar S, White S, Dave UJ, Agam G, Xu J, Wang S, Gilliam TC, Maltsev N.Lynx: база знаний и аналитический инструмент для интегративной медицины. Nucleic Acids Res. 2016, 04 января; 44 (D1): D882-7. Смотреть в: PubMed

  • Xie B, Agam G, Balasubramanian S, Xu J, Gilliam TC, Maltsev N, Börnigen D. Приоритезация гена болезни с использованием сети и функции. J Comput Biol. 2015 Apr; 22 (4): 313-23. Смотреть в: PubMed

  • Дубчак И., Баласубраманиан С., Ван С., Джем М., Мейден К., Сулахе Д., Поляков А., Бёрниген Д., Се Б., Тейлор А., Ма Дж., Пациорковский А.Р., Мирзаа Г.М., Дэйв П., Агам Г., Сюй Дж., Аль-Газали Л., Мейсон К.Э., Росс М.Э., Мальцев Н., Гиллиам Т.К.Интегративный вычислительный подход для определения приоритетов геномных вариантов. PLoS One. 2014; 9 (12): e114903. Смотреть в: PubMed

  • Sulakhe D, Taylor A, Balasubramanian S, Feng B, Xie B, Börnigen D, Dave UJ, Foster IT, Gilliam TC, Maltsev N. Веб-сервисы Lynx для аннотаций и системного анализа мультигенных расстройств. Nucleic Acids Res. 2014 июл; 42 (проблема с веб-сервером): W473-7. Смотреть в: PubMed

  • Sulakhe D, Balasubramanian S, Xie B, Berrocal E, Feng B, Taylor A, Chitturi B, Dave U, Agam G, Xu J, Börnigen D, Dubchak I, Gilliam TC, Maltsev N.Высокопроизводительная трансляционная медицина: проблемы и решения. Adv Exp Med Biol. 2014; 799: 39-67. Смотреть в: PubMed

  • Sulakhe D, Balasubramanian S, Xie B, Feng B, Taylor A, Wang S, Berrocal E, Dave U, Xu J, Börnigen D, Gilliam TC, Maltsev N. Lynx: база данных и механизм извлечения знаний для интегративной медицины. Nucleic Acids Res. 2014 Янв; 42 (Проблема с базой данных): D1007-12. Смотреть в: PubMed

  • Xu H, Cheng R, Juo SH, Liu J, Loth J.E, Endicott J, Gilliam C, Baron M.Точное картирование областей-кандидатов на биполярное расстройство дает убедительные доказательства локусов восприимчивости на хромосомах 7q. . 2011 Март; 156 (2): 168-76. Смотреть в: PubMed

  • Lajonchere CM. Изменение ландшафта исследований аутизма: обмен генетическими ресурсами аутизма. Нейрон. 21 октября 2010 г .; 68 (2): 187-91. Смотреть в: PubMed

  • Струг Л.Дж., Суреш Р., Файер А.Дж., Талати А., Адамс ПБ, Ли В., Ходж С.Е., Гиллиам Т.К., Вайсман ММ. Паническое расстройство связано с геном переносчика серотонина (SLC6A4), но не с промоторной областью (5-HTTLPR).Мол Психиатрия. 2010 фев; 15 (2): 166-76. Смотреть в: PubMed

  • Иосифов И., Чжэн Т., Барон М., Гиллиам Т.С., Ржецкий А. Картирование генетического сцепления сложных наследственных заболеваний с полногеномной сетью молекулярного взаимодействия. Genome Res. 2008 июл; 18 (7): 1150-62. Смотреть в: PubMed

  • Christian SL, Brune CW, Sudi J, Kumar RA, Liu S, Karamohamed S, Badner JA, Matsui S, Conroy J, McQuaid D, Gergel J, Hatchwell E, Gilliam TC, Gershon ES, Nowak NJ, Dobyns WB, Готовьте EH.Новые субмикроскопические хромосомные аномалии, обнаруженные при расстройстве аутистического спектра. Биол Психиатрия. 15 июня 2008 г .; 63 (12): 1111-7. Смотреть в: PubMed

  • Ponder CA, Huded CP, Munoz MB, Gulden FO, Gilliam TC, Palmer AA. Быстрая реакция отбора для контекстуальной обусловленности страха в помеси C57BL / 6J и A / J: поведенческий, QTL и анализ экспрессии генов. Behav Genet. 2008 May; 38 (3): 277-91. Смотреть в: PubMed

  • Кумар Р.А., КараМохамед С., Суди Дж., Конрад Д.Ф., Брун К., Баднер Дж. А., Гиллиам Т.К., Новак, штат Нью-Джерси, Кук Е.Х., Добинс В.Б., Кристиан С.Л.Рецидивирующие микроделеции 16p11.2 при аутизме. Hum Mol Genet. 2008 15 февраля; 17 (4): 628-38. Смотреть в: PubMed

  • Ponder CA, Munoz M, Gilliam TC, Palmer AA. Генетическая архитектура кондиционирования страха в штаммах с заменой хромосом: связь с показателями врожденного (необученного) тревожного поведения. Мамм Геном. 2007 Apr; 18 (4): 221-8. Смотреть в: PubMed

  • Себат Дж., Лакшми Б., Малхотра Д., Троге Дж., Лезе-Мартин К., Уолш Т., Ямром Б., Юн С., Красниц А., Кендалл Дж., Леотта А., Пай Д., Чжан Р., Ли Ю. Х., Хикс Дж., Спенс SJ, Lee AT, Puura K, Lehtimäki T, Ledbetter D, Gregersen PK, Bregman J, Sutcliffe JS, Jobanputra V, Chung W, Warburton D, King MC, Skuse D, Geschwind DH, Gilliam TC, Ye K, Wigler M.Сильная связь мутаций числа копий de novo с аутизмом. Наука. 2007 Apr 20; 316 (5823): 445-9. Смотреть в: PubMed

  • Картирование локусов риска аутизма с использованием генетического сцепления и хромосомных перестроек. Нат Жене. 2007 Март; 39 (3): 319-28. Смотреть в: PubMed

  • Ponder CA, Kliethermes CL, Drew MR, Muller J, Das K, Risbrough VB, Crabbe JC, Gilliam TC, Palmer AA. Выбор контекстуальной обусловливания страха влияет на поведение, подобное тревоге, и на экспрессию генов.Гены поведения мозга. 2007 ноя; 6 (8): 736-49. Смотреть в: PubMed

  • Мартинес-Мир А., Злотогорски А., Гордон Д., Петухова Л., Мо Дж., Гиллиам Т.С., Лондоно Д., Хейнс К., Отт Дж., Хординский М., Нанова К., Норрис Д., Прайс В., Дувик М., Кристиано А. М.. Полногеномное сканирование на сцепление выявляет доказательства нескольких локусов восприимчивости к очаговой алопеции. Am J Hum Genet. 2007 фев; 80 (2): 316-28. Смотреть в: PubMed

  • Xu H, Kellendonk CB, Simpson EH, Keilp JG, Bruder GE, Polan HJ, Kandel ER, Gilliam TC.Полиморфизм DRD2 C957T взаимодействует с полиморфизмом COMT Val158Met в способности рабочей памяти человека. Schizophr Res. 2007 фев; 90 (1-3): 104-7. Смотреть в: PubMed

  • Huster D, Finegold MJ, Morgan CT, Burkhead JL, Nixon R, Vanderwerf SM, Gilliam CT, Lutsenko S. Последствия накопления меди в печени мышей с нокаутом Atp7b - / - (ген болезни Вильсона). Am J Pathol. 2006 фев; 168 (2): 423-34. Смотреть в: PubMed

  • Cheng R, Juo SH, Loth JE, Nee J, Iossifov I, Blumenthal R, Sharpe L, Kanyas K, Lerer B, Lilliston B, Smith M, Trautman K, Gilliam TC, Endicott J, Baron M.Полногеномное сканирование сцепления в большой выборке биполярного расстройства из инициативы генетики Национального института психического здоровья предлагает предполагаемые локусы биполярного расстройства, психоза, самоубийства и панического расстройства. Мол Психиатрия. 2006 Mar; 11 (3): 252-60. Смотреть в: PubMed

  • Йонан А.Л., Палмер А.А., Гиллиам ТК. Нарушение равновесия Харди-Вайнберга выявило ошибку генотипирования полиморфизма промотора транспортера серотонина (SLC6A4). Psychiatr Genet. 2006 фев; 16 (1): 31-4. Смотреть в: PubMed

  • Маккуин М.Б., Девлин Б., Фараон С.В., Нимгаонкар В.Л., Склар П., Смоллер Дж. В., Абу Джамра Р., Альбус М., Бакану С. А., Барон М., Барретт Т. Б., Берреттини В., Блэкер Д., Байерли В., Цишон С., Кориелл В. , Крэддок Н., Дейли М.Дж., Депауло Дж. У, Маккиннон Д., Макиннис М.Г., МакМахон Ф.Дж., Мерфи Д.Л., Нотен М.М., Нюрнбергер Д.И., Пато CN, Пато М.Т., Potash JB, Propping P, Pulver AE, Rice JP, Rietschel M, Scheftner W, Schumacher J, Segurado R, Ван Стин К., Се В., Занди П.П., Лэрд Н.М.Комбинированный анализ одиннадцати исследований сцепления биполярного расстройства предоставляет убедительные доказательства локусов восприимчивости на хромосомах 6q и 8q. Am J Hum Genet. 2005 Oct; 77 (4): 582-95. Смотреть в: PubMed

  • Cheng R, Park N, Juo SH, Liu J, Loth JE, Endicott J, Gilliam TC, Baron M. Психоз и генетический спектр биполярного расстройства: данные анализа сцепления. Мол Психиатрия. 2006 Янв; 11 (1): 3-5. Смотреть в: PubMed

  • Палмер А.А., Вербицкий М., Суреш Р., Каменс Х.М., Рид К.Л., Ли Н., Беркхарт-Каш С., Маккиннон С.С., Белкнап Дж.К., Гиллиам Т.К., Филлипс Т.Дж.Различия в экспрессии генов у мышей, дивергентно отобранных по чувствительности к метамфетамину. Мамм Геном. 2005 May; 16 (5): 291-305. Смотреть в: PubMed

  • Bruder GE, Keilp JG, Xu H, Shikhman M, Schori E, Gorman JM, Gilliam TC. Генотипы катехол-O-метилтрансферазы (COMT) и рабочая память: ассоциации с различными когнитивными операциями. Биол Психиатрия. 2005 Dec 01; 58 (11): 901-7. Смотреть в: PubMed

  • Alarcón M, Yonan AL, Gilliam TC, Cantor RM, Geschwind DH.Количественное сканирование генома и анализ упорядоченных подмножеств эндофенотипов аутизма поддерживают языковые QTL. Мол Психиатрия. 2005 Aug; 10 (8): 747-57. Смотреть в: PubMed

  • Park N, Cheng R, Juo SH, Liu J, Loth JE, Endicott J, Gilliam TC, Baron M. Отсутствие психоза может повлиять на результаты сцепления при биполярном расстройстве. Мол Психиатрия. 2005 Mar; 10 (3): 235-7. Смотреть в: PubMed

  • Krauthammer M, Kaufmann CA, Gilliam TC, Rzhetsky A. Молекулярная триангуляция: мостиковая связь и информация о молекулярной сети для идентификации генов-кандидатов при болезни Альцгеймера.Proc Natl Acad Sci U S. A. 2004, 19 октября; 101 (42): 15148-53. Смотреть в: PubMed

  • Stone JL, Merriman B, Cantor RM, Yonan AL, Gilliam TC, Geschwind DH, Nelson SF. Доказательства наличия аллелей риска, специфичных для пола, при расстройствах аутистического спектра. Am J Hum Genet. 2004 Dec; 75 (6): 1117-23. Смотреть в: PubMed

  • Тадин-Стрэппс М., Уорбертон Д., Баумейстер Ф.А., Фишер С.Г., Йонан Дж., Гиллиам Т.С., Кристиано А.М. Клонирование точек останова при инверсии de novo хромосомы 8, inv (8) (p11.2q23.1) у пациента с синдромом Амбраса. Cytogenet Genome Res. 2004; 107 (1-2): 68-76. Смотреть в: PubMed

  • Гарсия Аросена Д., Луи ЭД, Тассон Ф, Гиллиам ТК, Оттман Р., Жакмонт С., Хагерман П.Дж. Скрининг расширенных аллелей FMR1 у пациентов с эссенциальным тремором. Mov Disord. 2004 Aug; 19 (8): 930-3. Смотреть в: PubMed

  • Себат Дж., Лакшми Б., Троге Дж., Александр Дж., Янг Дж., Лундин П., Манер С., Масса Х, Уокер М., Чи М., Навин Н., Люсито Р., Хили Дж., Хикс Дж., Йе К., Райнер А., Гиллиам Т.К., Траск Б., Паттерсон Н., Зеттерберг А., Виглер М.Полиморфизм крупномасштабного числа копий в геноме человека. Наука. 2004 Jul 23; 305 (5683): ​​525-8. Смотреть в: PubMed

  • Park N, Juo SH, Cheng R, Liu J, Loth JE, Lilliston B, Nee J, Grunn A, Kanyas K, Lerer B, Endicott J, Gilliam TC, Baron M. Анализ связи психоза в биполярных родословных предлагает роман предполагаемые локусы биполярного расстройства и общая предрасположенность к шизофрении. Мол Психиатрия. 2004 Dec; 9 (12): 1091-9. Смотреть в: PubMed

  • Морабия А., Росс Б.М., Костанза М.С., Каянис Э., Флаэрти М.С., Элвин ГБ, Дас К., Джеймс Р., Ян А.С., Еваграфов О., Гиллиам Т.К.Популяционное исследование генетической изменчивости и липидного профиля SR-BI. Атеросклероз. 2004 июл; 175 (1): 159-68. Смотреть в: PubMed

  • Verbitsky M, Yonan AL, Malleret G, Kandel ER, Gilliam TC, Pavlidis P. Измененный профиль транскрипта гиппокампа сопровождает возрастной дефицит пространственной памяти у мышей. Learn Mem. 2004 май-июнь; 11 (3): 253-60. Смотреть в: PubMed

  • Оттман Р., Винавер М.Р., Калачиков С., Баркер-Каммингс К., Гиллиам Т.С., Педли Т.А., Хаузер В.А. Мутации LGI1 при аутосомно-доминантной парциальной эпилепсии со слуховыми особенностями.Неврология. 2004 Apr 13; 62 (7): 1120-6. Смотреть в: PubMed

  • Мартинес-Мир А., Злотогорски А., Лондоно Д., Гордон Д., Грюн А., Урибе Е., Хорев Л., Руис И.М., Давалос Н.О., Алайан О., Лю Дж., Гиллиам Т.С., Салас-Аланис Ю.С., Кристиано А.М. Идентификация локуса точечной ладонно-подошвенной кератодермии I типа на хромосоме 15q22-q24. J Med Genet. 2003 Dec; 40 (12): 872-8. Смотреть в: PubMed

  • Kim S, Ruparel HD, Gilliam TC, Ju J. Цифровое генотипирование с использованием молекулярного сродства и масс-спектрометрии.Nat Rev Genet. 2003 Dec; 4 (12): 1001-8. Смотреть в: PubMed

  • Йонан А.Л., Палмер А.А., Смит К.С., Фельдман И., Ли Х.К., Йонан Дж.М., Фишер С.Г., Павлидис П., Гиллиам Т.К. Биоинформатический анализ генов-кандидатов от аутизма с использованием биологических баз данных и компьютерного прогнозирования генной сети. Гены поведения мозга. 2003 Oct; 2 (5): 303-20. Смотреть в: PubMed

  • Йонан А.Л., Аларкон М., Ченг Р., Магнуссон П.К., Спенс С.Дж., Палмер А.А., Гранн А., Джуо С.Х., Тервиллигер Д.Д., Лю Дж., Кантор Р.М., Гешвинд Д.Х., Гиллиам ТК.Полногеномный скрининг 345 семей на предмет выявления локусов предрасположенности к аутизму. Am J Hum Genet. 2003 Oct; 73 (4): 886-97. Смотреть в: PubMed

  • Morabia A, Cayanis E, Costanza MC, Ross BM, Flaherty MS, Alvin GB, Das K, Gilliam TC. Связь крайних фенотипических вариаций липидного профиля крови с 11 генами обратного транспорта холестерина и 10 негенетическими факторами риска сердечно-сосудистых заболеваний. Hum Mol Genet. 2003 Nov 01; 12 (21): 2733-43. Смотреть в: PubMed

  • Чен А., Муццио И.А., Маллерет Г., Барч Д., Вербицкий М., Павлидис П., Йонан А.Л., Вронская С., Гроды М.Б., Сепеда И., Гиллиам Т.С., Кандел Э.Р.Индуцируемое усиление памяти и синаптической пластичности у трансгенных мышей, экспрессирующих ингибитор белков ATF4 (CREB-2) и C / EBP. Нейрон. 2003 Aug 14; 39 (4): 655-69. Смотреть в: PubMed

  • Сегурадо Р., Детера-Уодли С.Д., Левинсон Д.Ф., Льюис С.М., Гилл М., Нюрнбергер Дж. И., Крэддок Н., ДеПауло-младший, Барон М., Гершон Е.С., Экхольм Дж., Сишон С., Туреки Дж., Клас С., Келсо Дж. Р., Шофилд PR, Badenhop RF, Morissette J, Coon H, Blackwood D, McInnes LA, Foroud T., Edenberg HJ, Reich T, Rice JP, Goate A, McInnis MG, McMahon FJ, Badner JA, Goldin LR, Bennett P, Willour VL, Занди П.П., Лю Дж., Гиллиам К., Юо С.Х., Берреттини В.Х., Йошикава Т., Пелтонен Л., Лённквист Дж., Нётен М.М., Шумахер Дж., Виндемут К., Ритшель М., Проппинг П., Майер В., Альда М., Гроф П., Руло, штат Джорджия. , Дель-Фаверо Дж., Ван Брокховен К., Мендлевич Дж., Адольфссон Р., Спенс М. А., Любберт Х., Адамс Л. Дж., Дональд Дж. А., Митчелл П. Б., Барден Н., Шинк Е., Байерли В., Мьюир В., Висшер П. М., Макгрегор С., Гурлинг H, Kalsi G, McQuillin A, Escamilla MA, Reus VI, Leon P, Freimer NB, Ewald H, Kruse TA, Mors O, Radhakrishna U, Blouin JL, Antonarakis SE, Akarsu N.Мета-анализ сканирования генома шизофрении и биполярного расстройства, часть III: Биполярное расстройство. Am J Hum Genet. 2003 июл; 73 (1): 49-62. Смотреть в: PubMed

  • Kljuic A, Bazzi H, Sundberg JP, Martinez-Mir A, O'Shaughnessy R, Mahoney MG, Levy M, Montagutelli X, Ahmad W., Aita VM, Gordon D, Uitto J, Whiting D, Ott J, Fischer S. , Гиллиам Т.К., Джахода КА, Моррис Р.Дж., Пантелеев А.А., Нгуен В.Т., Кристиано AM. Десмоглеин 4 в дифференцировке волосяных фолликулов и адгезии эпидермиса: данные по наследственному гипотрихозу и приобретенной пузырчатке обыкновенной.Клетка. 2003 Apr 18; 113 (2): 249-60. Смотреть в: PubMed

  • Morabia A, Cayanis E, Costanza MC, Ross BM, Bernstein MS, Flaherty MS, Alvin GB, Das K, Morris MA, Penchaszadeh GK, Zhang P, Gilliam TC. Связь между геном липопротеинлипазы (LPL) и липидами крови: общий вариант общего признака? Genet Epidemiol. 2003 May; 24 (4): 309-21. Смотреть в: PubMed

  • Лю Дж., Джуо С.Х., Деван А., Грюнн А., Тонг Х, Брито М., Пак Н., Лот Дж.Доказательства предполагаемого локуса биполярного расстройства на 2p13-16 и других потенциальных локусах на 4q31, 7q34, 8q13, 9q31, 10q21-24, 13q32, 14q21 и 17q11-12. Мол Психиатрия. 2003 Mar; 8 (3): 333-42. Смотреть в: PubMed

  • Zhang P, Sheng H, Morabia A, Gilliam TC. Алгоритм ЭМ оптимальной длины шага (OSLEM) для оценки частоты гаплотипов и его применение при генотипировании липопротеинлипазы. BMC Bioinformatics. 2003 15 января; 4: 3. Смотреть в: PubMed

  • Winawer MR, Martinelli Boneschi F, Barker-Cummings C, Lee JH, Liu J, Mekios C, Gilliam TC, Pedley TA, Hauser WA, Ottman R.Четыре новых семейства с аутосомно-доминантной парциальной эпилепсией со слуховыми особенностями: клиническое описание и сцепление с хромосомой 10q24. Эпилепсия. 2002 Jan; 43 (1): 60-7. Смотреть в: PubMed

  • Мартинес-Мир А., Лю Дж., Гордон Д., Вайнер М. С., Ахмад В., Файн Дж. Д., Отт Дж., Гиллиам Т. К., Кристиано А. М.. EB simplex superficialis является результатом мутации в гене коллагена VII типа. J Invest Dermatol. 2002 Mar; 118 (3): 547-9. Смотреть в: PubMed

  • Калачиков С., Евграфов О., Росс Б., Винавер М., Баркер-Каммингс К., Мартинелли Бонески Ф., Чой С., Морозов П., Дас К., Теплицкая Е., Ю. А., Каянис Е., Пенчасзаде Г., Коттманн А. Х., Педли Т. А., Хаузер В.А., Оттман Р., Гиллиам Т.К.Мутации в LGI1 вызывают аутосомно-доминантную парциальную эпилепсию со слуховыми особенностями. Нат Жене. 2002 Mar; 30 (3): 335-41. Смотреть в: PubMed

  • Alarcón M, Cantor RM, Liu J, Gilliam TC, Geschwind DH. Доказательства локуса количественного признака языка на хромосоме 7q в семьях с множественным аутизмом. Am J Hum Genet. 2002 Jan; 70 (1): 60-71. Смотреть в: PubMed

  • Лю Дж., Юо С.Х., Холопайнен П., Тервиллигер Дж., Тонг Х, Грюнн А., Брито М., Грин П., Мусталахти К., Мяки М., Гиллиам Т.К., Партанен Дж.Полногеномный анализ глютеновой болезни в финских семьях. Am J Hum Genet. 2002 Jan; 70 (1): 51-9. Смотреть в: PubMed

  • Лю Дж., Нихольт Д.Р., Магнуссен П., Парано Е., Павоне П., Гешвинд Д., Лорд С., Иверсен П., Хох Дж., Отт Дж., Гиллиам Т.С. Полногеномный скрининг локусов предрасположенности к аутизму. Am J Hum Genet. 2001 Aug; 69 (2): 327-40. Смотреть в: PubMed

  • Лю Дж., Джуо С.Х., Тервиллигер Дж. Д., Грюнн А, Тонг Х, Брито М, Лот Дж. Э., Каньяс К., Лерер Б., Эндикотт Дж., Пенчасзаде Дж., Гиллиам К.Последующее исследование сцепления подтверждает доказательства наличия локуса биполярного аффективного расстройства на хромосоме 21q22. Am J Med Genet. 2001 Mar 08; 105 (2): 189-94. Смотреть в: PubMed

  • Ranta S, Zhang Y, Ross B, Takkunen E, Hirvasniemi A, de la Chapelle A, Gilliam TC, Lehesjoki AE. Позиционное клонирование и характеристика гена DLGAP2 человека и его исключение при прогрессирующей эпилепсии с умственной отсталостью. Eur J Hum Genet. 2000 May; 8 (5): 381-4. Смотреть в: PubMed

  • Айта В.М., Ахмад В., Пантелеев А.А., Козловская Ю., Козловская А., Гиллиам Т.С., Яблонска С., Кристиано А.М.Новая миссенс-мутация (C622G) в домене «цинковые пальцы» гена безволосости человека, связанная с врожденными атрихиями с папулезными поражениями. Exp Dermatol. 2000 Apr; 9 (2): 157-62. Смотреть в: PubMed

  • Айта В.М., Кристиано А.М., Гиллиам ТК. Картирование сложных признаков при заболеваниях волос и кожи. Exp Dermatol. 1999 Dec; 8 (6): 439-52. Смотреть в: PubMed

  • Ranta S, Zhang Y, Ross B, Lonka L, Takkunen E, Messer A, Sharp J, Wheeler R, Kusumi K, Mole S, Liu W, Soares MB, Bonaldo MF, Hirvasniemi A, de la Chapelle A, Gilliam TC, Lehesjoki AE.Цероидные липофусцинозы нейронов у мышей с мутантами EPMR и mnd человека связаны с мутациями в CLN8. Нат Жене. 1999 Oct; 23 (2): 233-6. Смотреть в: PubMed

  • Ларин Д., Мекиос К., Дас К., Росс Б., Ян А.С., Гиллиам ТК. Характеристика взаимодействия между белками болезней Вильсона и Менкеса и цитоплазматическим шапероном меди, HAh2p. J Biol Chem. 1999 Oct 01; 274 (40): 28497-504. Смотреть в: PubMed

  • Буякова О.И., Сюй Дж., Луценко С., Цейтлин С., Дас К., Дас С., Росс Б.М., Мекиос С., Шейнберг И.Х., Гиллиам ТК.Нулевая мутация мышиного гена ATP7B (болезнь Вильсона) приводит к внутриклеточному накоплению меди и позднему началу узловой трансформации печени. Hum Mol Genet. 1999 Sep; 8 (9): 1665-71. Смотреть в: PubMed

  • Льюис CA, Батл И.Р., Батлле К.Г., Банерджи П., Сидесиян А.В., Хуанг Дж., Алеман Т.С., Хуанг Й., Отт Дж., Гиллиам Т.С., Ноулз Дж. А., Якобсон С.Г. Гомозиготная мутация сайта сплайсинга Tubby-like белка 1 вызывает тяжелую дегенерацию сетчатки с ранним началом. Инвестируйте Ophthalmol Vis Sci. 1999 Aug; 40 (9): 2106-14.Смотреть в: PubMed

  • Aita VM, Liang XH, Murty VV, Pincus DL, Yu W, Cayanis E, Kalachikov S, Gilliam TC, Levine B. Клонирование и геномная организация беклина 1, гена-кандидата опухолевого супрессора на хромосоме 17q21. Геномика. 1999, 01 июля; 59 (1): 59-65. Смотреть в: PubMed

  • Aita VM, Liu J, Knowles JA, Terwilliger JD, Baltazar R, Grunn A, Loth JE, Kanyas K, Lerer B, Endicott J, Wang Z, Penchaszadeh G, Gilliam TC, Baron M. Комплексный анализ хромосомных связей 21q22 подтверждает предшествующие доказательства предполагаемого локуса биполярного аффективного расстройства.Am J Hum Genet. 1999 Jan; 64 (1): 210-7. Смотреть в: PubMed

  • Гаврилов Д.К., Ши Х, Дас К., Гиллиам Т.К., Ван Ч. Дифференциальная экспрессия SMN2, связанная с тяжестью СМА. Нат Жене. 1998 Nov; 20 (3): 230-1. Смотреть в: PubMed

  • Knowles JA, Fyer AJ, Vieland VJ, Weissman MM, Hodge SE, Heiman GA, Haghighi F, de Jesus GM, Rassnick H, Preud'homme-Rivelli X, Austin T, Cunjak J, Mick S, Fine LD, Woodley KA, Das K, Maier W, Adams PB, Freimer NB, Klein DF, Gilliam TC.Результаты полногеномного генетического скрининга на паническое расстройство. Am J Med Genet. 1998 28 марта; 81 (2): 139-47. Смотреть в: PubMed

  • Frucht S, Sun D, ​​Schiff N, Eidelberg D, Gilliam TC. Тремор рук вторичный по отношению к болезни Вильсона. Mov Disord. 1998 Mar; 13 (2): 351-3. Смотреть в: PubMed

  • Ноулз Дж. А., Рао П. А., Кокс-Матиз Т., Лот Дж. Э., де Хесус Г. М., Левин Л., Дас К., Пенчасзаде Г. К., Александр Дж. Р., Лерер Б., Эндикотт Дж., Отт Дж., Гиллиам Т.К., барон М. Нет доказательств значительная связь между биполярным аффективным расстройством и перицентромерными маркерами хромосомы 18 в большой серии мультиплексных расширенных родословных.Am J Hum Genet. 1998 Apr; 62 (4): 916-24. Смотреть в: PubMed

  • Банерджи П., Льюис К.А., Клейн П.В., Шугарт Ю.Ю., Росс Б.М., Пенчасзаде Г.К., Отт Дж., Якобсон С.Г., Гиллиам Т.К., Ноулз Дж. А.. Гомозиготность и физическое картирование локуса аутосомно-рецессивного пигментного ретинита (RP14) на хромосоме 6p21.3. Геномика. 01 марта 1998 г .; 48 (2): 171-7. Смотреть в: PubMed

  • Банерджи П., Клейн П.В., Ноулз Дж. А., Льюис К.А., Росс Б.М., Парано Е., Коватс С.Г., Ли Дж.Дж., Пенчасзаде Г.К., Отт Дж., Якобсон С.Г., Гиллиам Т.К.Мутация TULP1 у двух доминиканских родственников с аутосомно-рецессивным пигментным ретинитом. Нат Жене. 1998 Feb; 18 (2): 177-9. Смотреть в: PubMed

  • Луценко С, Петрухин К, Гиллиам ТЦ, Каплан Дж. Гетерологичная экспрессия металл-связывающих доменов человеческих медь-транспортирующих АТФаз (Р1-АТФаз). Ann N Y Acad Sci. 1997 Nov 03; 834: 155-7. Смотреть в: PubMed

  • Ranta S, Lehesjoki AE, de Fatima Bonaldo M, Knowles JA, Hirvasniemi A, Ross B, de Jong PJ, Soares MB, de la Chapelle A, Gilliam TC.Картирование с высоким разрешением и идентификация транскриптов при прогрессирующей эпилепсии с локусом умственной отсталости на хромосоме 8p. Genome Res. 1997 Sep; 7 (9): 887-96. Смотреть в: PubMed

  • Шах А.Б., Чернов И., Чжан Х.Т., Росс Б.М., Дас К., Луценко С., Парано Э, Павоне Л., Евграфов О., Иванова-Смоленская И.А., Аннерен Г., Вестермарк К., Уррутия Ф.Х., Пенчасзаде Г.К., Штернлиб И., Шейнберг IH, Гиллиам Т.С., Петрухин К. Идентификация и анализ мутаций в гене болезни Вильсона (ATP7B): популяционные частоты, корреляция генотип-фенотип и функциональный анализ.Am J Hum Genet. 1997 Aug; 61 (2): 317-28. Смотреть в: PubMed

  • Ян XL, Миура Н., Каварада Ю., Терада К., Петрухин К., Гиллиам Т., Сугияма Т. Две формы белка болезни Вильсона, продуцируемые альтернативным сплайсингом, локализованы в разных клеточных компартментах. Biochem J. 1997, 15 сентября; 326 (Pt 3): 897-902. Смотреть в: PubMed

  • Ван СН, Картер Т.А., Дас К., Сюй Дж., Росс Б.М., Пенчасзаде Г.К., Гиллиам ТК. Обширная делеция ДНК, связанная с аллелями тяжелого заболевания на гомологах спинальной мышечной атрофии.Энн Нейрол. 1997 Jul; 42 (1): 41-9. Смотреть в: PubMed

  • Картер Т.А., Беннеманн К.Г., Ван СН, Обичи С., Парано Е., Де Фатима Боналдо М., Росс Б.М., Пенчасзаде Г.К., Маккензи А., Соарес МБ, Канкель Л.М., Гиллиам Т.К. Многокопийный ген репарации транскрипции, BTF2p44, картируется в области SMA и демонстрирует делеции, связанные с SMA. Hum Mol Genet. 1997 Feb; 6 (2): 229-36. Смотреть в: PubMed

  • Ferenci P, Gilliam TC, Gitlin JD, Packman S, Schilsky ML, Sokol RJ, Sternlieb I.Международный симпозиум по болезням Вильсона и Менкеса. Гепатология. 1996 Oct; 24 (4): 952-8. Смотреть в: PubMed

  • Ван СН, Сюй Дж., Картер Т.А., Росс Б.М., Домински М.К., Беллкросс, Калифорния, Пенчасзаде, Г.К., Мунсат, Т.Л., Гиллиам, ТК. Характеристика делеций гена моторного нейрона выживания (SMNT) у бессимптомных носителей спинальной мышечной атрофии. Hum Mol Genet. 1996 Mar; 5 (3): 359-65. Смотреть в: PubMed

  • Ranta S, Lehesjoki AE, Hirvasniemi A, Weissenbach J, Ross B, Leal SM, de la Chapelle A, Gilliam TC.Генетическое и физическое картирование локуса прогрессирующей эпилепсии с умственной отсталостью (EPMR) на хромосоме 8p. Genome Res. 1996 May; 6 (5): 351-60. Смотреть в: PubMed

  • Вильгельмсен К.С., Блейк Д.М., Линч Т., Мабутас Дж., Де Вера М., Нейстат М., Бернштейн М., Хирано М., Гиллиам Т.С., Мерфи П.Л., Сола М.Д., Бонилла Е., Шотланд Д.Л., Хейс А.П., Роуленд Л.П. Хромосомно-12-сцепленная аутосомно-доминантная лопаточно-малоберцовая мышечная дистрофия. Энн Нейрол. 1996 Apr; 39 (4): 507-20. Смотреть в: PubMed

  • Соарес В.М., Бжустович Л.М., Клейн П.В., Ноулз Дж.А., Палмер Д.А., Асокан С., Пенчасзаде Г.К., Мунсат Т.Л., Гиллиам ТК.Уточнение локуса спинальной мышечной атрофии до интервала между D5S435 и MAP1B. Геномика. 1993 Feb; 15 (2): 365-71. Смотреть в: PubMed

  • Петрухин К.Е., Шпеер М.К., Каянис Э., Боналдо М.Ф., Тантравахи У., Соарес М.Б., Фишер С.Г., Уорбертон Д., Гиллиам Т.С., Отт Дж. Карта микросателлитных генетических связей хромосомы 13 человека. Геномика. 1993 Jan; 15 (1): 76-85. Смотреть в: PubMed

  • Томпсон Т.Г., Моррисон К.Э., Клейн П., Бенгтссон Ю., Гиллиам Т.С., Дэвис К.Э., Васмут Дж. Дж., Макферсон Дж. Д..Физическая карта с высоким разрешением области, окружающей ген спинальной мышечной атрофии. Hum Mol Genet. 1993 Aug; 2 (8): 1169-76. Смотреть в: PubMed

  • Nygaard TG, Wilhelmsen KC, Risch NJ, Brown DL, Trugman JM, Gilliam TC, Fahn S, Weeks DE. Картирование сцепления допа-чувствительной дистонии (DRD) с хромосомой 14q. Нат Жене. 1993 Dec; 5 (4): 386-91. Смотреть в: PubMed

  • Клейн П.В., Гиллиам ТК. Прогресс в направлении клонирования гена, ответственного за мышечную атрофию позвоночника у детей.Semin Neurol. 1993 Sep; 13 (3): 276-82. Смотреть в: PubMed

  • Brzustowicz LM, Mérette C, Xie X, Townsend L, Gilliam TC, Ott J. Молекулярные и статистические подходы к обнаружению и исправлению ошибок в базах данных генотипов. Am J Hum Genet. 1993 Nov; 53 (5): 1137-45. Смотреть в: PubMed

  • Le Beau MM, Overhauser J, Straub RE, Silverman G, Gilliam TC, Ott J, O'Connell P, Francke U, Geurts van Kessel A. Отчет о первом международном семинаре по картированию хромосомы 18 человека.Cytogenet Cell Genet. 1993; 63 (2): 78-96. Смотреть в: PubMed

  • Локк П.А., Макдональд М.Э., Сриниди Дж., Гиллиам Т.С., Танзи Р.Э., Коннелли П.М., Векслер Н.С., Хейнс Дж. Л., Гуселла Дж. Ф. Карта генетического сцепления короткого плеча хромосомы 4. Somat Cell Mol Genet. 1993 Jan; 19 (1): 95-101. Смотреть в: PubMed

  • Straub RE, Speer MC, Luo Y, Rojas K, Overhauser J, Ott J, Gilliam TC. Микросателлитная карта генетического сцепления хромосомы 18 человека. Геномика. 1993 Jan; 15 (1): 48-56.Смотреть в: PubMed

  • Mérette C, Brzustowicz LM, Daniels RJ, Davies KE, Gilliam TC, Melki J, Munnich A, Pericak-Vance MA, Siddique T, Voosen B, et al. Исследование генетической гетерогенности и неравновесия по сцеплению в 161 семье со спинальной мышечной атрофией. Геномика. 1994 01 мая; 21 (1): 27-33. Смотреть в: PubMed

  • Ноулз JA, Шугарт Y, Banerjee P, Gilliam TC, Lewis CA, Jacobson SG, Ott J. Идентификация локуса, отличного от RDS-периферина, для пигментного пигмента аутосомно-рецессивного ретинита на хромосоме 6p.Hum Mol Genet. 1994 Aug; 3 (8): 1401-3. Смотреть в: PubMed

  • Baron M, Straub RE, Lehner T, Endicott J, Ott J, Gilliam TC, Lerer B. Биполярное расстройство и связь с Xq28. Нат Жене. 1994 Aug; 7 (4): 461-2. Смотреть в: PubMed

  • Brzustowicz LM, Mérette C, Kleyn PW, Lehner T., Castilla LH, Penchaszadeh GK, Das K, Munsat TL, Ott J, Gilliam TC. Оценка неаллельной генетической гетерогенности хронической (II и III типа) спинальной мышечной атрофии. Hum Hered. 1993 ноябрь-декабрь; 43 (6): 380-7.Смотреть в: PubMed

  • Петрухин К, Гиллиам ТЦ. Генетические нарушения обмена меди. Curr Opin Pediatr. 1994 Dec; 6 (6): 698-701. Смотреть в: PubMed

  • Петрухин К, Луценко С, Чернов I, Росс Б.М., Каплан Дж. Х., Гиллиам ТК. Характеристика гена болезни Вильсона, кодирующего АТФазу, транспортирующую медь P-типа: геномная организация, альтернативный сплайсинг и предсказания структуры / функции. Hum Mol Genet. 1994 Sep; 3 (9): 1647-56. Смотреть в: PubMed

  • Brzustowicz LM, Wang CH, Matseoane D, Kleyn PW, Vitale E, Das K, Penchaszadeh GK, Munsat TL, Hausmanowa-Petrusewicz I, Gilliam TC.Нарушение равновесия сцепления и анализ гаплотипов среди польских семей со спинальной мышечной атрофией. Am J Hum Genet. 1995 Jan; 56 (1): 210-5. Смотреть в: PubMed

  • Хуанг TH, Yeh PL, Martin MB, Straub RE, Gilliam TC, Caldwell CW, Skibba JL. Генетические изменения микросателлитов на хромосоме 18 при раке груди человека. Diagn Mol Pathol. 1995 Mar; 4 (1): 66-72. Смотреть в: PubMed

  • Selig S, Bruno S, Scharf JM, Wang CH, Vitale E, Gilliam TC, Kunkel LM. Экспрессированные псевдогены кадгерина локализованы в критической области гена спинальной мышечной атрофии.Proc Natl Acad Sci U S. 1995, 25 апреля; 92 (9): 3702-6. Смотреть в: PubMed

  • Бойлан КБ, Корнблат Д.Р., Гласс Дж.Д., Олдерсон К., Кункл Р.В., Клейн П.В., Гиллиам Т.К. Аутосомно-доминантная дистальная мышечная атрофия позвоночника в четырех поколениях. Неврология. 1995 Apr; 45 (4): 699-704. Смотреть в: PubMed

  • Shugart YY, Banerjee P, Knowles JA, Lewis CA, Jacobson SG, Matise TC, Penchaszadeh G, Gilliam TC, Ott J. Тонкое генетическое картирование гена пигментного гена аутосомно-рецессивного ретинита на хромосоме 6p21.Am J Hum Genet. 1995 Aug; 57 (2): 499-502. Смотреть в: PubMed

  • Гиллиам ТК. Обнаружен ли ген спинальной мышечной атрофии? Nat Med. 1995 Feb; 1 (2): 124-7. Смотреть в: PubMed

  • Уильямсон Р., Дэвис К. Э., Дональд Дж., Гиллиам С., Уоллис С., Хамфрис С. Последствия генетической изменчивости в патологии человека. Biochem Soc Symp. 1984; 49: 183-8. Смотреть в: PubMed

  • Роббинс Дж., Фрейер Г.А., Чисхолм Д., Гиллиам ТК. Выделение нескольких геномных последовательностей, кодирующих белок тяжелой цепи миозина курицы.J Biol Chem. 1982 10 января; 257 (1): 549-56. Смотреть в: PubMed

  • Дэвис К.Э., Гиллиам Т.С., Уильямсон Р. Муковисцидоз не вызван дефектом гена, кодирующего человеческий комплемент С3. Мол Биол Мед. 1983 Sep; 1 (2): 185-90. Смотреть в: PubMed

  • Гиллиам Т.С., Скамблер П., Роббинс Т., Ингл С., Уильямсон Р., Дэвис К.Э. Положения трех полиморфизмов длины рестрикционных фрагментов на хромосоме 4 относительно известных генетических маркеров. Hum Genet. 1984; 68 (2): 154-8.Смотреть в: PubMed

  • Гузелла Дж. Ф., Танзи Р. Э., Андерсон М. А., Хоббс В., Гиббонс К., Раштчиан Р., Гиллиам Т. С., Уоллес М. Р., Векслер Н. С., Коннелли П. М.. ДНК-маркеры заболеваний нервной системы. Наука. 1984 21 сентября; 225 (4668): 1320-6. Смотреть в: PubMed

  • Зайзингер Б.Р., Танзи Р.Э., Гиллиам Т.К., Бадер Д.Л., Парри Д.М., Спенс М.А., Маразита М.Л., Гиббонс К., Хоббс В., Гуселла Дж.Ф. Анализ генетической связи нейрофиброматоза с ДНК-маркерами. Ann N Y Acad Sci. 1986; 486: 304-10.Смотреть в: PubMed

  • Скамблер П., Роббинс Т., Гиллиам С., Бойлстон А., Типпет П., Уильямсон Р., Дэвис К. Изучение связи между полиморфными маркерами на хромосоме 4 и муковисцидозом. Hum Genet. 1985; 69 (3): 250-4. Смотреть в: PubMed

  • Gusella JA, Gilliam TC, MacDonald ME, Cheng SV, Tanzi RE. Молекулярная генетика хромосомы человека 4. J Med Genet. 1986 Jun; 23 (3): 193-9. Смотреть в: PubMed

  • Whaley WL, Michiels F, MacDonald ME, Romano D, Zimmer M, Smith B, Leavitt J, Bucan M, Haines JL, Gilliam TC, et al.Картирование D4S98 / S114 / S113 ограничивает дефект Хантингтона уменьшенной физической областью на теломере хромосомы 4. Nucleic Acids Res. 1988 Dec 23; 16 (24): 11769-80. Смотреть в: PubMed

  • Ричардс Дж. Э., Гиллиам Т. К., Коул Дж. Л., Драмм М. Л., Васмут Дж. Дж., Гуселла Дж. Ф., Коллинз Ф. С. Хромосома прыгает от D4S10 (G8) к гену болезни Хантингтона. Proc Natl Acad Sci U S. A. 1988 сентябрь; 85 (17): 6437-41. Смотреть в: PubMed

  • Мюррей Дж. К., Буетоу К. Х., Смит М., Карлок Л., Чакраварти А., Феррелл Р. Ф., Гедаму Л., Гиллиам С., Шианг Р., Де Хейвен С. Р..Анализ парных сцеплений 11 локусов на хромосоме 4 человека. Am J Hum Genet. 1988 Mar; 42 (3): 490-7. Смотреть в: PubMed

  • Gilliam TC, Gusella JF, Lehrach H. Молекулярно-генетические стратегии для исследования болезни Хантингтона. Adv Neurol. 1988; 48: 17-29. Смотреть в: PubMed

  • Gilliam TC, Bucan M, MacDonald ME, Zimmer M, Haines JL, Cheng SV, Pohl TM, Meyers RH, Whaley WL, Allitto BA, et al. Сегмент ДНК, кодирующий два гена, очень тесно связанных с болезнью Хантингтона.Наука. 1987 Nov 13; 238 (4829): 950-2. Смотреть в: PubMed

  • MacDonald ME, Андерсон MA, Gilliam TC, Tranejaerg L, Carpenter NJ, Magenis E, Hayden MR, Healey ST, Bonner TI, Gusella JF. Панель гибридов соматических клеток для локализации сегментов ДНК вблизи гена болезни Хантингтона. Геномика. 1987 Sep; 1 (1): 29-34. Смотреть в: PubMed

  • Blanché H, Zunec R, Gilliam C, Hartley D, Williamson R, Dausset J, Cann HM. Анонимный клон человека с низким числом копий, 4c11 (D6S4), локализованный на 6p12-6p21, обнаруживает 2 RFLP, один из которых является умеренно полиморфным.Nucleic Acids Res. 1987 24 июля; 15 (14): 5902. Смотреть в: PubMed

  • Gilliam TC, Tanzi RE, Haines JL, Bonner T.I, Faryniarz AG, Hobbs WJ, MacDonald ME, Cheng SV, Folstein SE, Conneally PM, et al. Локализация гена болезни Хантингтона в небольшом сегменте хромосомы 4, фланкированном D4S10 и теломерой. Клетка. 1987 Aug 14; 50 (4): 565-71. Смотреть в: PubMed

  • Gusella JF, Gilliam TC, Tanzi RE, MacDonald ME, Cheng SV, Wallace M, Haines J, Conneally PM, Wexler NS.Молекулярная генетика болезни Хантингтона. Колд Спринг Харб Symp Quant Biol. 1986; 51 Пт 1: 359-64. Смотреть в: PubMed

  • Гиллиам Т.С., Хили С.Т., Макдональд М.Э., Стюарт Дж. Д., Васмут Дж. Дж., Танзи Р. Э., Рой Дж. К., Гуселла Дж. Ф. Выделение полиморфных фрагментов ДНК из хромосомы человека 4. Nucleic Acids Res. 1987 Feb 25; 15 (4): 1445-58. Смотреть в: PubMed

  • Kaufmann CA, DeLisi LE, Lehner T, Gilliam TC. Физическое картирование, анализ сцепления предполагаемого локуса шизофрении на хромосоме 5q.Шизофр Бык. 1989; 15 (3): 441-52. Смотреть в: PubMed

  • Gilliam TC, Freimer NB, Kaufmann CA, Powchik PP, Bassett AS, Bengtsson U, Wasmuth JJ. Делеционное картирование ДНК-маркеров в области хромосомы 5, которая совпадает с шизофренией. Геномика. 1989 Nov; 5 (4): 940-4. Смотреть в: PubMed

  • Янгман С., Сарфарази М., Букан М., Макдональд М., Смит Б., Циммер М., Гиллиам С., Фришауф А.М., Васмут Дж. Дж., Гуселла Дж. Ф. и др. Новый маркер ДНК (D4S90) расположен на конце короткого плеча хромосомы 4, рядом с геном болезни Хантингтона.Геномика. 1989 Nov; 5 (4): 802-9. Смотреть в: PubMed

  • Weeks DE, Brzustowicz L, Squires-Wheeler E, Cornblatt B, Lehner T, Stefanovich M, Bassett A, Gilliam TC, Ott J, Erlenmeyer-Kimling L. Отчет семинара по изучению генетической связи при шизофрении. Шизофр Бык. 1990; 16 (4): 673-86. Смотреть в: PubMed

  • Gilliam TC, Brzustowicz LM, Castilla LH, Lehner T., Penchaszadeh GK, Daniels RJ, Byth BC, Knowles J, Hislop JE, Shapira Y, et al. Генетическая однородность между острой и хронической формами мышечной атрофии позвоночника.Природа. 1990, 28 июня; 345 (6278): 823-5. Смотреть в: PubMed

  • Лиен Л.Л., Бойс FM, Клейн П., Бжустович Л.М., Меннингер Дж., Уорд округ Колумбия, Гиллиам Т.К., Кункель Л.М. Картирование человеческого белка 1B, связанного с микротрубочками, в непосредственной близости от локуса спинномозговой мышечной атрофии в 5q13. Proc Natl Acad Sci U S. A. 1991, 01 сентября; 88 (17): 7873-6. Смотреть в: PubMed

  • Brzustowicz LM, Wilhelmsen KC, Gilliam TC. Генетический анализ спинальной мышечной атрофии в детстве. Adv Neurol. 1991; 56: 181-7.Смотреть в: PubMed

  • Kleyn PW, Brzustowicz LM, Wilhelmsen KC, Freimer NB, Miller JM, Munsat TL, Gilliam TC. Спинальная мышечная атрофия не является результатом мутаций в локусе бета-гексозаминидазы или GM2-активатора. Неврология. 1991 Sep; 41 (9): 1418-22. Смотреть в: PubMed

  • Wilhelmsen KC, Weeks DE, Nygaard TG, Moskowitz CB, Rosales RL, dela Paz DC, Sobrevega EE, Fahn S, Gilliam TC. Генетическое картирование «Lubag» (Х-сцепленная дистония-паркинсонизм) у филиппинца, родственного перицентромерной области Х-хромосомы.Энн Нейрол. 1991 Feb; 29 (2): 124-31. Смотреть в: PubMed

  • Consalez GG, Stayton CL, Freimer NB, Goonewardena P, Brown WT, Gilliam TC, Warren ST. Выделение и характеристика высокополиморфного локуса человека (DXS455) в проксимальном Xq28. Геномика. 1992 Apr; 12 (4): 710-4. Смотреть в: PubMed

  • Rojas K, Straub RE, Kurtz A, Feder M, Mewar R, Gilliam TC, Overhauser J. Идентификация и локализация микросателлитных маркеров, покрывающих хромосому 18 человека.Геномика. 1992 Dec; 14 (4): 1095-7. Смотреть в: PubMed

  • Ноулз Дж. А., Виланд В. Дж., Гиллиам ТК. Опасности картирования генов с помощью микросателлитных маркеров. Am J Hum Genet. 1992 Oct; 51 (4): 905-9. Смотреть в: PubMed

  • Гиллиам ТК. Картирование генов психических заболеваний: влияние новых молекулярных стратегий. J Psychiatr Res. 1992 Oct; 26 (4): 309-26. Смотреть в: PubMed

  • Бен Отман К., Бен Хамида М., Перикак-Вэнс М.А., Бен Хамида С., Блел С., Картер С.К., Боукок А.М., Петрухкин К., Гиллиам Т.С., Розес А.Д. и др.Связь тунисской аутосомно-рецессивной мышечной дистрофии Дюшенна с перицентромерной областью хромосомы 13q. Нат Жене. 1992 Dec; 2 (4): 315-7. Смотреть в: PubMed

  • Петрухин К.Е., Модянов Н.Н., Гиллиам ТЦ. Полиморфизм динуклеотидных повторов в локусе D4S251. Hum Mol Genet. 1992 Aug; 1 (5): 349. Смотреть в: PubMed

  • Петрухин К.Е., Гиллиам ТЦ. Полиморфизм динуклеотидных повторов в локусе D19S206. Hum Mol Genet. 1992 Sep; 1 (6): 454. Смотреть в: PubMed

  • Петрухин К.Е., Гиллиам ТЦ.Полиморфизм динуклеотидных повторов в локусе D1S182. Hum Mol Genet. 1992 Sep; 1 (6): 454. Смотреть в: PubMed

  • С. Луценко, К. Петрухин, М. Дж. Купер, Т. К. Гиллиам, Дж. Каплан. . N-концевые домены АТФаз человека, транспортирующих Cu (белки болезни Вильсона и Менкеса), селективно связывают Cu in vivo и in vitro со стехиометрией, равной одной Cu на каждый металл-связывающий повтор. Журнал биологической химии. 1997; 272: 18939-18944. ::::

  • 44. К. Петрухин, С.Г. Фишер, М. Пирасту, Р. Э. Танци, И. Чернов, М. Девото, Л. М. Бжустович, Э. Каянис, Э. Витале, Дж. Руссо, Д. Мацеоане, Б. Бухгалтер, А. Л. Фиглис, Дж. Лолидихнос, А. Цао И. Стернлиб , О. Евграфов, Э. Парано, Л. Павоне, Д. Уорбертон, Дж. Отт, Г. К. Пенчасзаде, И. Х. Шейнберг и Т. К. Гиллиам.. Физическое картирование, клонирование и генетическая характеристика локуса болезни Вильсона. Генетика природы. 1993; 5: 338-343. ::::

  • 19. Brzustowicz LB., Lehner T, Castilla L, Penchaszadeh GK, Wilhelmsen K, Daniels R, Davies KE, Leppert M, Ziter F, Wood D, Dubowits V, Zerres K, Hausmanowa-Petrusewicz I, Ott J, Munsat Т и Гиллиам Т.С. Генетическое картирование хронической мышечной атрофии позвоночника в детстве на хромосому 5q11.2-13.3. Природа. 1990; 344: 540-541. ::::

  • Д'Суза, М., Сулахе, Д., Ван, С., Се, Б., Хашемифар, С., Тейлор, А., Дубчак, И., Конрад Гиллиам, Т., Мальцев, Н.

    . Стратегическая интеграция множества биоинформатических ресурсов для анализа биологических сетей на системном уровне. Методы Мол биол. 2017; 1613: 85-89. ::::

  • Parano, E ,. Falcidia E, Grillo A, Pavone P, Cutuli N, Takabayashi H, Trifiletti RR и TC Gilliam. . Неинвазивная пренатальная диагностика хромосомных ануэплоидий путем выделения и анализа фетальных клеток из материнской крови.Амер. J. of Med. Genet. 2001; 101: 262-267. ::::

  • Р. Е. Танзи, К. Петрухин, И. Чернов, Ю. Л. Пеллекер, В. Васко, Б. Росс, Д. М. Романо, Л. М. Бжустович, М. Девото, Дж. Пепперкорн, А. И. Буш, И. Стернлиб, М. Пирасту, Дж. Ф. Гуселла, О. Евграфов, Г. К. Пенчасзаде , Б. Хониг, И. С. Эдельман, М. Б. Соареш, И. Х. Шейнберг и Т. К. Гиллиам. Ген болезни Вильсона представляет собой АТФазу, транспортирующую медь, гомологичную гену болезни Менкеса. Генетика природы. 1993; 5: 344-350. ::::

  • Хустер, Д.
    Finegold, MJ
    Morgan, CT
    Burkhead, JL
    Nixon, R.
    Vanderwerf, SM
    Gilliam, CT
    Lutsenko, S. Последствия накопления меди в печени мышей с нокаутом Atp7b - / - (ген болезни Вильсона) . Am J Pathol. 2006; 168 (2): 423-434. ::::

  • Kara, S.
    Pirela-Morillo, G. A.
    Gilliam, C. T.
    Wilson, G. D. Идентификация новых генов восприимчивости, связанных с семью аутоиммунными нарушениями, с использованием сетей полногеномного молекулярного взаимодействия.J Autoimmun. 2019; 97: 48-58. ::::

  • Congress.gov | Библиотека Конгресса

    Секция записи Конгресса Ежедневный дайджест Сенат дом Расширения замечаний

    Замечания участников Автор: Any House Member Адамс, Альма С.[D-NC] Адерхольт, Роберт Б. [R-AL] Агилар, Пит [D-CA] Аллен, Рик В. [R-GA] Оллред, Колин З. [D-TX] Амодеи, Марк Э. [R -NV] Армстронг, Келли [R-ND] Аррингтон, Джоди К. [R-TX] Auchincloss, Jake [D-MA] Axne, Cynthia [D-IA] Бабин, Брайан [R-TX] Бэкон, Дон [R -NE] Бэрд, Джеймс Р. [R-IN] Балдерсон, Трой [R-OH] Бэнкс, Джим [R-IN] Барр, Энди [R-KY] Барраган, Нанетт Диас [D-CA] Басс, Карен [ D-CA] Битти, Джойс [D-OH] Бенц, Клифф [R-OR] Бера, Ами [D-CA] Бергман, Джек [R-MI] Бейер, Дональд С., младший [D-VA] Байс , Стефани И. [R-OK] Биггс, Энди [R-AZ] Билиракис, Гас М.[R-FL] Бишоп, Дэн [R-NC] Бишоп, Сэнфорд Д., младший [D-GA] Блуменауэр, Эрл [D-OR] Блант Рочестер, Лиза [D-DE] Боберт, Лорен [R-CO ] Бонамичи, Сюзанна [D-OR] Бост, Майк [R-IL] Bourdeaux, Carolyn [D-GA] Bowman, Jamaal [D-NY] Бойл, Брендан Ф. [D-PA] Брэди, Кевин [R-TX ] Брукс, Мо [R-AL] Браун, Энтони Г. [D-MD] Браунли, Джулия [D-CA] Бьюкенен, Верн [R-FL] Бак, Кен [R-CO] Бакшон, Ларри [R-IN ] Бадд, Тед [R-NC] Берчетт, Тим [R-TN] Берджесс, Майкл С. [R-TX] Буш, Кори [D-MO] Бустос, Cheri [D-IL] Баттерфилд, GK [D-NC ] Калверт, Кен [R-CA] Каммак, Кэт [R-FL] Карбаджал, Салуд О.[D-CA] Карденас, Тони [D-CA] Карл, Джерри Л. [R-AL] Карсон, Андре [D-IN] Картер, Эрл Л. «Бадди» [R-GA] Картер, Джон Р. [ R-TX] Картер, Трой [D-LA] Картрайт, Мэтт [D-PA] Кейс, Эд [D-HI] Кастен, Шон [D-IL] Кастор, Кэти [D-FL] Кастро, Хоакин [D- TX] Cawthorn, Мэдисон [R-NC] Chabot, Стив [R-OH] Чейни, Лиз [R-WY] Чу, Джуди [D-CA] Cicilline, Дэвид Н. [D-RI] Кларк, Кэтрин М. [ D-MA] Кларк, Иветт Д. [D-NY] Кливер, Эмануэль [D-MO] Клайн, Бен [R-VA] Клауд, Майкл [R-TX] Клайберн, Джеймс Э. [D-SC] Клайд, Эндрю С. [R-GA] Коэн, Стив [D-TN] Коул, Том [R-OK] Комер, Джеймс [R-KY] Коннолли, Джеральд Э.[D-VA] Купер, Джим [D-TN] Корреа, Дж. Луис [D-CA] Коста, Джим [D-CA] Кортни, Джо [D-CT] Крейг, Энджи [D-MN] Кроуфорд, Эрик А. «Рик» [R-AR] Креншоу, Дэн [R-TX] Крист, Чарли [D-FL] Кроу, Джейсон [D-CO] Куэльяр, Генри [D-TX] Кертис, Джон Р. [R- UT] Дэвидс, Шарис [D-KS] Дэвидсон, Уоррен [R-OH] Дэвис, Дэнни К. [D-IL] Дэвис, Родни [R-IL] Дин, Мадлен [D-PA] ДеФазио, Питер А. [ D-OR] DeGette, Diana [D-CO] DeLauro, Rosa L. [D-CT] DelBene, Suzan K. [D-WA] Delgado, Antonio [D-NY] Demings, Val Butler [D-FL] DeSaulnier , Марк [D-CA] ДеДжарле, Скотт [R-TN] Дойч, Теодор Э.[D-FL] Диас-Баларт, Марио [R-FL] Дингелл, Дебби [D-MI] Доггетт, Ллойд [D-TX] Дональдс, Байрон [R-FL] Дойл, Майкл Ф. [D-PA] Дункан , Джефф [R-SC] Данн, Нил П. [R-FL] Эллзи, Джейк [R-TX] Эммер, Том [R-MN] Эскобар, Вероника [D-TX] Эшу, Анна Г. [D-CA ] Эспайлат, Адриано [D-NY] Эстес, Рон [R-KS] Эванс, Дуайт [D-PA] Фэллон, Пэт [R-TX] Feenstra, Рэнди [R-IA] Фергюсон, А. Дрю, IV [R -GA] Фишбах, Мишель [R-MN] Фицджеральд, Скотт [R-WI] Фитцпатрик, Брайан К. [R-PA] Флейшманн, Чарльз Дж. «Чак» [R-TN] Флетчер, Лиззи [D-TX] Фортенберри, Джефф [R-NE] Фостер, Билл [D-IL] Фокс, Вирджиния [R-NC] Франкель, Лоис [D-FL] Франклин, К.Скотт [R-FL] Фадж, Марсия Л. [D-OH] Фулчер, Расс [R-ID] Gaetz, Мэтт [R-FL] Галлахер, Майк [R-WI] Галлего, Рубен [D-AZ] Гараменди, Джон [D-CA] Гарбарино, Эндрю Р. [R-NY] Гарсия, Хесус Дж. "Чуй" [D-IL] Гарсия, Майк [R-CA] Гарсия, Сильвия Р. [D-TX] Гиббс, Боб [R-OH] Хименес, Карлос А. [R-FL] Гомерт, Луи [R-TX] Голден, Джаред Ф. [D-ME] Гомес, Джимми [D-CA] Гонсалес, Тони [R-TX] Гонсалес , Энтони [R-OH] Гонсалес, Висенте [D-TX] Гонсалес-Колон, Дженниффер [R-PR] Гуд, Боб [R-VA] Гуден, Лэнс [R-TX] Госар, Пол А. [R-AZ ] Gottheimer, Джош [D-NJ] Granger, Kay [R-TX] Graves, Garret [R-LA] Graves, Sam [R-MO] Green, Al [D-TX] Green, Mark E.[R-TN] Грин, Марджори Тейлор [R-GA] Гриффит, Х. Морган [R-VA] Гриджалва, Рауль М. [D-AZ] Гротман, Гленн [R-WI] Гость, Майкл [R-MS] Гатри, Бретт [R-KY] Хааланд, Дебра А. [D-NM] Хагедорн, Джим [R-MN] Хардер, Джош [D-CA] Харрис, Энди [R-MD] Харшбаргер, Диана [R-TN] Хартцлер, Вики [R-MO] Гастингс, Элси Л. [D-FL] Хейс, Джахана [D-CT] Херн, Кевин [R-OK] Херрелл, Иветт [R-NM] Эррера Бейтлер, Хайме [R-WA ] Хайс, Джоди Б. [R-GA] Хиггинс, Брайан [D-NY] Хиггинс, Клэй [R-LA] Хилл, Дж. Френч [R-AR] Хаймс, Джеймс А. [D-CT] Хинсон, Эшли [R-IA] Hollingsworth, Trey [R-IN] Horsford, Steven [D-NV] Houlahan, Chrissy [D-PA] Hoyer, Steny H.[D-MD] Хадсон, Ричард [R-NC] Хаффман, Джаред [D-CA] Huizenga, Билл [R-MI] Исса, Даррелл Э. [R-CA] Джексон, Ронни [R-TX] Джексон Ли, Шейла [D-TX] Джейкобс, Крис [R-NY] Джейкобс, Сара [D-CA] Jayapal, Pramila [D-WA] Джеффрис, Хаким С. [D-NY] Джонсон, Билл [R-OH] Джонсон, Дасти [R-SD] Джонсон, Эдди Бернис [D-TX] Джонсон, Генри К. «Хэнк» младший [D-GA] Джонсон, Майк [R-LA] Джонс, Mondaire [D-NY] Джордан, Джим [R-OH] Джойс, Дэвид П. [R-OH] Джойс, Джон [R-PA] Кахеле, Кайали [D-HI] Каптур, Марси [D-OH] Катко, Джон [R-NY] Китинг , Уильям Р.[D-MA] Келлер, Фред [R-PA] Келли, Майк [R-PA] Келли, Робин Л. [D-IL] Келли, Трент [R-MS] Кханна, Ро [D-CA] Килди, Дэниел Т. [D-MI] Килмер, Дерек [D-WA] Ким, Энди [D-NJ] Ким, Янг [R-CA] Kind, Рон [D-WI] Кинзингер, Адам [R-IL] Киркпатрик, Энн [D-AZ] Кришнамурти, Раджа [D-IL] Кустер, Энн М. [D-NH] Кустофф, Дэвид [R-TN] Лахуд, Дарин [R-IL] Ламальфа, Дуг [R-CA] Лэмб, Конор [D-PA] Лэмборн, Дуг [R-CO] Ланжевен, Джеймс Р. [D-RI] Ларсен, Рик [D-WA] Ларсон, Джон Б. [D-CT] Латта, Роберт Э. [R-OH ] Латернер, Джейк [R-KS] Лоуренс, Бренда Л.[D-MI] Лоусон, Эл, младший [D-FL] Ли, Барбара [D-CA] Ли, Сьюзи [D-NV] Леже Фернандес, Тереза ​​[D-NM] Леско, Дебби [R-AZ] Летлоу , Джулия [R-LA] Левин, Энди [D-MI] Левин, Майк [D-CA] Лиу, Тед [D-CA] Лофгрен, Зои [D-CA] Лонг, Билли [R-MO] Лоудермилк, Барри [R-GA] Ловенталь, Алан С. [D-CA] Лукас, Фрэнк Д. [R-OK] Люткемейер, Блейн [R-MO] Лурия, Элейн Г. [D-VA] Линч, Стивен Ф. [D -MA] Мейс, Нэнси [R-SC] Малиновски, Том [D-NJ] Маллиотакис, Николь [R-NY] Мэлони, Кэролин Б. [D-NY] Мэлони, Шон Патрик [D-NY] Манн, Трейси [ R-KS] Мэннинг, Кэти Э.[D-NC] Мэсси, Томас [R-KY] Маст, Брайан Дж. [R-FL] Мацуи, Дорис О. [D-CA] МакБэт, Люси [D-GA] Маккарти, Кевин [R-CA] МакКол , Майкл Т. [R-TX] Макклейн, Лиза К. [R-MI] МакКлинток, Том [R-CA] МакКоллум, Бетти [D-MN] МакИчин, А. Дональд [D-VA] Макговерн, Джеймс П. [D-MA] МакГенри, Патрик Т. [R-NC] МакКинли, Дэвид Б. [R-WV] МакМоррис Роджерс, Кэти [R-WA] Макнерни, Джерри [D-CA] Микс, Грегори В. [D- NY] Мейер, Питер [R-MI] Мэн, Грейс [D-NY] Meuser, Daniel [R-PA] Mfume, Kweisi [D-MD] Миллер, Кэрол Д. [R-WV] Миллер, Мэри Э. [ R-IL] Миллер-Микс, Марианнетт [R-IA] Мооленаар, Джон Р.[R-MI] Муни, Александр X. [R-WV] Мур, Барри [R-AL] Мур, Блейк Д. [R-UT] Мур, Гвен [D-WI] Морелль, Джозеф Д. [D-NY ] Моултон, Сет [D-MA] Мрван, Фрэнк Дж. [D-IN] Маллин, Маркуэйн [R-OK] Мерфи, Грегори [R-NC] Мерфи, Стефани Н. [D-FL] Надлер, Джерролд [D -NY] Наполитано, Грейс Ф. [D-CA] Нил, Ричард Э. [D-MA] Негусе, Джо [D-CO] Нелс, Трой Э. [R-TX] Ньюхаус, Дэн [R-WA] Ньюман , Мари [D-IL] Норкросс, Дональд [D-NJ] Норман, Ральф [R-SC] Нортон, Элеонора Холмс [D-DC] Нуньес, Девин [R-CA] О'Халлеран, Том [D-AZ] Обернолти, Джей [R-CA] Окасио-Кортес, Александрия [D-NY] Омар, Ильхан [D-MN] Оуэнс, Берджесс [R-UT] Палаццо, Стивен М.[R-MS] Паллоне, Фрэнк, младший [D-NJ] Палмер, Гэри Дж. [R-AL] Панетта, Джимми [D-CA] Паппас, Крис [D-NH] Паскрелл, Билл, мл. [D -NJ] Пейн, Дональд М., младший [D-NJ] Пелоси, Нэнси [D-CA] Пенс, Грег [R-IN] Перлмуттер, Эд [D-CO] Перри, Скотт [R-PA] Питерс, Скотт Х. [D-CA] Пфлюгер, Август [R-TX] Филлипс, Дин [D-MN] Пингри, Челли [D-ME] Пласкетт, Стейси Э. [D-VI] Покан, Марк [D-WI] Портер, Кэти [D-CA] Поузи, Билл [R-FL] Прессли, Аянна [D-MA] Прайс, Дэвид Э. [D-NC] Куигли, Майк [D-IL] Радваген, Аумуа Амата Коулман [R- AS] Раскин, Джейми [D-MD] Рид, Том [R-NY] Решенталер, Гай [R-PA] Райс, Кэтлин М.[D-NY] Райс, Том [R-SC] Ричмонд, Седрик Л. [D-LA] Роджерс, Гарольд [R-KY] Роджерс, Майк Д. [R-AL] Роуз, Джон В. [R-TN ] Розендейл старший, Мэтью М. [R-MT] Росс, Дебора К. [D-NC] Роузер, Дэвид [R-NC] Рой, Чип [R-TX] Ройбал-Аллард, Люсиль [D-CA] Руис , Рауль [D-CA] Рупперсбергер, Калифорния Датч [D-MD] Раш, Бобби Л. [D-IL] Резерфорд, Джон Х. [R-FL] Райан, Тим [D-OH] Саблан, Грегорио Килили Камачо [ D-MP] Салазар, Мария Эльвира [R-FL] Санчес, Линда Т. [D-CA] Сан-Николас, Майкл FQ [D-GU] Сарбейнс, Джон П. [D-MD] Скализ, Стив [R-LA ] Скэнлон, Мэри Гей [D-PA] Шаковски, Дженис Д.[D-IL] Шифф, Адам Б. [D-CA] Шнайдер, Брэдли Скотт [D-IL] Шрейдер, Курт [D-OR] Шрайер, Ким [D-WA] Швейкерт, Дэвид [R-AZ] Скотт, Остин [R-GA] Скотт, Дэвид [D-GA] Скотт, Роберт С. «Бобби» [D-VA] Сешнс, Пит [R-TX] Сьюэлл, Терри А. [D-AL] Шерман, Брэд [D -CA] Шерилл, Мики [D-NJ] Симпсон, Майкл К. [R-ID] Sires, Альбио [D-NJ] Slotkin, Элисса [D-MI] Смит, Адам [D-WA] Смит, Адриан [R -NE] Смит, Кристофер Х. [R-NJ] Смит, Джейсон [R-MO] Смакер, Ллойд [R-PA] Сото, Даррен [D-FL] Спанбергер, Эбигейл Дэвис [D-VA] Спарц, Виктория [ R-IN] Спейер, Джеки [D-CA] Стэнсбери, Мелани Энн [D-NM] Стэнтон, Грег [D-AZ] Stauber, Пит [R-MN] Стил, Мишель [R-CA] Стефаник, Элиза М.[R-NY] Стейл, Брайан [R-WI] Steube, В. Грегори [R-FL] Стивенс, Хейли М. [D-MI] Стюарт, Крис [R-UT] Стиверс, Стив [R-OH] Стрикленд , Мэрилин [D-WA] Суоззи, Томас Р. [D-NY] Swalwell, Эрик [D-CA] Такано, Марк [D-CA] Тейлор, Ван [R-TX] Тенни, Клаудия [R-NY] Томпсон , Бенни Г. [D-MS] Томпсон, Гленн [R-PA] Томпсон, Майк [D-CA] Тиффани, Томас П. [R-WI] Тиммонс, Уильям Р. IV [R-SC] Титус, Дина [ D-NV] Тлайб, Рашида [D-MI] Тонко, Пол [D-NY] Торрес, Норма Дж. [D-CA] Торрес, Ричи [D-NY] Трахан, Лори [D-MA] Трон, Дэвид Дж. .[D-MD] Тернер, Майкл Р. [R-OH] Андервуд, Лорен [D-IL] Аптон, Фред [R-MI] Валадао, Дэвид Г. [R-CA] Ван Дрю, Джефферсон [R-NJ] Ван Дайн, Бет [R-Техас] Варгас, Хуан [D-CA] Визи, Марк А. [D-TX] Вела, Филемон [D-TX] Веласкес, Нидия М. [D-Нью-Йорк] Вагнер, Энн [R -MO] Уолберг, Тим [R-MI] Валорски, Джеки [R-IN] Вальс, Майкл [R-FL] Вассерман Шульц, Дебби [D-FL] Уотерс, Максин [D-CA] Уотсон Коулман, Бонни [D -NJ] Вебер, Рэнди К., старший [R-TX] Вебстер, Дэниел [R-FL] Велч, Питер [D-VT] Венструп, Брэд Р. [R-OH] Вестерман, Брюс [R-AR] Векстон, Дженнифер [D-VA] Уайлд, Сьюзан [D-PA] Уильямс, Никема [D-GA] Уильямс, Роджер [R-TX] Уилсон, Фредерика С.[D-FL] Уилсон, Джо [R-SC] Виттман, Роберт Дж. [R-VA] Womack, Стив [R-AR] Райт, Рон [R-TX] Ярмут, Джон А. [D-KY] Янг , Дон [R-AK] Зельдин, Ли М. [R-NY] Любой член Сената Болдуин, Тэмми [D-WI] Баррассо, Джон [R-WY] Беннет, Майкл Ф. [D-CO] Блэкберн, Марша [ R-TN] Блюменталь, Ричард [D-CT] Блант, Рой [R-MO] Букер, Кори А. [D-NJ] Бузман, Джон [R-AR] Браун, Майк [R-IN] Браун, Шеррод [ D-OH] Берр, Ричард [R-NC] Кантуэлл, Мария [D-WA] Капито, Шелли Мур [R-WV] Кардин, Бенджамин Л. [D-MD] Карпер, Томас Р. [D-DE] Кейси , Роберт П., Младший [D-PA] Кэссиди, Билл [R-LA] Коллинз, Сьюзан М. [R-ME] Кунс, Кристофер А. [D-DE] Корнин, Джон [R-TX] Кортез Масто, Кэтрин [D -NV] Коттон, Том [R-AR] Крамер, Кевин [R-ND] Крапо, Майк [R-ID] Круз, Тед [R-TX] Дейнс, Стив [R-MT] Дакворт, Тэмми [D-IL ] Дурбин, Ричард Дж. [D-IL] Эрнст, Джони [R-IA] Файнштейн, Dianne [D-CA] Фишер, Деб [R-NE] Гиллибранд, Кирстен Э. [D-NY] Грэм, Линдси [R -SC] Грассли, Чак [R-IA] Хагерти, Билл [R-TN] Харрис, Камала Д. [D-CA] Хассан, Маргарет Вуд [D-NH] Хоули, Джош [R-MO] Генрих, Мартин [ D-NM] Гикенлупер, Джон В.[D-CO] Hirono, Mazie K. [D-HI] Hoeven, John [R-ND] Hyde-Smith, Cindy [R-MS] Inhofe, James M. [R-OK] Johnson, Ron [R-WI] ] Кейн, Тим [D-VA] Келли, Марк [D-AZ] Кеннеди, Джон [R-LA] Кинг, Ангус С., младший [I-ME] Klobuchar, Amy [D-MN] Ланкфорд, Джеймс [ R-OK] Лихи, Патрик Дж. [D-VT] Ли, Майк [R-UT] Леффлер, Келли [R-GA] Лухан, Бен Рэй [D-NM] Ламмис, Синтия М. [R-WY] Манчин , Джо, III [D-WV] Марки, Эдвард Дж. [D-MA] Маршалл, Роджер В. [R-KS] МакКоннелл, Митч [R-KY] Менендес, Роберт [D-NJ] Меркли, Джефф [D -ИЛИ] Моран, Джерри [R-KS] Мурковски, Лиза [R-AK] Мерфи, Кристофер [D-CT] Мюррей, Пэтти [D-WA] Оссофф, Джон [D-GA] Падилья, Алекс [D-CA ] Пол, Рэнд [R-KY] Питерс, Гэри К.[D-MI] Портман, Роб [R-OH] Рид, Джек [D-RI] Риш, Джеймс Э. [R-ID] Ромни, Митт [R-UT] Розен, Джеки [D-NV] Раундс, Майк [R-SD] Рубио, Марко [R-FL] Сандерс, Бернард [I-VT] Sasse, Бен [R-NE] Schatz, Брайан [D-HI] Шумер, Чарльз Э. [D-NY] Скотт, Рик [R-FL] Скотт, Тим [R-SC] Шахин, Жанна [D-NH] Шелби, Ричард К. [R-AL] Синема, Кирстен [D-AZ] Смит, Тина [D-MN] Стабеноу, Дебби [D-MI] Салливан, Дэн [R-AK] Тестер, Джон [D-MT] Тьюн, Джон [R-SD] Тиллис, Том [R-NC] Туми, Пэт [R-PA] Тубервиль, Томми [R -AL] Ван Холлен, Крис [D-MD] Уорнер, Марк Р.[D-VA] Варнок, Рафаэль Г. [D-GA] Уоррен, Элизабет [D-MA] Уайтхаус, Шелдон [D-RI] Уикер, Роджер Ф. [R-MS] Уайден, Рон [D-OR] Янг , Тодд [R-IN]

    .

    Оставить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *