Ст 1235 п 5 гк рф: ГК РФ Статья 1235. Лицензионный договор / КонсультантПлюс

Содержание

Недостаточно подробный лицензионный договор

В прошлых статьях я рассказывал о необходимости заключения договора об отчуждении исключительного права при покупке или продаже объектов авторских прав через интернет, а также об ошибке при заключении такого договора. Сегодня же мы будем говорить о лицензионном договоре.

Как Вы помните, если договор об отчуждении исключительного права составлен слишком подробно, то это может в некоторых случаях навредить. С лицензионным договором всё наоборот. В нем как раз надо максимально детально описать все важные моменты.

Лицензионному договору уделено достаточное внимание в Гражданском кодексе (ГК РФ), но стоит отметить, что при изучении правил, касающихся лицензионных договоров, мы довольно часто сталкиваемся с диспозитивными нормами. Диспозитивная норма – это такая норма (статья или правило), которая дает сторонам некоторую свободу выбора при определении их прав и обязанностей. Многие диспозитивные нормы заканчиваются словами «если договором не предусмотрено иное». То есть обычно закон дает обязательное (императивное) правило: «Должно быть так-то». И всё, это обязательно. А диспозитивная норма дает возможность изменять или не применять установленное ею правило: «Должно быть так-то, если договором между сторонами не предусмотрено иное».

Вот самые яркие примеры диспозиционных норм, касающихся лицензионных договоров:

По лицензионному договору лицензиат обязуется уплатить лицензиару обусловленное договором вознаграждение, если договором не предусмотрено иное (п.5. ст.1235 ГК РФ).
Лицензия предполагается простой (неисключительной), если лицензионным договором не предусмотрено иное (п.2. ст.1236 ГК РФ).

Это только пара примеров. По тексту статьи мы разберем похожие моменты, а в конце статьи я приведу перечень «ловушек», в которые можно попасться, если в договоре не будут четко описаны определенные условия. По этому перечню Вы сможете самостоятельно пошагово проверить Ваш договор.

Пока же предлагаю разобраться с существенными условиями лицензионного договора. Без существенных условий договор считается незаключенным; это те положения, которые обязательно должны быть в договоре (п.1. ст.432 ГК РФ).

Существенными условиями лицензионного договора являются предмет договора (указание на конкретный объект или объекты, в отношении которых заключается договор) и способы использования, которыми лицензиат (пользователь) сможет использовать объект. Размер вознаграждения является существенным условием только для возмездного лицензионного договора.

И если с указанием на конкретный объект проблем обычно не возникает, то вот со способами использования бывает хуже. Стороны начинают их придумывать, что-то забывают, что-то называют неправильно, что-то заимствуют из западного права. На самом деле не стоит изобретать велосипед. Способы использования произведения приведены в ст.1270 ГК РФ. Они сформулированы достаточно четко и так или иначе их можно применить к любому объекту. Самой грубой ошибкой является, конечно же, полное игнорирование способов использования в договоре. Но еще если их сформулировать размыто или не полностью, это тоже может привести суд к выводу о несогласованности сторонами способов использования. Чтобы этого избежать, рекомендую пользоваться формулировками из ст.1270 ГК РФ.

Стоит заранее согласовать с Вашим контрагентом способы использования и попросить юриста их сформулировать и включить в договор.

Помимо существенных условий в лицензионном договоре стоит учесть еще ряд важных моментов.

Конечно же, следует заранее определиться с видом лицензионного договора.

Лицензионные договоры бывают двух видов: о предоставлении простой неисключительной лицензии и о предоставлении исключительной лицензии.

Простая неисключительная лицензия означает, что правообладатель сохраняет за собой право выдавать лицензии кому-либо еще.

Исключительная лицензия означает, что лицензия предоставляется только одному лицензиату эксклюзивно, и правообладатель не вправе заключать такие же договоры в отношении этого объекта с кем-то еще.

Я рекомендую в договоре обязательно указывать его вид. Если этого не сделать, то договор будет считаться заключенным на условиях простой неисключительной лицензии (п.2. ст.1236 ГК РФ).

Срок – это еще одна важная деталь, которую обязательно стоит описать в договоре. Если срок не указать, то договор будет считаться действующим, но автоматически будет считаться заключенным на 5 лет (п.4 ст.1235 ГК РФ). Чаще всего лицензионные договоры заключаются на более короткий срок, так что стоит его конкретизировать.

Территория лицензионного договора тоже очень важна. Часто бывает, что территория является определяющим фактором для сторон договора (тогда, например, когда речь идет об эксклюзивных правах региональных лицензиатов). Отсутствие в договоре условия о территории не приведет к его недействительности, но если территория не прописана, то территорией использования будет считаться вся территория РФ. И если по такому договору объект будет использован вне пределов РФ, то это приведет к нарушению условий договора.

Бывает также, что у лицензиата возникает необходимость в заключении сублицензионных договоров. Сублицензионный договор – это такой лицензионный договор, который заключается не самим правообладателем, а пользователем с другим новым пользователем. Что важно: у пользователя должно быть письменное согласие первичного лицензиара на заключение сублицензионных договоров с другими пользователями. Такое письменное согласие может быть выражено договоре. Поэтому я рекомендую отдельно уточнять в договоре, предусмотрено ли для лицензиата право заключения сублицензионных договоров.

Итак, обобщая всё сказанное, привожу перечень основных моментов, которые стоит подробно отразить в лицензионном договоре, чтобы не попасться в «ловушки» диспозитивности и заключить договор, который будет действующим:

1. Предмет договора и перечень способов использования – обязательно стоит указать объект и привести согласованный сторонами перечень способов использования с учетом формулировок ст.1270 ГК РФ.

 

2. Вид договора – стоит указать, заключается ли лицензионный договор на условиях простой лицензии или же на условиях исключительной лицензии.

 

3. Срок договора – следует четко его определить. Иначе договор будет действовать 5 лет.

 

4. Территория – следует ее четко определить. Иначе договор будет действовать на всей территории РФ.

 

5. Право на заключение сублицензионных договоров – стоит указать предоставляется ли такое право лицензиату.

 

© Андрей Макаров, 2020г. Эта статья является охраняемым объектом авторских прав! Воспроизведение текста статьи и/или его частей разрешается в сети Интернет с обязательным указанием имени автора и активной гиперссылки на источник 

Лицензионное вознаграждение в случае неиспользования программы

Главная / Кейсы

Вознаграждение не зависит от фактического использования программного обеспечения

Предметом лицензионного договора является предоставление права использования на определенный объект (например, программу, базу данных). В отношениях между коммерческими организациями (как и в большинстве случаев, когда отношения сторон носят предпринимательский характер) за предоставление лицензии (права использования) уплачивается вознаграждение.

При этом, как и в случае с договором на абонентское обслуживание, вознаграждение уплачивается вне зависимости от того, воспользовался ли лицензиат предоставленными ему правами.

Готовое решение для вашего бизнеса

Сохранение льготы по НДС. Защита прав. Более 48 вариантов лицензирования

Судебная практика по лицензионному вознаграждению

В деле N А40-224091/2019 предприниматель пытался вернуть уплаченное вознаграждение, ссылаясь на то, что предоставленная программа им не использовалась. Правообладатель подал встречный иск о взыскании лицензионного вознаграждения по лицензионному договору за предоставление права на программное обеспечение.

В результате в удовлетворении иска лицензиата отказано, задолженность по лицензионному вознаграждению взыскана в полном объеме по встречному иску лицензиара.

Таким образом, как и в случае с арендой, фактическое пользование программным обеспечением по лицензионному договору не имеет значения для начисления вознаграждения. Достаточно подтвердить, что лицензиату предоставлено право использования (с даты заключения договора, даты передачи экземпляра ПО или иного, указанного в договоре момента).

В то же время лицензиат не лишен возможности ссылаться на отказ от использования ввиду недостатков ПО.

Правовая позиция из Постановления СИП от 30.11.2020 г. по делу N А40-224091/2019

1. Согласно п. 1 ст. 1235 ГК РФ по лицензионному договору одна сторона - обладатель исключительного права на произведение (программу) предоставляет или обязуется предоставить другой стороне право использования такого произведения (программы) в предусмотренных договором пределах.

2. По смыслу п. 5 ст. 1235 ГК РФ в его взаимосвязи с п. 4 ст. 1237 ГК РФ вознаграждение по возмездному лицензионному договору уплачивается за предоставление права использования результата интеллектуальной деятельности или средства индивидуализации (п. 40 Постановления Пленума ВС РФ от 23.04.2019 N 10).

В связи с этим лицензиару не может быть отказано в удовлетворении требования о взыскании вознаграждения по мотиву неиспользования лицензиатом соответствующей программы.

3. В соответствии со ст. 309 ГК РФ обязательства должны исполняться надлежащим образом в соответствии с условиями обязательства и требованиями закона, иных правовых актов. При этом в силу положений ст. 310 ГК РФ односторонний отказ от исполнения обязательства и одностороннее изменение его условий не допускаются.

Поскольку право на программу было предоставлено, встречное требование о взыскании задолженности по лицензионному вознаграждению подлежит удовлетворению в полном объеме.

Регистрация ПО Лицензионный договор

Лицензионный договор: анализ арбитражной практики

Упущенная выгода - это один убытков в гражданском праве. Рассматриваются особенности взыскания, доказывания и методики расчета в арбитражной практике

Читать статью

Комментарий к проекту постановления пленума ВАС РФ о последствиях расторжения договора

Читать статью

Комментарий к постановлению пленума ВАС РФ о возмещении убытков лицами, входящими в состав органов юридического лица.

Читать статью

О способах защиты бизнеса и активов, прав и интересов собственников (бенефициаров) и менеджмента. Возможные варианты структуры бизнеса и компаний, участвующих в бизнесе

Читать статью

Дробление бизнеса – одна из частных проблем и постоянная тема в судебной практике. Уход от налогов привлекал и привлекает внимание налоговых органов. Какие ошибки совершаются налогоплательщиками и могут ли они быть устранены? Читайте материал на сайте

Читать статью

Привлечение к ответственности бывших директоров, учредителей, участников обществ с ограниченной ответственностью (ООО). Условия, арбитражная практика по привлечению к ответственности, взыскания убытков

Читать статью

АСК НДС-2 – объект пристального внимания. Есть желание узнать, как она работает, есть ли способы ее обхода, либо варианты минимизации последствий ее применения. Поэтому мы разобрали некоторые моменты с ней связанные

Читать статью

Срывание корпоративной вуали – вариант привлечения контролирующих лиц к ответственности. Без процедуры банкротства. Подходит для думающих и хорошо считающих кредиторов в ситуации взыскания задолженности

Читать статью

Общество с ограниченной ответственностью с двумя участниками: сложности принятия решений и ведения хозяйственной деятельности общества при корпоративном конфликте, исключение участника, ликвидация общества. Равное и неравное распределение долей.

Читать статью

Структурирование бизнеса является одним из необходимых инструментов для бизнеса и его бенефициаров с целью создания условий налоговой безопасности при ведении предпринимательской деятельности. Подробнее на сайте юрфирмы «Ветров и партнеры».

Читать статью

Вопрос-ответ: Использование товарного знака

ВОПРОС:

Как использовать товарный знак ООО, если он зарегистрирован на физическое лицо - учредителя ООО? Какие документы для этого потребуются?

ОТВЕТ:

Для передачи учредителем права на товарный знак предусматривается заключение лицензионного договора между правообладателем и руководителем ООО.

По лицензионному договору одна сторона - обладатель исключительного права на результат интеллектуальной деятельности или на средство индивидуализации (лицензиар) предоставляет или обязуется предоставить другой стороне (лицензиату) право использования такого результата или такого средства в предусмотренных договором пределах (п. 1 ст. 1235 ГК РФ).

Руководитель - это лицо, которое действует от имени ООО без доверенности. Именно он обеспечивает деятельность общества: заключает сделки и т.п. С дополнительной информацией можно ознакомиться  в Готовое решение: Какими полномочиями может быть наделен единоличный исполнительный орган (руководитель) ООО (КонсультантПлюс, 2018)

Особенности лицензионного договора

По общему правилу лицензионный договор заключается в письменной форме. Несоблюдение письменной формы влечет недействительность лицензионного договора (абз. 1 п. 2 ст. 1235 ГК РФ).

Государственной регистрации подлежит предоставление права использования … средства индивидуализации по лицензионному договору, если ей подлежит соответствующий результат интеллектуальной деятельности или средство индивидуализации (абз. 2 п. 2 ст. 1235, п. 2 ст. 1232 ГК РФ). Порядок и условия государственной регистрации устанавливаются Правительством РФ (п. 2 ст. 1232 ГК РФ).

Такая государственная регистрация осуществляется по заявлению сторон договора. Заявление может быть подано сторонами договора или одной из сторон договора (п. 3 ст. 1232 ГК РФ).

При несоблюдении требования о государственной регистрации предоставление права использования результата интеллектуальной деятельности или средства индивидуализации считается несостоявшимся (п. 6 ст. 1232 ГК РФ).

С 1 апреля 2016 г. размеры пошлины за рассмотрение заявления о государственной регистрации предоставления права использования … товарного знака, знака обслуживания по лицензионному (сублицензионному) договору и принятие решения по результатам его рассмотрения предусмотрены Постановлением Правительства РФ от 10.12.2008 N 941.

Важные детали
  • По общему правилу лицензионный договор предполагается возмездным (п. 5 ст. 1235 ГК РФ). Поэтому, если в лицензионном договоре прямо не оговорена его безвозмездность, но при этом в нем не согласовано условие о размере вознаграждения или о порядке его определения, такой договор считается незаключенным (абз. 2 п. 5 ст. 1235 ГК РФ, п. 13.6 Постановления Пленума Верховного Суда РФ N 5, Пленума ВАС РФ N 29 от 26.03.2009).
  • Не допускается безвозмездное предоставление права использования результата интеллектуальной деятельности или средства индивидуализации в отношениях между коммерческими организациями на территории всего мира и на весь срок действия исключительного права на условиях исключительной лицензии, если Гражданским кодексом РФ не установлено иное (п. 5.1 ст. 1235 ГК РФ).

Обзор подготовлен специалистами Линии Консультирования ГК "Земля-СЕРВИС"

Статья 1428 ГК РФ. Лицензионный договор о предоставлении права использования селекционного достижения

По лицензионному договору одна сторона - патентообладатель (лицензиар) предоставляет или обязуется предоставить другой стороне - пользователю (лицензиату) удостоверенное патентом право использования соответствующего селекционного достижения в установленных договором пределах.


1. В комментируемой статье применительно к исключительному праву на селекционное достижение воспроизводится понятие лицензионного договора о предоставлении права использования результата интеллектуальной деятельности, предусмотренное в п. 1 ст. 1235 ГК. При этом, в отличие от договора об отчуждении патента, заключение лицензионного договора не влечет за собой переход исключительного права на селекционное достижение к лицензиату (п. 1 ст. 1233 ГК). Правовой режим договора об отчуждении патента на селекционное достижение определяется, главным образом, положениями гл. 69 ГК.

Лицензиат может использовать селекционное достижение только в пределах тех прав и теми способами, которые предусмотрены лицензионным договором (п. 1 ст. 1235 ГК). Использование селекционного достижение за пределами прав, предоставленных лицензиату по договору, влечет его ответственность за нарушение исключительного права на селекционное достижение, установленную Кодексом, другими законами или договором (п. 3 ст. 1237 ГК).

2. Кодекс предусматривает два вида лицензионных договоров в зависимости от того, сохраняется ли у лицензиара, предоставившего право использования селекционного достижения одному лицензиату, право выдачи аналогичных лицензий другим лицензиатам или нет. В первом случае речь идет о простой (неисключительной) лицензии (подп. 1 п. 1 ст. 1236 ГК), а во втором - об исключительной лицензии (подп. 2 п. 1 ст. 1236 ГК). В пункте 2 ст. 1236 ГК установлена презумпция, в соответствии с которой, если лицензионным договором не предусмотрено иное, лицензия предполагается простой (неисключительной). Указанные условия предоставления права использования селекционного достижения могут быть включены в один лицензионный договор в отношении различных способов использования соответствующего достижения (п. 3 ст. 1236 ГК). Таким образом, в правовом режиме лицензионных договоров получило отражение общее правило п. 3 ст. 421 ГК о смешанных договорах.

В то же время, независимо от того, на каких условиях - простой или исключительной лицензии - предоставлено лицензиату право использования селекционного достижения по лицензионному договору, в течение всего срока действия последнего лицензиар обязан воздерживаться от каких-либо действий, способных затруднить осуществление лицензиатом предоставленного ему права в установленных лицензионным договором пределах (п. 2 ст. 1237 ГК).

3. Особой разновидностью лицензионного договора является сублицензионный договор (ст. 1238 ГК), в соответствии с которым лицензиат, получивший право использования селекционного достижения по договору с лицензиаром, может, в свою очередь, с письменного согласия последнего предоставить право использования соответствующего достижения другому лицу (сублицензиату). По сублицензионному договору сублицензиату могут быть предоставлены права использования селекционного достижения исключительно в пределах тех прав и тех способов использования, которые предусмотрены лицензионным договором для лицензиата (п. 2 ст. 1238 ГК).

В силу прямого указания п. 5 ст. 1238 ГК к сублицензионному договору подлежат применению правила о лицензионном договоре. Это означает, в частности, что на сублицензионный договор распространяются правила о форме и государственной регистрации лицензионного договора, о его существенных и обычных условиях.

Несмотря на то что лицензиар может формально не быть стороной сублицензионного договора, действия сублицензиата могут затрагивать принадлежащее лицензиару (патентообладателю) исключительное право. Поэтому по общему правилу ответственность перед лицензиаром за действия сублицензиата несет лицензиат (п. 4 ст. 1238 ГК). Указанное правило, однако, сформулировано в Кодексе как диспозитивное, так что стороны лицензионного договора вправе договориться о том, что ответственность возлагается непосредственно на сублицензиата.

4. В соответствии с п. 1 ст. 1235 ГК и комментируемой статьей лицензионный договор может быть как реальным, когда для заключения договора необходимо предоставление права использования селекционного достижения, так и консенсуальным, когда договор признается заключенным в момент выражения сторонами воли на его заключение. Соответственно, в первом случае речь идет о предоставлении лицензиаром права использования селекционного достижения, а во втором - об обязанности лицензиара предоставить соответствующее право в будущем.

5. В пункте 5 ст. 1235 ГК в соответствии с п. 3 ст. 423 ГК установлена презумпция возмездности лицензионного договора. Следовательно, по общему правилу лицензиат обязан уплатить лицензиару (патентообладателю) вознаграждение за предоставление права использования селекционного достижения. В то же время стороны могут договориться и о безвозмездности лицензионного договора.

Указанная презумпция, однако, имеет некоторые особенности, связанные с тем, что в силу уникальности результата интеллектуальной деятельности к нему не могут быть применены правила п. 3 ст. 424 ГК, позволяющие путем сопоставления с ценой аналогичного товара восполнить отсутствующее в возмездном лицензионном договоре условие о размере причитающегося лицензиару вознаграждения. Поэтому при отсутствии в возмездном лицензионном договоре условия о вознаграждении или о порядке его определения соответствующий договор в силу прямого указания п. 5 ст. 1235 ГК считается незаключенным. Следовательно, условие о вознаграждении в возмездном лицензионном договоре относится к числу его существенных условий (п. 1 ст. 432 ГК).

6. В соответствии с п. 2 ст. 1232, п. 2 ст. 1235 ГК лицензионный договор заключается в письменной форме и подлежит государственной регистрации, поскольку исключительное право на селекционное достижение признается и охраняется в силу государственной регистрации соответствующего достижения (ст. 1414 ГК). В соответствии с п. 2 ст. 1439 ГК сведения о заключенных лицензионных договорах вносятся в Государственный реестр охраняемых селекционных достижений.

Несоблюдение письменной формы и требования государственной регистрации лицензионного договора влечет его ничтожность в соответствии с п. 1 ст. 165, ст. 168, п. 2 ст. 1235 ГК.

Сведения о заключенных лицензионных договорах в соответствии с подп. 5 п. 1 ст. 1443 ГК подлежат опубликованию в "Официальном бюллетене" как сведения, касающиеся охраны селекционных достижений.

В настоящее время за регистрацию исключительной лицензии и публикацию в официальном бюллетене сведений о ней установлена патентная пошлина (код 1.5.0) в размере 4,0 минимальных размеров оплаты труда (Положение о патентных пошлинах на селекционные достижения). Документ об уплате этой пошлины представляется вместе с заявлением о регистрации исключительной лицензии или в течение одного месяца начиная с даты поступления этого заявления в Госкомиссию. Кроме того, установлена патентная пошлина за внесение изменений в зарегистрированную исключительную лицензию (код 1.5.1) в размере 1,0 минимального размера оплаты труда, документ об уплате которой представляется вместе с заявлением о внесении изменений в исключительную лицензию.

7. К числу обычных условий лицензионного договора, не требующих, в отличие от существенных условий, непременного согласования сторонами, относятся условия о территории использования селекционного достижения, о сроке действия договора, а также о сроке и порядке представления лицензиатом отчетов об использовании селекционного достижения.

В соответствии с п. 3 ст. 1235 ГК в лицензионном договоре должна быть указана территория, на которой допускается использование селекционного достижения. Однако в случае, если такая территория в договоре не указана, лицензиат вправе осуществлять использование селекционного достижения на всей территории Российской Федерации.

В соответствии с п. 4 ст. 1235 ГК срок, на который заключается лицензионный договор, не может превышать срок действия исключительного права на селекционное достижение. В случае, когда в лицензионном договоре срок его действия не определен, договор считается заключенным на пять лет. В случае прекращения исключительного права на селекционное достижение как по истечении срока его действия, так и при досрочном прекращении действия патента на селекционное достижение (ст. 1442 ГК) лицензионный договор прекращается. Кроме того, срок действия лицензионного договора предопределяет продолжительность действия сублицензионного договора, так что в соответствии с п. 3 ст. 1238 ГК сублицензионный договор, заключенный на срок, превышающий срок действия лицензионного договора, считается заключенным на срок действия лицензионного договора. При этом в соответствии с п. 3 ст. 1237 ГК использование лицензиатом селекционного достижения после прекращении действия лицензионного договора влечет предусмотренную законом или договором ответственность за нарушение исключительного права.

В соответствии с п. 1 ст. 1237 ГК норма об обязанности лицензиата предоставлять лицензиару отчеты об использовании селекционного достижения носит диспозитивный характер. При этом, однако, для того, чтобы избежать ее применения, стороны должны в договоре прямо предусмотреть, что лицензиат не обязан предоставлять лицензиару соответствующие отчеты. В противном случае, а также в случае, когда в лицензионном договоре, предусматривающем представление отчетов об использовании селекционного достижения, будут отсутствовать условия о сроке и порядке их представления, лицензиат в силу п. 1 ст. 1237 ГК обязан представлять такие отчеты лицензиару по его требованию.

8. К числу существенных условий лицензионного договора в соответствии с п. 6 ст. 1235 ГК относится условие о предмете договора и о способах использования селекционного достижения.

Условие о предмете договора предполагает указание на селекционное достижение, право использования которого предоставляется по договору, с указанием номера и даты выдачи патента, удостоверяющего исключительное право на селекционное достижение.

Способы использования селекционного достижения исчерпывающим образом предопределяют перечень действий, которые лицензиат вправе совершать в отношении соответствующего селекционного достижения. При этом в соответствии с п. 1 ст. 1235 ГК право использования селекционного достижения, прямо не указанное в лицензионном договоре, не считается предоставленным лицензиату.

В то же время в силу п. 3 ст. 1237 ГК использование лицензиатом селекционного достижения способом, не предусмотренным лицензионным договором, влечет установленную законом или договором ответственность за нарушение исключительного права.

9. Действие лицензионного договора не зависит от смены лицензиара, которая может произойти как в результате перехода исключительного права к наследникам первоначального патентообладателя (лицензиара), так и в случае отчуждения последним патента на селекционное достижение. В соответствии с п. 7 ст. 1235 ГК переход исключительного права на селекционное достижение к новому патентообладателю не является основанием для изменения или расторжения лицензионного договора, заключенного предшествующим патентообладателем. Указанное правило действует независимо от вида лицензии, т.к. заключение лицензионного договора не влечет за собой переход исключительного права на селекционное достижение к лицензиату (п. 1 ст. 1233 ГК).

10. Помимо законодательного регулирования условий лицензионных договоров о предоставлении права использования селекционных достижений сохраняет значение и ведомственное нормотворчество. Разработанные Госкомиссией до введения в действие части 4 ГК примерные формы лицензионных договоров могут сохранить свое регулятивное значение в той части, в которой эти формы не противоречат новому законодательству о селекционных достижениях, действующему с 1 января 2008 г. И хотя часть 4 ГК не предусматривает право указанного федерального органа издавать примерные формы договоров, соответствующие правомочия могут быть ему предоставлены при утверждении положения об этом органе. До тех пор разработанные Госкомиссией примерные формы лицензионных договоров могут при указанном выше условии рассматриваться в качестве обычаев делового оборота, своеобразного ориентира для участников экономического оборота прав на селекционные достижения, отражающего сложившуюся практику заключения лицензионных договоров.

К сохраняющим указанное значение условиям из примерных форм лицензионных договоров следует отнести обязанность лицензиата по информированию лицензиара обо всех известных ему (лицензиату) случаях использования семян сорта с нарушением прав лицензиара, а также обязанность лицензиата вести учет и документацию, связанные с использованием селекционного достижения.

Примерные формы лицензионных договоров возлагают на лицензиара обязанность оказывать лицензиату по письменному запросу последнего консультативную помощь при использовании селекционного достижения в установленных договором пределах. На лицензиара возлагается также обязанность по согласованному с лицензиатом графику производить для сортообновления определенное количество семян соответствующей категории и осуществлять их поставку лицензиату "в согласованные сроки и по согласованным ценам".

Должна сохранить свое регулятивное значение возможность осуществления платежей, причитающихся с лицензиата по лицензионному договору, "полностью или частично в натуральной форме - семенами, товарным зерном и другой продукцией по предварительному согласованию с лицензиаром".

О сложившейся практике свидетельствуют и включенные в примерные формы условия об установлении пени за каждый день просрочки лицензиатом оплаты причитающихся с него платежей, а также перечисление обязанностей лицензиата, неоднократное нарушение которых дает лицензиару право потребовать расторжения соответствующего лицензионного договора.

Распоряжение исключительными правами: основные изменения гражданского законодательства

Е.С. Гринь,
кандидат юридических наук
старший преподаватель кафедры гражданского права и кафедры интеллектуальных прав
Московского государственного юридического университета
имени О.Е. Кутафина (МГЮА)

 

 

"Журнал Суда по интеллектуальным правам", № 6, Декабрь 2014 г., с. 69-74

Основные и наиболее важные изменения, касающиеся механизмов распоряжения исключительными правами, были внесены в часть четвертую Гражданского кодекса РФ согласно Федеральному закону от 12.03.2014 № 35-ФЗ «О внесении изменений в части первую, вторую и четвертую Гражданского кодекса Российской Федерации и отдельные законодательные акты Российской Федерации»1 (далее – Закон № 35-ФЗ) и вступили в силу с 1 октября 2014 г.

Данные изменения объективно требуют детального изучения и проработки с целью дальнейшего юридически корректного использования договорных конструкций в практической деятельности, поскольку именно договорные отношения формируют тот рынок инновационных технологий, развитие которого является одной из наиболее важных целей в процессе модернизации отечественной экономики.

Кроме того, в рамках рассмотрения аспекта защиты интеллектуальных прав следует подчеркнуть, что их нарушение происходит не только в случае внедоговорного использования результатов интеллектуальной деятельности (что является наиболее очевидным), но при ненадлежащем исполнении - договоров по распоряжению исключительными правами.

Рассмотрим основные изменения, которые были внесены в часть четвертую ГК РФ согласно Закону № 35-ФЗ по вопросам распоряжения исключительными правами (далее рассматриваемые статьи (оставить полное написание, т.к. «ст.» отдельно без цифр некрасиво выглядит) части четвертой ГК РФ указываются в редакции Закона № 35-ФЗ).

1. В первую очередь следует сказать о договорах заказа. Как известно, в рамках этой разновидности договоров возможно заключение договора авторского заказа (ст. 1288 ГК РФ), субъектами которого выступают автор (гражданин, творческим трудом которого создан результат интеллектуальной деятельности) и заказчик. В договоре авторского заказа содержатся условия относительно дальнейшего использования созданного произведения: он может предусматривать как отчуждение заказчику исключительного права на созданное автором произведение, так и предоставление права использования этого произведения в установленных договором пределах (п. 2 ст. 1288 ГК РФ). Соответственно, к такому договору применяются либо положения ГК РФ о договоре об отчуждении исключительного права (п. 3 ст. 1288 ГК РФ), либо положения о лицензионном договоре (п. 4 ст. 1288 ГК РФ).

Таким образом, договор авторского заказа согласно ст. 1288 ГК РФ не может быть заключен с иными лицами, кроме автора.

Ввиду этого, нормы о договоре авторского заказа не могут быть распространены на отношения по созданию произведений, когда сторонами договора являются исполнитель, который не является автором, и заказчик. Такие отношения прежде были урегулированы лишь применительно к созданию программ для ЭВМ и баз данных (ст. ст. 1296 ,1297 ГК РФ в редакции Федерального закона от 02.07.2013 № 185-ФЗ). Однако согласно Закону № 35-ФЗ ,правила о договоре заказа с 1 октября 2014 г. применяются к отношениям, связанным с произведениями, созданными по заказу2. Формулировка нормы ст. 1296 ГК РФ предполагает распространение правил о таком договоре не только на отношения по созданию программ для ЭВМ и баз данных, но и любых иных произведений.

С 1 октября 2014 г., согласно п. 1 ст. 1296 ГК РФ, исключительное право на произведение, созданное по договору, предметом которого было его создание (по заказу), принадлежит заказчику, если договором между подрядчиком (исполнителем) и заказчиком не предусмотрено иное (договор заказа на создание произведения).

На наш взгляд, такое нововведение необходимо, поскольку эта правовая конструкция является типичной для случаев заказа на создание большинства сложных объектов, в том числе, мультимедийных продуктов, – соответствующий договор в данных случаях заключается между организатором создания сложного объекта (исполнителем, подрядчиком) и заказчиком (например, (оставить запятую) издателем). Важным отличием этого договора от авторского заказа является то, что исполнителем по нему является не сам автор3, а иное лицо (п. 5 ст. 1296 ГК РФ). Как правило, сторонами рассматриваемого договора выступают юридические лица.

Так, согласно пунктам 2, 3 статьи 1296 ГК РФ, по общему правилу исключительное право на созданное произведение принадлежит заказчику, но при этом исполнитель вправе использовать такое произведение для собственных нужд на условиях безвозмездной простой (неисключительной) лицензии в течение всего срока действия исключительного права. Если в договоре прямо предусмотрено, что исключительное право принадлежит исполнителю (подрядчику), то уже (оставить, т.к. здесь подчеркивается различие с предыдущим предложением) заказчик вправе использовать такое произведение в целях, для достижения которых был заключен соответствующий договор на условиях безвозмездной простой (неисключительной) лицензии в течение всего срока действия исключительного права.

В силу того, что исполнителем в рассматриваемых отношениях, как правило, является организация (юридическое лицо), результаты творческой деятельности, как правило, создают её работники, которые наряду с личными неимущественными правами также приобретают право на вознаграждение от своего работодателя за использование им соответствующего служебного объекта (абз. 3 п. 2 ст. 1295, п. 4 ст. 1296 ГК РФ). Такой автор не является стороной договора заказа, однако в силу закона у него есть право на получение указанного вознаграждения от своего работодателя, а не от лица, к которому исключительное право перешло по договору.

Кроме того, законодателем определена сфера применения норм ст. 1296 ГК РФ: правила данной статьи не распространяются на договоры, в которых подрядчиком (исполнителем) является сам автор произведения, т. е. речь идёт о классических договорах авторского заказа (п. 5 ст. 1296 ГК РФ). Рассматриваемая оговорка сделана ещё и потому, что прежде в судебной практике имели место случаи, когда отношения, возникающие из заключенного между юридическими лицами договора на создание произведения по заказу, неверно квалифицировались как правоотношения из договора авторского заказа4.

Одним из основных практических последствий этого нового законодательного решения является то, что в случае нарушения обязательств по рассматриваемому договору применяются общие положения гражданского законодательства об ответственности за нарушение обязательств (а не специальные нормы об ответственности авторов). Это означает, что к нарушителю могут быть применены такие меры гражданско-правовой ответственности, как взыскание неустойки, возмещение убытков, взыскание процентов за пользование чужими денежными средствами и др.

Например, по договорам заказа, заключенным между организаторами и издателями, сторона, нарушившая обязательство (должник), обязана возместить кредитору убытки, причиненные неисполнением или ненадлежащим исполнением обязательства (ст. 393 ГК РФ). В отличие от договоров, заключаемых с авторами, когда применяются правила о взыскании с авторов только реального ущерба, в данном случае лицо, право которого было нарушено (кредитор), вправе требовать полного возмещения убытков, которые включают в себя как реальный ущерб (расходы, которые потерпевшее лицо либо произвело, либо должно будет произвести для устранения последствий правонарушения), так и упущенную выгоду (недополученные доходы) (п. 2 ст. 15 ГК РФ).

В случае неисполнения договора заказа на создание произведения (например, если произведение не создано) или ненадлежащего исполнения такого договора (например, если произведение создано не в полном соответствии с заданием) должник по соответствующему обязательству, как правило, несет ответственность без учета вины. Указанный вывод обусловлен тем, что сторонами в рассматриваемой договорной конструкции обычно являются юридические лица – коммерческие организации, осуществляющие предпринимательскую деятельность. В данном случае ответственность наступает, если лицо не докажет, что надлежащее исполнение оказалось невозможным вследствие непреодолимой силы (п. 3 ст. 401 ГК РФ).

Невыплата вознаграждения или его выплата не в полном объеме так же, как и при нарушении любого денежного обязательства, является основанием для применения меры ответственности в виде начисления на соответствующую сумму процентов, определяемых, по общему правилу, размером ставки рефинансирования Центрального Банка РФ (ст. 395 ГК РФ).

В договоре заказа на создание результата интеллектуальной деятельности может быть предусмотрено, что сторона, нарушившая обязательство, обязана уплатить за это неустойку. Неустойка может уплачиваться за нарушение обязательства как исполнителем, так и заказчиком. Ее размер согласовывается сторонами (ст. 330и331 ГК РФ) и так же не ограничивается суммой реального ущерба, как в договоре авторского заказа.

Помимо этого, к данным обязательственным отношениям подлежит применению диспозитивное правило п. 2 ст. 396 ГК РФ о том, что в случае ненадлежащего исполнения должником своих обязанностей уплата убытков и возмещение неустойки не освобождают его от исполнения обязательства в натуре. Например, если исполнитель по этому договору организовал создание объекта, который отличается от того, который требовался заказчику по условиям соответствующего договора,- после возмещения убытков он, по общему правилу, должен исправить эти недостатки, что будет рассматриваться как исполнение обязательства в натуре.

Согласно новой редакции ст. 1297 ГК РФ, особые правовые формы имеют место при создании произведений в рамках выполнения работ по иным договорам. Исключительные права на произведения, созданные при выполнении договора подряда либо договора на выполнение научно-исследовательских, опытно-конструкторских или технологических работ, которые прямо не предусматривали создание такого произведения, принадлежат подрядчику (исполнителю), если договором между ним и заказчиком не предусмотрено иное (п. 1 ст. 1297 ГК РФ).

Несмотря на то, что по общему правилу исключительное право на созданное произведение принадлежит подрядчику (исполнителю), заказчик вправе использовать созданное произведение в целях, для достижения которых был заключен соответствующий договор на условиях простой (неисключительной) лицензии в течение всего срока действия исключительного права без выплаты за такое использование произведения дополнительного вознаграждения. При передаче подрядчиком (исполнителем) исключительного права на произведение другому лицу заказчик сохраняет право использования произведения.

Напротив, если стороны изменили данное правило и в договоре прямо предусмотрено, что исключительное право принадлежит заказчику или указанному им третьему лицу, то подрядчик (исполнитель) вправе использовать такое произведение для собственных нужд на условиях безвозмездной простой (неисключительной) лицензии в течение всего срока действия исключительного права (абз. 2 п. 1, п. 2 ст. 1297 ГК РФ).

Пункт 3 ст. 1297 ГК РФ повторяет анализируемую выше норму п. 4 ст. 1296 ГК РФ относительно права автора на вознаграждение согласно правилам о служебном произведении (абз. 3 п. 2 ст. 1295 ГК РФ).

2. Изменения, которые вступили в силу с 1 октября 2014 г., затронули также классические договорные конструкции, объединяемые в группу договоров по распоряжению исключительными правами: договоры об отчуждении исключительного права (ст. 1234 ГК РФ) и лицензионные договоры (ст. 1235 ГК РФ).

В соответствии с ГК РФ в редакции Закона № 35-ФЗ с 1 октября 2014 г. в случаях распоряжения правом на результат интеллектуальной деятельности, охраняемый при условии государственной регистрации, соответствующей государственной регистрации подлежит отчуждение исключительного права по рассматриваемому договору, а не сам договор, как это было согласно ранее действовавшей редакции ГК РФ (п. 2 ст. 1234 ГК РФ). Переход исключительного права по договору подлежит государственной регистрации в случаях, предусмотренных в Кодексе (ст. 1232 ГК РФ).

Таким образом, договор об отчуждении исключительного права заключается в письменной форме, однако отсутствует необходимость его государственной регистрации. Практическое значение указанной новеллы заключается, прежде всего, в том, что возникновение обязательственных отношений между сторонами соответствующего договора определяется моментом достижения соглашения по всем его существенным условиям. Однако в связи с этим возникает вопрос о моменте перехода исключительного права.

По общему правилу, исключительное право на результат интеллектуальной деятельности или на средство индивидуализации переходит к приобретателю в момент заключения договора. Если переход исключительного права на результат интеллектуальной деятельности подлежит государственной регистрации, то исключительное право на такой результат переходит от правообладателя к приобретателю в момент государственной регистрации права (п. 4 ст. 1234 ГК РФ). Так, например, исключительное право на изобретение, полезную модель или промышленный образец признается и охраняется при условии государственной регистрации соответствующих изобретений, полезной модели или промышленного образца (ст. 1232, 1353 ГК РФ).

Законодатель подробно регламентирует порядок государственной регистрации отчуждения исключительного права на результат интеллектуальной деятельности (порядок подачи документов, документация и иные вопросы регламентируются правилами ст. 1232 ГК РФ).

При несоблюдении правил о государственной регистрации перехода исключительного права переход такого права, его залог или предоставление права использования считается несостоявшимся (п. 6 ст. 1232 ГК РФ).

Особо законодатель оговаривает различные формы выплаты вознагражденияпо договору об отчуждении исключительного права, такие как фиксированные разовые или периодические платежи, процентные отчисления от дохода (выручки) либо в иной форме (п. 3 ст. 1234 ГК РФ).

В новом п. 3.1 ст. 1234 ГК РФ в редакции Закона № 35-ФЗ отмечается, что не допускается безвозмездное отчуждение исключительного права между коммерческими организациями, если иное не будет предусмотрено ГК РФ.

В соответствии с п. 5 ст. 1234 ГК РФ установлен специальный способ защиты прав прежнего правообладателя при существенном нарушении приобретателем обязанности выплатить ему в установленный договором срок вознаграждение за приобретение исключительного права на объект. В этой ситуации прежний правообладатель вправе требовать в судебном порядке перевода на себя прав приобретателя исключительного права и возмещения убытков, если исключительное право перешло к его приобретателю (абз. 1 п. 5 ст. 1234 ГК РФ)5. Если право ещё не перешло к приобретателю, при существенном нарушении им такой обязанности правообладатель может отказаться от договора в одностороннем порядке и потребовать возмещения убытков, причиненных расторжением договора. При этом договор прекращается по истечении тридцатидневного срока с момента получения приобретателем уведомления об отказе от договора, если в этот срок приобретатель не исполнил обязанность выплатить вознаграждение (абз. 2 п. 5 ст. 1234 ГК РФ).

Кроме того, в соответствии с новыми правилами, введенными Законом № 35-ФЗ, государственной регистрации подлежит также предоставление права использования результата интеллектуальной деятельности или средства индивидуализации по лицензионному договору (п. 2 ст. 1235 ГК РФ). Лицензионный договор заключается в письменной форме и с 1 октября 2014 г. не подлежит государственной регистрации.

Предоставление права использования результата интеллектуальной деятельности подлежит государственной регистрации в случаях и порядке, предусмотренных ст. 1232 ГК РФ.

Правила о выплате вознаграждения и о запрете на безвозмездное предоставление права использования результата интеллектуальной деятельности между коммерческими организациями применительно к лицензионному договору схожи с теми, которые были рассмотрены выше применительно к договору об отчуждении исключительного права (п. 5 ст. 1235 ГК РФ и п. 5.1 ст. 1235 ГК РФ).

Новеллой законодательного регулирования является закрепление в п. 1.1. ст. 1236 ГК РФ диспозитивной нормы о запрете для лицензиара на использование результата интеллектуальной деятельности в тех пределах, в которых право использования такого результата предоставлено лицензиату по договору на условиях исключительной лицензии.

В рамках п. 4 ст. 1237 ГК РФ также определен механизм одностороннего расторжения договора по инициативе лицензиара (схожий с правилами п. 5 ст. 1234 ГК РФ). При существенном нарушении лицензиатом обязанности выплатить в установленный договором срок вознаграждение за предоставление права использования произведения лицензиар может отказаться в одностороннем порядке от лицензионного договора и потребовать возмещения убытков, причиненных его расторжением. Договор прекращается по истечении тридцатидневного срока с момента получения уведомления об отказе от договора, если в этот срок лицензиат не исполнил обязанность выплатить вознаграждение.

В рамках анализируемых изменений в часть четвертую Гражданского кодекса РФ была введена концептуально новая для отечественного правопорядка форма распоряжения исключительным правом на произведение – открытая лицензия на использование произведения науки, литературы или искусства (ст. 1286.1 ГК РФ). Аналоги введенной в российское гражданское законодательство конструкции открытой лицензии известны в зарубежных правопорядках. Наиболее распространённой из таких конструкций являются лицензии Creative Commons6. Значение и перспективы использования механизма открытых лицензий ввиду существенной специфики данного правового средства должны выступать предметом самостоятельного исследования.

Рассмотренные изменения гражданского законодательства Российской Федерации, посвященные механизмам распоряжения исключительными правами, в основном, следует признать своевременными и продуктивными. В рамках указанного реформирования законодательства созданы предпосылки для решения многих проблем, которые были выявлены в ходе реализации норм о соответствующих договорах, а также активно обсуждались в научной литературе. Прежде всего, эти изменения продиктованы развитием цифровых технологий, требованием применения новых подходов к правовому регулированию отношений, возникающих не только в связи с использованием произведений в сети «Интернет», но и в сфере оборота исключительных прав в целом.

 

 


1См.: Федеральный закон от 12 марта 2014 г. № 35-ФЗ «О внесении изменений в части первую, вторую и четвертую Гражданского кодекса Российской Федерации и отдельные законодательные акты Российской Федерации» // Собрание законодательства РФ. 2014. № 11. Ст. 1100.

2В редакции, действующей до 1 октября 2014 г., анализируемая норма включает в себя только договоры по созданию программы для ЭВМ и базы данных по заказу (ст. 1296 ГК РФ). В литературе отсутствует единая точка зрения относительно того, к какой группе относятся рассматриваемые договоры. Так, согласно п. 13 заключения Исследовательского центра частного права при Президенте РФ, рассматриваемый договор «по своей правовой природе является смешанным договором» и содержит элементы, характерные для различных договорных конструкций. Вместе с тем отмечается, что по своему основному содержанию такой договор относится к договорам подрядного типа, договорам о выполнении работ. См.: Заключение Исследовательского центра частного права по вопросам толкования и возможного применения отдельных положений части четвертой Гражданского кодекса Российской Федерации // Вестник гражданского права. 2007. № 3. С. 130.

3Автору не принадлежит исключительное право на такое произведение, однако за ним сохраняется право на вознаграждение.

4См., например: Постановление ФАС Московского округа от 08.11.2010 по делу № А40-17167/10-15-115; ФАС Уральского округа от 20.04.2010 по делу № А60-21914/2009-С7 // СПС «ГАРАНТ».

5Таким образом, анализируемая норма не исключает возможности применения прежним правообладателем иных способов защиты (ст. 12 ГК РФ) (п. 13.4 Постановления Пленума ВС РФ № 5, Пленума ВАС РФ № 29 от 26.03.2009 «О некоторых вопросах, возникших в связи с введением в действие части четвертой Гражданского кодекса Российской Федерации») // Российская газета. 22.04.2009. № 70.

6См. об этом: Войниканис Е.А. Право интеллектуальной собственности в цифровую эпоху: парадигма баланса и гибкости. М.: Юриспруденция, 2013. 552 с.; Савельев А.И. Свободные лицензии на программное обеспечение в контексте реформы гражданского законодательства // Вестник гражданского права. 2012. № 4. С. 75–101 и др.).

 

Подлежит ли законодательному регулированию порядок расчета цены по лицензионному соглашению? //

Рассмотрев вопрос, мы пришли к следующему выводу:

Стороны лицензионного договора самостоятельно договариваются о размере вознаграждения и форме его выплаты.

Правительство РФ имеет право устанавливать лишь минимальные ставки вознаграждений по лицензионным договорам о предоставлении права использования произведения.

Обоснование вывода:

По лицензионному договору одна сторона — обладатель исключительного права на результат интеллектуальной деятельности или на средство индивидуализации (лицензиар) предоставляет или обязуется предоставить другой стороне (лицензиату) право использования такого результата или такого средства в предусмотренных договором пределах (п. 1 ст. 1235 ГК РФ).

Согласно п. 5 ст. 1235 ГК РФ лицензиат обязуется уплатить лицензиару обусловленное лицензионным договором вознаграждение, если договором не предусмотрено иное. При отсутствии в возмездном лицензионном договоре условия о размере вознаграждения или порядке его определения договор считается незаключенным. При этом правила определения цены, предусмотренные п. 3 ст. 424 ГК РФ, не применяются, поскольку результаты интеллектуальной деятельности и приравненные к ним средства индивидуализации создаются творческим трудом и являются неповторимыми.

В силу п. 1 ст. 424 ГК РФ исполнение договора оплачивается по цене, установленной соглашением сторон. В предусмотренных законом случаях применяются цены (тарифы, расценки, ставки и т.п.), устанавливаемые или регулируемые уполномоченными на то государственными органами и (или) органами местного самоуправления.

Поскольку в ст. 1235 ГК РФ не содержится правил, ограничивающих стороны в определении размера и порядка выплаты вознаграждения обладателю исключительного права в случае заключения лицензионного договора, его стороны должны самостоятельно согласовать это условие. При этом формы выплаты вознаграждения могут быть любыми (например единовременный фиксированный платеж, периодический фиксированный платеж, периодические отчисления от дохода и т.д.).

Исключение составляют только те случаи, когда закон предписывает руководствоваться определенными нормами при согласовании условия лицензионного договора о вознаграждении.

Так, устанавливая размер вознаграждения в лицензионном договоре о предоставлении права использования произведения (ст. 1286 ГК РФ), следует иметь в виду, что в силу п. 4 ст. 1286 ГК РФ право устанавливать минимальные ставки авторского вознаграждения за отдельные виды использования произведений предоставлено Правительству РФ.

В настоящее время продолжают действовать постановления Правительства РФ от 21 марта 1994 г. N 218 "О минимальных ставках авторского вознаграждения за некоторые виды использования произведений литературы и искусства" и от 17 мая 1996 г. N 614 "О ставках вознаграждения исполнителям за некоторые виды использования исполнения (постановки)".

Каких-либо иных нормативных правовых актов, определяющих минимальные ставки вознаграждения по лицензионным договорам о предоставлении права использования произведения, в настоящее время не принято.

Эксперт службы Правового консалтинга ГАРАНТ

Штукатурова Татьяна

Информационное правовое обеспечение ГАРАНТ

http://www.garant.ru

Исследование метаболического пути метаболического контроля метилэритритол-4-фосфатного пути микробного образования терпеноидов | Microbial Cell Factories

Бактериальные штаммы и условия культивирования

Стандартное клонирование и метаболическая инженерия были выполнены с использованием штаммов E. coli 10β и BL21 (DE3), соответственно (оба поставляются New England Biolabs, Ипсвич, Массачусетс, США). Для общего клонирования бактерии культивировали в среде лизогенного бульона (LB), тогда как для всех других экспериментов бактерии культивировали в среде M9 с добавлением 0.5% (мас. / Об.) Глюкозы и соответствующие антибиотики (50 мкг мл -1 канамицин, 100 мкг мл -1 ампициллин и / или 25 мкг мл -1 хлорамфеникол) при 37 ° C [24]. Штаммы, несущие плазмиды pSIM5 или pSIM6 [25], выращивали при 30 ° C и излечивали от плазмид при 37 ° C. Культуры выращивали в колбах Эрленмейера с перегородками, заполненных до одной пятой их номинального объема, и перемешивали со скоростью 180 об / мин. Рост клеток в жидкой среде контролировали спектрофотометрией для определения оптической плотности при 600 нм (OD 600 ).

Общее клонирование и амплификация

Общие процедуры клонирования и очистка плазмид выполнялись в соответствии со стандартной лабораторной практикой [24]. ДНК-полимеразу слияния Herculase II (Agilent Technologies, Санта-Клара, Калифорния, США) использовали для амплификации фрагментов ДНК с помощью полимеразной цепной реакции (ПЦР) в соответствии с инструкциями производителя. Все плазмиды и измененные участки генома были проверены секвенированием по Сэнгеру, проведенным Eurofins GmbH (Эберсберг, Германия).

Конструирование плазмид для продукции изопрена

Ген isp S из Populus alba был оптимизирован для кодонов E. coli (дополнительный файл 1: Таблица S1) (Thermo Fisher Scientific, Waltham, MA, USA ) и ген был амплифицирован с использованием прямого праймера 5'-AAT AAT TTT GTT TAA CTT TAA TAA GGA GAT ATA CC A TG G AAG CTC GTC GTT CTG C-3 'и обратного праймера 5'-TTA GCG TTC AAA TGG CAG TAG CAA GCT TGT CGA CCA CGT TCG AAC GGC AGG ATC-3 '(стартовый кодон выделен жирным шрифтом).Вектор pCOLA амплифицировали с использованием прямого праймера 5'-GGT ATA TCT CCT TAT TAA AGT TAA ACA-3 'и обратного праймера 5'-GGT CGA CAA GCT TGC GGC CG-3'. Продукты были соединены сборкой Гибсона, давая pCOLA :: IspS, который затем был амплифицирован с использованием прямого праймера 5'-GGC CGC ATA ATG CTT AAG TCG-3 'и обратного праймера 5'-GCA AGC TTG TC GAC CTT AGC-3'. Ген изопентенилдифосфатизомеразы ( idi ) амплифицировали из генома E. coli штамма BL21 с использованием прямого праймера 5'-TAC TGC CAT TTG AAC GCT AAG GTC GAC AAG CTT GCA AGG AGA TAT ACC ATG CAA ACG GAA CAC GTC AT-3 'и обратный праймер 5'-GAT TAC TTT CTG TTC GAC TTA AGC ATT ATG CGG CCT TAA TTG TGC TGC GCG AAA G-3'.Полученные фрагменты снова были объединены сборкой Гибсона для получения pCOLA :: IspS-idi.

Конструирование библиотек экспрессии dxs и dxr

Escherichia coli трансформировали pSIM5 и выращивали при 30 ° C для поддержания плазмиды. Соответственно, мы инокулировали 20 мл среды LB с 200 мкл выращенной в течение ночи культуры E. coli pSIM5 и инкубировали культуру до тех пор, пока OD 600 не достигла 0,5. Затем культуру переносили в шейкер с водяной баней при 42 ° C и инкубировали в течение 10 минут для индукции экспрессии gam , bet и exo .Затем культуру помещали в ледяную суспензию на 10 мин. После центрифугирования при 4000 × g в течение 15 мин при 4 ° C супернатант отбрасывали, осадок ресуспендировали в 20 мл бидистиллированной воды при 0 ° C и снова центрифугировали. Эту стадию повторяли дважды, а затем осадок ресуспендировали в 0,2 мл бидистиллированной воды. Затем мы добавили 100 пмоль соответствующего олигонуклеотида: для экспрессионной библиотеки dxs последовательность была 5'-GAC TAC ATC ATC CAG CGT AAT AAA TAA ACA ATA A C T DDD RRR RRD DDD CTG ATG AGT TTT GAT ATT GCC AAA TAC CCG ACC CTG GCA-3 ', а для библиотеки экспрессии dxr последовательность была 5'-TCG AGC CGG TCG AGC CCA GAA TGG TGA GTT GCT T CA T GA A HH HHY YYY YHH TGA GAC AGA ATA AAA AGC AAA ACG CCG CCA GCC GAT CCG-3 '(изменения геномной последовательности подчеркнуты).Олигомеры были сконструированы, как описано Wang et al. [8] и содержал четыре фосфоротиоатных основания на 5'-конце. Для электропорации использовали аликвоту клеток объемом 50 мкл, после чего клетки регенерировали при 30 ° C.

Эту процедуру проводили семь раз с попеременным использованием pSIM5 и pSIM6 и соответствующих антибиотиков. После шестого раунда рекомбинирования клетки регенерировали без антибиотиков при 37 ° C в течение 2 часов и разведения наносили на чашки. Одиночные колонии использовали для ПЦР колоний.Геномную область, содержащую целевую мутацию, амплифицировали с прямым праймером 5'-ACC AGC AAC TTG GTA AAA GTA CC-3 'и обратным праймером 5'-CGA TTT TGT CGC GGC G-3' для библиотеки экспрессии dxs , и с прямым праймером 5'-ACA GCC AAC GCG CTT CAA TG-3 'и обратным праймером 5'-TCG TGG TGA AGC AGA ACA AG-3' для библиотеки экспрессии dxr . Ампликоны секвенировали с использованием тех же праймеров.

Количественное определение метаболитов

10-миллилитровый объем среды M9 с добавлением 0.5% (мас. / Об.) Глюкозы инокулировали 100 мкл ночной культуры в 200-мл колбы Эрленмейера. Аликвоту объемом 1 мл отбирали из культуры при OD 600 ≈ 0,5 и центрифугировали при 13000 × g в течение 1 мин при 4 ° C. Супернатант удаляли, а осадок ресуспендировали в 90 мкл гасящего раствора при -20 ° C перед добавлением 10 мкл 360 мкМ азидотимидина [26]. Раствор для гашения содержал 40% метанола, 40% ацетонитрила и 20% бидистиллированной воды, подкисленной 0,5% муравьиной кислоты [27].Образец инкубировали при -20 ° C в течение 1 ч для количественной экстракции промежуточных продуктов пути MEP. Раствор центрифугировали при 17000 × g в течение 1 мин при 4 ° C и переносили в мерную пробирку.

Для анализа внеклеточных метаболитов отбирали 1 мл культуры и немедленно центрифугировали при 13000 × g в течение 1 мин при 4 ° C. Аликвоту надосадочной жидкости объемом 20 мкл смешивали с 70 мкл модифицированного гасящего раствора (50% метанол, 50% ацетонитрил, подкисленный 0.25% муравьиной кислоты) и 10 мкл 360 мкМ азидотимидина [26].

Калибровочные кривые для абсолютного количественного определения были построены с использованием аналитических стандартов для всех целевых метаболитов. Стандарты хранили в лиофилизированном виде при -20 ° C перед приготовлением серии разведений смешанных аналитических стандартов в гасящем растворе. Калибровочные кривые внутриклеточных метаболитов получали путем смешивания 90 мкл каждого набора разведенных стандартов с лиофилизированным экстрактом 1 мл E. культуры coli , выращенной в минимальной среде с глюкозой U- 13 C до OD 600 = 0.5, чтобы учесть матричные эффекты других метаболитов в E. coli . Этот шаг был пропущен для калибровочной кривой внеклеточных метаболитов. Мы добавили 10 мкл внутреннего стандарта 360 мкМ азидотимидина. Раствор центрифугировали при 17000 × g в течение 1 мин при 4 ° C и переносили в мерную пробирку. Чтобы рассчитать внутриклеточную концентрацию на основе концентрации в образце, фактор внутриклеточного объема составляет 3,6 мкл · мл -1 ОП. −1 600 было принято [28].

Метаболиты анализировали с использованием системы ВЭЖХ Shimadzu (Токио, Япония), соединенной с масс-спектрометром 6500 QTRAP (Sciex, Дармштадт, Германия). Автоматический пробоотборник охлаждали до 15 ° C. Поток поддерживали постоянным на уровне 0,25 мл мин -1 . Духовой шкаф нагревали до 40 ° C. Метаболиты разделяли по принципу обращенно-фазовой ионной пары на колонке Nucleoshell RP18 (2,7 мкм, 90 Å, 100 мм) (Macherey – Nagel, Düren, Германия). Использовали два буфера: буфер A содержал 15 мМ трибутиламина и 20 мМ муравьиной кислоты, тогда как буфер B представлял собой 100% метанол.Элюирование начиналось с 0% буфера B в течение 2 минут, затем следовало увеличение до 40% буфера B в течение 1 минуты, выдержка при 40% буфера B в течение 3 минут, увеличение до 100% буфера B в течение 6 минут, затем уменьшение до 0% буфера B в течение 1 мин и заключительная выдержка в течение 4 мин. Базовое разделение всех промежуточных продуктов, кроме IPP и DMAPP, было достигнуто (дополнительный файл 1: рис. S1). Масс-спектрометр работал в отрицательном режиме с единичным разрешением для масс-фильтров Q1 и Q3 с оптимизированными параметрами для метода ВЭЖХ (дополнительный файл 1: таблица S2).Оптимизированные параметры для каждого метаболита перечислены в Дополнительном файле 1: Таблица S3.

Количественное определение белка

Мы инокулировали 50 мл среды 0,5 мл ночной культуры и индуцировали экспрессию гена с помощью 1 мМ изопропил-β-d-1-тиогалактопиранозида (IPTG) при OD 600 = 0,1. Культуру инкубировали до тех пор, пока OD 600 не достигнет 0,5, а затем приготовили, как описано Gaida et al. [29].

In silico предсказание массы пептида и размера фрагмента

In silico предсказание и экраны мониторинга одиночных реакций (SRM) выполнялись с использованием программного обеспечения Skyline [30].После расщепления in silico с трипсином мы исключили пептиды вне диапазона размеров 8–20 аминокислот, пептиды, содержащие остатки цистеина, или пептиды с потенциально рваными концами из-за тандемных остатков аргинина и / или лизина. Остальные пептиды подвергали скринингу на наличие двухзарядных частиц с однозарядными фрагментами серии y после столкновения в ячейке столкновения Q2. Пептиды и фрагменты со значениями m / z вне диапазона 50–1000 Да были исключены. В Skyline оптимизированы потенциал декластеризации и энергия столкновения для всех фрагментов.Предсказанные переходы искали в лизатах штаммов E. coli BL21, сверхэкспрессирующих соответствующий ген. Протеотипические пептиды были выбраны для каждого белка в соответствии с несколькими критериями: (i) по крайней мере, два перехода с высокими отношениями сигнал / шум; (ii) времена удерживания для всех переходов равны и близки к прогнозируемому значению [30]; (iii) уникальные переходы в протеоме E. coli , обеспечиваемые поиском в базе данных NCBI с использованием BLAST [31] и Mascot [32]; и (iv) сила сигнала перехода на несколько порядков ниже в отрицательном контроле, не сверхэкспрессирующем соответствующий ген.Если все критерии совпадают, были отобраны протеотипические пептиды с наивысшим отношением сигнал / шум для достижения максимальной чувствительности.

Синтетический внутренний стандарт и калибровочная кривая

После выбора одного протеотипического пептида для каждого интересующего белка были синтезированы точные количества каждого пептида (JPT, Берлин, Германия) в нормальной и тяжелой формах, последняя содержала 13 C и 15 N меченых лизина и аргинина (SpikeTides L, JPT). Значения m / z для обнаружения меченых пептидов были соответственно изменены.Все синтетические пептиды включали C-концевую модификацию Qtag (JPT), которая может расщепляться трипсином. Мы использовали 1 нмоль тяжелых меченых пептидов в качестве внутреннего стандарта, который вводили в образец перед восстановлением дитиотреитолом. Своевременное введение внутреннего стандарта, а также метки, которую необходимо отколоть, обеспечивает количественный контроль качества на всех этапах подготовки и анализа образцов. Известные количества синтетических пептидов использовали для построения калибровочной кривой на основе того же протокола подготовки, что и для всех других образцов, включая добавление внутреннего стандарта.Опять же, внутриклеточный объем 3,6 мкл · мл -1 OD. −1 600 было принято [28].

Разделение и обнаружение пептидов

Пептиды разделяли методом ЖХ-МС / МС [33]. Образец объемом 5 мкл вводили в колонку Ascentis Express Peptide ES-C18 (5 см × 2,1 мм, 2,7 мкм) (Sigma-Aldrich, Сент-Луис, Миссури, США), снабженную совместимой защитной колонкой. Пептиды элюировали при скорости потока 400 мкл мин. -1 в 2% ацетонитриле плюс 98% бидистиллированной воды, содержащей 0.1% муравьиной кислоты (буфер A) и 98% ацетонитрила плюс 2% бидистиллированной воды, содержащей 5% муравьиной кислоты (буфер B). Элюция началась с 5% буфера B, увеличиваясь до 40% буфера B за 17 мин, а затем до 95% буфера B за 0,5 мин, с последующей выдержкой в ​​течение 1 мин перед уменьшением до 5% буфера B через 0,5 мин и выдержкой в ​​течение 3 мин. для повторного уравновешивания. Пептиды были количественно определены с использованием Multiquant (Sciex, Дармштадт, Германия) в соответствии с деталями, представленными в Дополнительном файле 1: Таблица S4. Разделение базовой линии было достигнуто для всех измеренных пептидов (дополнительный файл 1: рис.S2).

Количественное определение изопрена

Escherichia coli культур выращивали в среде M9, содержащей 0,1% (мас. / Об.) Глюкозы, в колбах Эрленмейера с перегородками. При OD 600 = 0,1 культуры индуцировали 1 мМ IPTG. При OD 600 = 0,5 несколько аликвот культуры объемом 1 мл переносили во флаконы объемом 10 мл и герметично закрывали. Запечатанные аликвоты продолжали расти при 37 ° C при встряхивании. В определенные моменты времени флаконы перемещали в кипящую воду и инкубировали в течение 5 минут перед охлаждением до 4 ° C.

Внешние калибровочные кривые использовали для количественного определения с серией разбавлений коммерческого изопрена. Все образцы инкубировали при 37 ° C в течение не менее 10 минут перед количественным определением. Шприц с подогревом использовался для извлечения 200 мкл из газовой фазы и введения образца в нагретый (100 ° C) порт ввода ГХ-МС / МС TQ8030 (Shimadzu). Образцы разделяли на капиллярной колонке ZB-XLB-HT-Inferno (30 м × 0,25 мм, 0,25 мкм) (Phenomenex, Ашаффенбург, Германия) с гелием в качестве газа-носителя.Температурная программа начиналась с 40 ° C в течение 1 минуты с линейным повышением до 80 ° C за 1 минуту с последующей выдержкой в ​​течение 1 минуты. Изопрен был обнаружен в режиме мониторинга множественных реакций (MRM) с переходами от 68,1 до 67 m / z и от 67,1 до 41 m / z с энергией столкновения 13 и 10 кВ, соответственно. Источник ионов поддерживали при 200 ° C, а границу раздела - при 250 ° C.

Химические вещества и реагенты

Если не указано иное, все химические вещества и индукторы были приобретены у Sigma-Aldrich.Следующие стандарты для количественного определения промежуточных продуктов пути MEP были предоставлены Echelon Biosciences (Солт-Лейк-Сити, Юта, США): 2- C -метил-d-эритритол 4-фосфат (MEP), 1-дезокси-d-ксилулоза. 5-фосфат (DXP), изопентенилпирофосфат (IPP) и диметилаллилпирофосфат (DMAPP). Растворители для ВЭЖХ – МС были предоставлены Carl-Roth (Карлсруэ, Германия), а U- 13 C-глюкоза была приобретена в Cambridge Isotope Laboratories (Тьюксбери, Массачусетс, США). Газы для ГХ приобретены у Linde AG (Мюнхен, Германия).

Определение потока по включению метки

Потоки в пути MEP у дикого типа и мутантов рассчитывали по абсолютному включению 13 C в DXP в анализах мечения во времени в диапазоне от 10 с до 30 мин. Ночные культуры E. coli использовали для инокуляции 40 мл минимальной среды M9 с соответствующими антибиотиками до OD 600 ~ 0,02 AU. Для выращивания использовали сосуд с регулируемой температурой (изготовленный по индивидуальному заказу, Охс, Йена).Концентрацию глюкозы доводили до 0,05% с помощью 20% (мас. / Об.) Раствора глюкозы. Эта концентрация глюкозы была рассчитана как достаточная, чтобы позволить культуре вырасти до OD 600 0,5 с остаточной концентрацией глюкозы, достаточно высокой для предотвращения углеродного голодания. Культуры выращивали при 37 ° C при перемешивании с помощью магнита до OD 600 ~ 0,1 AU и индуцировали 1 мМ IPTG. Добавляли U- 13 C-глюкозу до конечной концентрации 0,05% при OD 600 ~ 0.5 AU. В выбранные моменты времени отбирали 1 мл культуры и вводили в 10 мл 2% раствора NaCl, выдержанного при 0 ° C, чтобы замедлить дальнейший метаболизм. Затем погашенную культуру немедленно фильтровали через фильтр 0,45 мкм (0,45 мкм, 22 мм, PVDF, Merck Milipore) в держателе фильтра Swinnex (Merck Milipore). Затем фильтр переносили для экстракции в сосуд с 1 мл 80% метанола [26], предварительно охлажденный до 0 ° C. После 10 мин инкубации раствор для экстракции переносили в пробирку объемом 2 мл, фильтр снова экстрагировали и промывали 1 мл метанола.Экстракты объединяли и центрифугировали при 15000 g в течение 1 мин при 4 ° C. Супернатант переносили в новую пробирку и упаривали при 60 ° C досуха. Осадок растворяли в 50 мкл dd H 2 O и определяли метаболиты с помощью ЖХ-МС / МС. {{\ left [{- k \ times t } \ right]}}} \ right) \), где A - плато маркировки, t - время маркировки, а k - кинетическая константа скорости.{2} \) значения с использованием алгоритма минимизации Левенберга – Марквардта, реализованного в библиотеке научных вычислительных процедур SciPy (http://www.scipy.org). Оценки семян были получены путем визуального осмотра максимумов маркировки кривых (для A ) и с использованием \ (1 / t_ {1/2} \) (для k ). Затем поток был рассчитан для каждой линии путем умножения размера пула DXP на подобранную константу скорости k .

50 GK Вопросы для класса 5

Введение

Общие знания для 5 класса - ключ к развитию интеллекта вашего ребенка.Получение знаний из различных источников не только делает уличных детей умнее, но и улучшает их успеваемость.

Общие вопросы викторины для 5 класса очень помогают ученикам выделиться из толпы. Обучение, выходящее за рамки академических кругов, стало обычным делом, поскольку мир день ото дня становится все более конкурентоспособным.


Gk Вопросы для класса 5

Вот список GK вопросов с ответами на английском для 5 класса, которые помогут им в их будущем.Теперь родители могут быть уверены, что их ребенок получит возможность лучше осведомиться с помощью этих типовых вопросов GK для класса 5. Они могут думать об этих GK-вопросах для класса 5 с ответами как на разминке, которая готовит маленьких учеников к трудностям. предстоящий.


Вот список вопросов Gk для 5 класса на английском языке (с ответами)

GK ВОПРОСЫ ДЛЯ КЛАССА 5: ОБЩИЕ

1 кв. Сколько согласных в английском алфавите?

2 кв.Что растет быстрее - волосы или ногти на ногах?

3 кв. Какая гора самая высокая в мире?

4 кв. В какой известной детской книге есть два персонажа по имени Твидлдум и Твидлди?

Алиса в Зазеркалье Льюиса Кэрролла

Q5. На какой планете есть гигантское красное пятно?

Q6.Что из перечисленного не является металлом: золото, смола, стекло?

Q7. Какое плато самое большое в мире?

Q8. В каком океане затонул знаменитый Титаник в 1912 году - Тихом, Североатлантическом или Средиземном?

9 кв. Какие две части тела продолжают расти на протяжении всей вашей жизни?

Q10. Что составляет (приблизительно) 80% объема нашего мозга?

Q11.По чему водитель определяет направление движения автомобиля?

Q12. Какие стопорные рожки на фондовом рынке?

Q13. Назовите союзные территории Индии?

Национальная столичная территория Дели

Джамму и Кашмир

Ладакх

Чандигарх

Андаманские и Никобарские острова

Дадра Нагар Хавели и Даман и Диу

Лакшадвип

Пудучерри


ГК ВОПРОСЫ ПО КЛАССУ 5: НАУКА

Q14.Чем транспортируется вода в растениях?

Q 15. Что не входит в состав хлорофилла? Азот или кальций?

Q 16. Лук (Allium cepa) представляет собой модифицированную форму?

Q 17. Каково ботаническое название томата?

Q 18. К какой категории животных относится осьминог?

Q19. Температура Луны днем ​​выше или ниже?

Q20.Какая планета самая маленькая: Нептун, Марс, Меркурий?

Q21. Ваша группа крови определяется генами, которые вы унаследовали от родителей: верно или неверно?

Q22. Кислород, выделяемый во время фотосинтеза, поступает из

Q23. Часть стебля, на которой прикреплен лист

Q24. Какой сенсорный орган человеческого тела состоит из видимой части, называемой короной, и невидимой части, называемой корнем?

Q25.Какая структура глаза наиболее чувствительна, но не содержит кровеносных сосудов?


GK ВОПРОСЫ ДЛЯ КЛАССА 5: MATHS

Q26. Какой следующий номер в следующей последовательности - 7, 14, 21, 28?

Q27. Разместите эти фигуры в порядке их количества сторон - квадрата, треугольника, восьмиугольника и шестиугольника?

Треугольник, квадрат, шестиугольник, восьмиугольник

Q28.Каков квадратный корень из 144?

Q29. Что составляет три пятых от 50?

Q30. Найдите наибольшее число, которое разделит 43, 91 и 183, чтобы в каждом случае оставался одинаковый остаток.

Q31. H.C.F. двух чисел равно 23, а два других фактора их L.C.M. равны 13 и 14. Большее из двух чисел:

Q32. Шесть колоколов начинают звонить вместе и звонить с интервалами 2, 4, 6, 8 10 и 12 секунд соответственно.Сколько раз они звонят вместе за 30 минут?

В33. Пусть N будет наибольшим числом, которое разделит 1305, 4665 и 6905, оставив в каждом случае одинаковый остаток. Тогда сумма цифр в N будет:

Q34. Наибольшее число из четырех цифр, которое делится на 15, 25, 40 и 75:

Q35. Произведение двух чисел равно 4107. Если H.C.F. из этих чисел 37, то большее число:

Q36.Три числа находятся в соотношении 3: 4: 5 и их L.C.M. 2400. Их H.C.F. это:

Q37. G.C.D. из 1,08, 0,36 и 0,9 это:

Q38. Произведение двух чисел - 2028 и их H.C.F. равно 13. Количество таких пар:

Q39. Наименьшее кратное 7, которое оставляет остаток 4, при делении на 6, 9, 15 и 18 составляет:

Q40.Кто известен как принц индийской математики?

Вопрос 41. «Число управляет Вселенной». Кто это сказал?

Q42. Как называется самая длинная сторона прямоугольного треугольника?

Q43. Какое число вы получите, если умножите все числа на телефонной цифровой клавиатуре?

Q44. Какая теория треугольников самая известная в геометрии?

Q45.В какой системе счисления нет представления нуля?

Q46. Какое общее количество точек на кубике?

В47. Какой фильм основан на Шринивасе Рамануджане?

Человек, который знал бесконечность

Q48. Кто считается «отцом математики»?

Q49.Какое число считается числом Рамануджана?

Q50. Сколько нулей в миллиард?


Заключение

Общие знания для 5-го класса играют ключевую роль в жизни учащегося. Чтобы преуспеть в учебе, а также повысить общую осведомленность о происходящем в мире, необходимо непрерывное изучение общих знаний. Есть много способов улучшить свои общие знания.

Во-первых, ежедневное чтение грамотных книг, а также газеты в течение получаса повысит общие знания учащихся 5-го класса. Эффективные пометки рядом с прочитанной информацией помогают удерживать факты.


О компании Cuemath

Cuemath, удобная для учащихся платформа математики и кодирования, проводит регулярные онлайн-классы для учебы и развития навыков, а их приложение Mental Math для iOS и Android представляет собой универсальное решение для детей, развивающее несколько навыков.Изучите структуру комиссионных сборов Cuemath и подпишитесь на бесплатную пробную версию.

Инфузии азацитидина и донорских лимфоцитов в качестве первой терапии для спасения рецидива ОМЛ или МДС после трансплантации аллогенных стволовых клеток

  • 1

    Шленк Р.Ф., Донер К., Мак С., Стоппель М., Кирали Ф., Гоце К. и др. . Проспективная оценка трансплантации аллогенных гемопоэтических стволовых клеток от согласованных родственных и неродственных доноров у молодых людей с острым миелоидным лейкозом высокого риска: немецко-австрийское исследование AMLHD98A. J Clin Oncol 2010; 28 : 4642–4648.

    Артикул Google ученый

  • 2

    Saure C, Schroeder T, Zohren F, Groten A, Bruns I, Czibere A et al . Предварительная трансплантация аллогенных стволовых клеток крови пациентам с миелодиспластическим синдромом высокого риска или вторичным острым миелоидным лейкозом с использованием режима последовательного кондиционирования с высокими дозами на основе FLAMSA. Пересадка костного мозга Biol 2011; 18 : 466–472.

    Артикул Google ученый

  • 3

    Павлетик С.З., Кумар С., Мохти М., де Л.М., Форан Дж. М., Паскини М. и др. . Первый международный семинар NCI по биологии, профилактике и лечению рецидива после трансплантации аллогенных гемопоэтических стволовых клеток: отчет Комитета по эпидемиологии и естественной истории рецидива после трансплантации аллогенных клеток. Пересадка костного мозга Biol 2010; 16 : 871–890.

    Артикул Google ученый

  • 4

    van den Brink MR, Porter DL, Giralt S, Lu SX, Jenq RR, Hanash A et al . Рецидив после терапии аллогенными кроветворными клетками. Пересадка костного мозга Biol 2010; 16 (1 приложение): S138 – S145.

    Артикул Google ученый

  • 5

    Портер Д.Л., Алиеа Е.П., Антин Дж. Х., Делима М., Эстей Е., Фалькенбург Дж. Х. и др. .Первый международный семинар NCI по биологии, профилактике и лечению рецидивов после трансплантации аллогенных гемопоэтических стволовых клеток: отчет Комитета по лечению рецидивов после трансплантации аллогенных гемопоэтических стволовых клеток. Пересадка костного мозга Biol 2010; 16 : 1467–1503.

    Артикул Google ученый

  • 6

    Крогер Н. Подходы к рецидиву после трансплантации аллогенных стволовых клеток. Curr Opin Oncol 2011; 23 : 203–208.

    Артикул Google ученый

  • 7

    Шмид С., Лабопин М., Наглер А., Борнхаузер М., Финке Дж., Фассас А. и др. . Инфузия донорских лимфоцитов в лечении первого гематологического рецидива после аллогенной трансплантации стволовых клеток у взрослых с острым миелоидным лейкозом: ретроспективный анализ факторов риска и сравнение с другими стратегиями Рабочей группой EBMT Acute Leukemia. J Clin Oncol 2007; 25 : 4938–4945.

    CAS Статья Google ученый

  • 8

    Eapen M, Giralt SA, Horowitz MM, Klein JP, Wagner JE, Zhang MJ et al . Вторая трансплантация при остром и рецидивирующем хроническом лейкозе после первой трансплантации HLA-идентичного брата или сестры. Пересадка костного мозга 2004; 34 : 721–727.

    CAS Статья Google ученый

  • 9

    Bosi A, Laszlo D, Labopin M, Reffeirs J, Michallet M, Gluckman E et al .Вторая аллогенная трансплантация костного мозга при остром лейкозе: результаты исследования Европейской кооперативной группы по трансплантации крови и костного мозга. J Clin Oncol 2001; 19 : 3675–3684.

    CAS Статья Google ученый

  • 10

    Kuendgen A, Graf T, Zohren F, Hildebrandt B, Hunerliturkoglu A, Gattermann N и др. . Индукция полной ремиссии у пациента с острым миелоидным лейкозом, рефрактерным к высокодозной химиотерапии, путем лечения 5-азацитидином. Leuk Res 2007; 31 : 407–409.

    CAS Статья Google ученый

  • 11

    Атанакович Д., Люткенс Т., Клот Б., Фукс Г., Цао И., Хильдебрандт Ю. и др. . Экспрессия антигена рака яичка и ее эпигенетическая модуляция при остром миелоидном лейкозе. Am J Hematol 2011; 86 : 918–922.

    CAS Статья Google ученый

  • 12

    Pinto A, Maio M, Attadia V, Zappacosta S, Cimino R.Модуляция экспрессии антигенов HLA-DR в клетках миелоидной лейкемии человека цитарабином и 5-аза-2'-дезоксицитидином. Lancet 1984; 2 : 867–868.

    CAS Статья Google ученый

  • 13

    Pinto A, Attadia V, Fusco A, Ferrara F, Spada OA, Di Fiore PP. 5-Аза-2'-дезоксицитидин вызывает терминальную дифференцировку лейкозных бластов от пациентов с острым миелоидным лейкозом. Кровь 1984; 64 : 922–929.

    CAS PubMed Google ученый

  • 14

    Goodyear O, Agathanggelou A, Novitzky-Basso I, Siddique S, McSkeane T, Ryan G et al . Индукция CD8 + Т-клеточного ответа на антиген рака яичка MAGE путем комбинированного лечения азацитидином и вальпроатом натрия у пациентов с острым миелоидным лейкозом и миелодисплазией. Кровь 2010; 116 : 1908–1918.

    CAS Статья Google ученый

  • 15

    Санчес-Абарка Л.И., Гутьеррес-Косио С., Сантамария С., Кабальеро-Веласкес Т., Бланко Б., Эрреро-Санчес С. и др. .Иммуномодулирующий эффект 5-азацитидина (5-azaC): потенциальная роль в условиях трансплантации. Кровь 2010; 115 : 107–121.

    CAS Статья Google ученый

  • 16

    Choi J, Ritchey J, Prior JL, Holt M, Shannon WD, Deych E et al . In vivo введение гипометилирующих агентов смягчает болезнь трансплантат против хозяина без ущерба для трансплантата против лейкемии. Кровь 2010; 116 : 129–139.

    CAS Статья Google ученый

  • 17

    Graef T, Kuendgen A, Fenk R, Zohren F, Haas R, Kobbe G. Успешное лечение рецидива ОМЛ после трансплантации аллогенных стволовых клеток азацитидином. Leuk Res 2007; 31 : 257–259.

    CAS Статья Google ученый

  • 18

    Боланос-Мид Дж., Смит Б.Д., Гор С.Д., МакДевитт М.А., Лузник Л., Фукс Э.Д. и др. .5-Азацитидин как спасительное средство при рецидиве миелоидных опухолей после аллогенной трансплантации костного мозга. Пересадка костного мозга Biol 2011; 17 : 754–758.

    CAS Статья Google ученый

  • 19

    Czibere A, Bruns I, Kroger N, Platzbecker U, Lind J, Zohren F et al . 5-Азацитидин для лечения пациентов с острым миелоидным лейкозом или миелодиспластическим синдромом, у которых возник рецидив после алло-SCT: ретроспективный анализ. Пересадка костного мозга 2010; 45 : 872–876.

    CAS Статья Google ученый

  • 20

    Любберт М., Бертц Х., Вош Р., Маркс Р., Рутер Б., Клаус Р. и др. . Эффективность 3-дневного лечения низкими дозами 5-азацитидина с последующими инфузиями донорских лимфоцитов у пожилых пациентов с острым миелоидным лейкозом или хроническим миеломоноцитарным лейкозом, рецидивирующим после аллотрансплантации. Пересадка костного мозга 2010; 45 : 627–632.

    CAS Статья Google ученый

  • 21

    Джаббур Э., Гиралт С., Кантарджиан Х., Гарсия-Манеро Дж., Джагасия М., Кебриаи П. и др. . Низкие дозы азацитидина после трансплантации аллогенных стволовых клеток при остром лейкозе. Рак 2009; 115 : 1899–1905.

    CAS Статья Google ученый

  • 22

    Dohner H, Estey EH, Amadori S, Appelbaum FR, Buchner T, Burnett AK et al .Диагностика и лечение острого миелоидного лейкоза у взрослых: рекомендации международной группы экспертов от имени European LeukemiaNet. Кровь 2010; 115 : 453–474.

    Артикул Google ученый

  • 23

    Cheson BD, Greenberg PL, Bennett JM, Lowenberg B, Wijermans PW, Nimer SD et al . Клиническое применение и предложение по модификации критериев ответа Международной рабочей группы (IWG) при миелодисплазии. Кровь 2006; 108 : 419–425.

    CAS Статья Google ученый

  • 24

    Филипович А.Х., Вайсдорф Д., Павлетик С., Сосье Дж., Вингард Дж. Р., Ли С.Дж. и др. . Проект разработки консенсуса Национальных институтов здравоохранения по критериям клинических испытаний при хронической болезни «трансплантат против хозяина»: I. Отчет рабочей группы по диагностике и стадированию. Пересадка костного мозга Biol 2005; 11 : 945–956.

    Артикул Google ученый

  • 25

    Przepiorka D, Weisdorf D, Martin P, Klingemann HG, Beatty P, Hows J et al Консенсусная конференция 1994 года по оценке острой РТПХ. Пересадка костного мозга 1995; 15 : 825–828.

    Google ученый

  • 26

    Гринберг П., Кокс С., ЛеБо М.М., Фено П., Морель П., Санз Г. и др. . Международная система баллов для оценки прогноза миелодиспластических синдромов. Кровь 1997; 89 : 2079–2088.

    CAS PubMed Google ученый

  • 27

    Шмид С., Лабопин М., Наглер А., Нидервизер Д., Кастанья Л., Тебризи Р. и др. . Лечение, факторы риска и исходы у взрослых с рецидивом ОМЛ после кондиционирования с пониженной интенсивностью для трансплантации аллогенных стволовых клеток. Кровь 2012; 119 : 1599–1606.

    CAS Статья Google ученый

  • 28

    de LM, Giralt S, Thall PF, de Padua SL, Jones RB, Komanduri K et al .Поддерживающая терапия низкими дозами азацитидина после трансплантации аллогенных гемопоэтических стволовых клеток при рецидивирующем остром миелогенном лейкозе или миелодиспластическом синдроме: исследование по подбору дозы и графика. Рак 2010; 116 : 5420–5431.

    Артикул Google ученый

  • 29

    Platzbecker U, Wermke M, Radke J, Oelschlaegel U, Seltmann F, Kiani A et al . Азацитидин для лечения неминуемого рецидива у пациентов с МДС или ОМЛ после аллогенной ТГСК: результаты исследования РЕЛАЗА. Лейкоз 2011; 26 : 381–389.

    Артикул Google ученый

  • 30

    Guieze R, Damaj G, Robin M, Mohty M, Michallet M, Tabrizi R et al . Лечение рецидива после аллогенной трансплантации гемопоэтических полуклеток при миелодиспластическом синдроме: крупномасштабное исследование от имени Societe Francaise De Greffe De Moelle Et De Therapie Cellulaire (SFGM-TC). Тезисы ежегодного собрания ASH 2012; 120 : 593.

    Google ученый

  • 31

    Lubbert M, Wijermans P, Kunzmann R, Verhoef G, Bosly A, Ravoet C et al . Цитогенетические ответы при миелодиспластическом синдроме высокого риска после лечения низкими дозами ингибитора метилирования ДНК 5-аза-2'-дезоксицитидин. Br J Haematol 2001; 114 : 349–357.

    CAS Статья Google ученый

  • 32

    Кампрегер П.В., Гули Т., Скотт Б.Л., Моравек С., Сандмайер Б., Мартин П.Дж. и др. .Результаты инфузий донорских лимфоцитов при рецидиве миелодиспластического синдрома после трансплантации гемопоэтических клеток. Пересадка костного мозга 2007; 40 : 965–971.

    CAS Статья Google ученый

  • 33

    Arellano ML, Langston A, Winton E, Flowers CR, Waller EK. Лечение рецидива острого лейкоза после аллогенной трансплантации: опыт единого центра. Пересадка костного мозга Biol 2007; 13 : 116–123.

    Артикул Google ученый

  • 34

    Goodyear OC, Dennis M, Jilani NY, Loke J, Siddique S, Ryan G et al . Азацитидин увеличивает экспансию регуляторных Т-клеток после трансплантации аллогенных стволовых клеток у пациентов с острым миелоидным лейкозом. Кровь 2012; 119 : 3361–3369.

    CAS Статья Google ученый

  • 35

    Блюм В., Клисович Р.Б., Беккер Х., Ян X, Розевски Д.М., Фелпс М.А. и др. .Повышение дозы леналидомида при рецидивирующих или рефрактерных острых лейкозах. J Clin Oncol 2010; 28 : 4919–4925.

    CAS Статья Google ученый

  • 36

    Fehniger TA, Uy GL, Trinkaus K, Nelson AD, Demland J, Abboud CN et al . Фаза 2 исследования высоких доз леналидомида в качестве начальной терапии для пожилых пациентов с острым миелоидным лейкозом. Кровь 2011; 117 : 1828–1833.

    CAS Статья Google ученый

  • 37

    Fenaux P, Giagounidis A, Selleslag D, Beyne-Rauzy O, Mufti G, Mittelman M и др. . Рандомизированное исследование фазы 3 леналидомида по сравнению с плацебо у зависимых от переливания эритроцитов пациентов с миелодиспластическими синдромами низкого / среднего риска с del5q. Кровь 2011; 118 : 3765–3776.

    CAS Статья Google ученый

  • 38

    Лиознов М., Эль-Шейх Дж., Хоффманн Ф., Хильдебрандт Я., Аюк Ф., Вольшке С. и др. .Леналидомид в качестве спасательной терапии после алло-SCT при множественной миеломе эффективен и приводит к увеличению количества активированных NK (NKp44 (+)) и T (HLA-DR (+)) клеток. Пересадка костного мозга 2010; 45 : 349–353.

    CAS Статья Google ученый

  • 39

    Секерес М.А., Лист А.Ф., Катбертсон Д., Пакетт Р., Ганецки Р., Латам Д. и др. . Фаза I исследования комбинации леналидомида и азацитидина у пациентов с миелодиспластическими синдромами высокого риска. J Clin Oncol 2010; 28 : 2253–2258.

    CAS Статья Google ученый

  • 40

    Секерес М.А., О’Киф С., Лист А.Ф., Паулич К., Афабле М., Энглхаупт Р. и др. . Демонстрация дополнительной пользы от добавления леналидомида к азацитидину у пациентов с миелодиспластическими синдромами высокого риска. Am J Hematol 2011; 86 : 102–103.

    Артикул Google ученый

  • 41

    Breems DA, Van Putten WL, De Greef GE, Van Zelderen-Bhola SL, Gerssen-Schoorl KB, Mellink CH et al .Моносомный кариотип при остром миелоидном лейкозе: лучший показатель плохого прогноза, чем сложный кариотип. J Clin Oncol 2008; 26 : 4791–4797.

    Артикул Google ученый

  • Доцент-исследователь

    Белок, сшивающий актин, палладин, модулирует генерацию силы и механочувствительность. фибробластов, ассоциированных с опухолью.Азатов М., Goicoechea SM , Otey C, Upadhyaya A. Sci. Отчет 6: 28805, 2016.

    Экспрессия палладина является консервативной характеристикой микросреды десмопластической опухоли. и способствует измененной экспрессии генов. Пушка AR, Оуэн МК, Герреро М.С., Кербер ML, Goicoechea SM , Hemstreet KC, Klazynski B, Hollyfield J, Chang EH, Hwang RF, Otey CA, Kim HJ.Цитоскелет. 72 (8): 402-11, 2015. Изображено на обложке.

    Я обращаюсь к вам в GEF: Регулирование RhoGEF во время миграции клеток. Goicoechea SM , Awadia S, Garcia-Mata R. Cell Adh Migr. 2; 8 (4), 2014 г.

    Палладин способствует инвазии клеток рака поджелудочной железы, усиливая образование инвадоподий в фибробластах, ассоциированных с опухолью. Goicoechea SM , García-Mata R, Staub J, Valdivia A, Sharek L, McCulloch CAG, Hwang RF, Urrutia R, Yeh JJ, Ким HJ и Otey CA. Онкоген 6; 33 (10): 1265-73, 2014

    Структура и функция актин-связывающего домена палладина. Beck MR, Dixon RD, Goicoechea SM , Murphy GS, Brungardt JG, Beam MT, Srinath P, Patel J, Mohiuddin J, Otey CA, Campbell SL.J Mol Biol. 23; 425 (18): 3325-37, 2013 г.

    Белок, связанный с актином, палладин, важен для ранних гладкомышечных клеток. дифференциация. Jin L, Gan Q, Zieba BJ, Goicoechea SM , Owens GK, Otey CA, Somlyo AV. PLoS One 22; 5 (9): e12823, 2010 г.

    Изоформа-специфическая активация палладина в опухолях поджелудочной железы человека и мыши. Goicoechea SM , Bednarski B, Stack C, Cowan DW, Volmar K, Thorne L, Cukierman E, Rustgi AK, Brentnall Т, Хван РФ, Маккалок, Калифорния, Йе Дж.Дж., Бентрем ДиДжей, Хохвальд С.Н., Хингорани С.Р., Ким Х.Дж., Otey CA. PLoS One 26; 5 (4): e10347, 2010.

    Цитоплазматические Ig-доменные белки: регуляторы цитоскелета, играющие роль в заболеваниях человека. Otey CA, Dixon R, Stack C, Goicoechea SM .Цитоскелет клеточного мотиля. 66 (8): 618-34, 2009 г.

    Роль малых GTPases RhoA и Rac1 в поведении клеток. Кэрол Оти, Сильвия Гойкоэчеа, и Рафаэль Гарсиа-Мата. F1000 Биологические отчеты 1: 4, 2009 г.

    Характеристика кортактина как субстрата протеинкиназы D in vivo: взаимозависимость сайтов и потенцирование Src.Line De Kimpe, Katrien Janssens, Rita Derua, Milena Armacki, Silvia Goicoechea , Кэрол Оти, Этьен Велькенс, Сэнди Вандонинк, Джеки Р. Ванденхеде, Томас Зеуферляйн, и Йохан Ван Линт. Клетка. Сигнал. 21 (2): 253-63, 2009.

    Палладин способствует инвазивной подвижности клеток рака груди человека. Goicoechea SM , Bednarski B, García-Mata R, Prentice-Dunn H, Kim HJ и Otey CA.Онкоген. 28 (4): 587-98, 2009 г.

    Роль палладина в организации актина и подвижности клеток. Сильвия Гойкоэчеа , Даниэль Арнеман и Кэрол Оти. Eur J Cell Biol. 87 (8-9): 517-25, 2008 г.

    Палладин связывается с Eps8 и усиливает образование спинных складок и подосом. в гладкомышечных клетках сосудов. Goicoechea SM , Arneman D, Disanza A, Garcia-Mata R, Scita G и Otey C.J. Cell Science 119 (Pt 16): 3316-24, 2006 г.

    Белок, связанный с рецептором липопротеинов низкой плотности, представляет собой корецептор кальретикулина, который сигнализирует о разборке очаговой адгезии. A.W. Орр, К. Педраса, М.А.Паллер, К. Эльзи, SM Goicoechea , D.Стрикленд, Дж. Мерфи-Ульрих. J. Cell Biol. 161 (6): 1179-89, 2003 г.

    Антиадгезивная активность тромбоспондина опосредована N-концевым доменом клетки Поверхностный кальретикулин. Goicoechea SM , Pallero MA, Eggleton P, Michalak M., Murphy-Ullrich JE. J Biol Chem. 277 (40): 37219-28, 2002 г.

    Nck-2 взаимодействует с киназой фокальной адгезии и модулирует подвижность клеток. Goicoechea, SM ; Вт, Й; Хуа, Й; Чен, К; Шен, Т-Л; Guan, JL; Wu, C. Int. J. Biochem. Клетка. Биол. 1255: 1-15, 2002

    Тромбоспондин опосредует разборку очаговой адгезии посредством взаимодействия с клеткой поверхностный кальретикулин. Goicoechea SM , Orr WA, Pallero MA, Eggleton P, Murphy-Ullrich JE. J. Biol. Chem. 275 (46): 36358-68, 2000 LIM-only протеин PINCH является связывающим белком для интегрин-связанной киназы. (ILK).Вт, Й; Ли, Ф; Goicoechea, SM ; Ву К., Молекулярная и клеточная биология, 19 (3): 2425, 1999.

    Интегрин-связанная протеинкиназа регулирует сборку фибронектинового матрикса, экспрессию E-кадгерина и онкогенность. Wu, C; Keightley, SY; Leung-Hegesteijn, CH; Радева, Г; Копполино, M; Goicoechea, SM ; Макдональд, JA; Дедхар, С.J. Biol. Chem. 273 (1): 528-536, 1998.

    Влияние белкового питания на кальпаиновую активность почек мыши: Модуляция кальпастатин. Goicoechea, SM ; Конде, РД. Мол. Клетка. Biochem. 166 (1/2): 95-99, 19

    Оценка содержания мРНК убиквитина и убиквитина в темных стареющих листьях пшеницы.Пинедо, ML; Goicoechea, SM ; Ламаттина, L; Конде, РД. Biologia Plantarum, 38 (3): 321-328, 1996.

    Влияние диетического уровня белка на активность кальпаина печени мыши. Goicoechea, SM; Tabares, L; Пуччарелли, MG; Sabas, ME; Конде, РД. Horm. Метаб. Res. 26, 175-180, 1994 г.

    Глава книги:

    Деадгезивная активность кальретикулина-тромбоспондина на клеточной поверхности в кальретикулине для здоровья и болезнь. SM Goicoechea and J.E. Murphy-Ullrich. В Calreticulin 2 nd Edition. Эд. Пол Эгглтон и Марек Михалак. Landes Bioscience, Джорджтаун, Техас (2002).

    Радиочастотное распыление и осаждение высокотемпературных сверхпроводников

  • 1.

    К. Б. Эом Дж. З. Сун Б. М. Лэрсон С.К. Страйфер А. Ф. Маршалл К. Ямамото С. М. Анлаге Дж. К. Бравман Т. Х. Гебалле С. С. Ладерман Р. К. Табер и Р. Д. Яковиц Physica C 171 (1990) 354.

    Google ученый

  • 2.

    Р. Д. Арнелл и Р. И. Бейтс Вакуум 43 (1992) 105.

    Google ученый

  • 3.

    К. К. Чан, Г. А. Дж. Амаратунга и Т. К. С. Вонг Дж.Vac. Sci. Technol. A 10 (1992) 225.

    Google ученый

  • 4.

    Г. К. Вольф, там же J. Vac. Sci. Technol. A 10 (1992) 1757.

  • 5.

    С. Т. Пикро, Э. Часон и Т. М. Майер MRS Bull. 17 (1992) 52.

    Google ученый

  • 6.

    И. Петров, Л. Халтман, Ж.-Э. Сандгрен и Дж.Э. Грин J. Vac. Sci. Technol. A 10 (1992) 265.

    Google ученый

  • 7.

    D. W. Matson, M. D. Merz и E. D. McClanahan, ibid. J. Vac. Sci. Technol. A 10 (1992) 1791.

  • 8.

    А. Шерер, М. Вальтер, Л. М. Скьявоне, Б. П. ван дер Гааг и Э. Д. Бибе, ibid. J. Vac. Sci. Technol. A 10 (1992) 3305.

  • 10.

    Д. Монаган и Р.Д. Арнелл Вакуум 43 (1992) 77

    Google ученый

  • 11.

    Р. Р. Гроув Фил. Пер. Рой. Soc. 142 (1852) 87

    Google ученый

  • 12.

    В. К. Дампьер, История науки (Издательство Кембриджского университета, Кембридж, 1966 г.), с. 226.

    Google ученый

  • 13.

    Л. Трафтон, в Энциклопедии физики, под редакцией Р. М. Безансон (Ван Ностранд Рейнхольд, Нью-Йорк, 1990) с. 946.

    Google ученый

  • 14.

    В. Д. Вествуд Прог. в Surf. Sci. 7 (1976) 71.

    Google ученый

  • 15.

    Дж. Л. Фоссен и Дж. Дж. Куомо, в «Процессы тонких пленок», под редакцией Дж. Л. Фоссен и В. Керн (Academic Press, Нью-Йорк, 1978) с.11.

    Google ученый

  • 16.

    Б. Чепмен, Процессы тлеющего разряда (Джон Вили, Нью-Йорк, 1980) с. 215.

    Google ученый

  • 17,

    Дж. Э. Грин Крит. Rev. Solid State Mater. Sci. 11 (1983) 47, 189.

    Google ученый

  • 18.

    К. Райхельт и Х. Цзян Тонкие сплошные пленки 191 (1990) 91.

    Google ученый

  • 19.

    Л. Э. Клайн и М. Дж. Кушнер Crit Rev Solid State Mater. Sci. 16 (1989) 1.

    Google ученый

  • 20.

    Р. Бериш в «Распыление путем практической бомбардировки», Vol. Под редакцией Р. Бериша (Springer-Verlag, Берлин, 1981) с. 5.

    Google ученый

  • 21.

    Г. К. Венер J. Appl. Phys. 26 (1955) 1056

    Google ученый

  • 22.

    Х. Х. Андерсон и Х. L. Bay, в «Распыление бомбардировкой частицами», Vol. I, под редакцией Р. Бериша (Springer-Verlag, Берлин, 1981) с. 145.

    Google ученый

  • 23.

    В. А. Тиллер, Наука о кристаллизационно-микроскопических межфазных явлениях (Издательство Кембриджского университета, Кембридж, 1991) с.44

    Google ученый

  • 24.

    Дж. Р. Актон и Дж. Д. Свифт. Газоразрядные трубки с холодным катодом (Heywood and Company, Лондон, 1963) с. 164.

    Google ученый

  • 25.

    К. Грей Морган, в «Справочнике по физике вакуума», Vol. 2 под редакцией А. Х. Бек (Pergamon Press, Oxford, 1965) стр. 39.

    Google ученый

  • 26.

    Ф. Ллевеллин-Джонс, Ионизационные лавины и пробой (Метуэн, Лондон, 1967) с. 60

    Google ученый

  • 27.

    О. Библарц IEEE Trans. 19 (1991) 1235.

    Google ученый

  • 28.

    С. Пируз, П. А. Рамачандран и Б. Абрахам-Шраунер, там же. IEEE Trans. 19 (1991) 408.

  • 29.

    В. Б. Пеннебейкер IBM J. Res. Dev. 23 (1979) 16.

    Google ученый

  • 30.

    С. Б. Крупаниди, Х. Ху и Ю. Кумар J. Appl. Phys 71 (1992) 376.

    Google ученый

  • 31.

    Д. Дж. Лихтенвалнер, К. Н. Соблей, Р. Р. Вулкотт-младший, О. Аусиелло и А. И. Кингон, там же. J. Appl. Phys 70 (1991) 6952.

  • 32.

    Дж. Х. Келлер и У. Б. Пеннебейкер IBM J. Res. Dev. 23 (1979) 3.

    Google ученый

  • 33.

    Б. П. Вуд, М. А. Либерманн и А. Дж. Лихтенберг IEEE Trans. Plasma Sci. 19 (1991) 619

    Google ученый

  • 34.

    М. А. Либерман, А. Дж. Лихтенберг и С. Е. Савас, там же. IEEE Trans.Plasma Sci. 19 (1991) 189.

    Google ученый

  • 35.

    М. Сурендра и Д. Б. Грейвс, там же. IEEE Trans. Plasma Sci. 19 (1991) 144

  • 36

    Годяк В.А., Пиеяк Р.Б., Александрович Б.М., там же. IEEE Trans. Plasma Sci. 19 (1991) 660.

  • 37.

    C.K.Birdsall, , там же. IEEE Trans.Plasma Sci. 19 (1991) 65.

    Google ученый

  • 38.

    M. J. Goeckner, J. A. Goree и T. E. Sheridan Jr, ibid. IEEE Trans. Plasma Sci. 19 (1991) 301.

  • 39.

    Блевин Х.А., Блевин С. К. Хейдон Proc. Phys. Soc. 81 (1963) 490. См. Также [25] с. 145.

    Google ученый

  • 40.

    Р. К. Уэйтс, в «Процессы тонких пленок», под редакцией Дж. Л. Фоссен и В. Керн (Academic Press, Нью-Йорк, 1978) с. 131.

    Google ученый

  • 41.

    М. С. Рэйвен Избр. Lett. 24 (1988) 342.

    Google ученый

  • 42.

    Р. П. Хоусон и Х. А. Джафер J. Vac. Sci Technol. A 10 (1992) 1784.

    Google ученый

  • 43.

    Б. Окно и г. л. хардинг, там же. J. Vac. Sci Technol. A 10 (1992) 3300.

  • 44.

    У. Д. Вествуд, в Физике тонких пленок, под редакцией М. Х. Франкомб и Дж. Л. Фоссен (Academic Press, Boston, 1989) с. 1.

    Google ученый

  • 45.

    Ф. Джонс и Дж. С. Логан IBM J. Res. Развивать. 34 (1990) 680

    Google ученый

  • 46.

    Дж. Л. Фоссен, С. Кромменкеок и В. А. Косс J. Vac. Sci. Technol. A 9 (1991) 600.

    Google ученый

  • 47.

    M. S. Raven, M. H. T. Al-Sinaid, S. J. T. Owen and T. Л. Тэнсли Тонкие сплошные пленки 71 (1980) 23

    Google ученый

  • 48.

    М. Моради С. Нендер С. Берг и Н.О. Блом J. Vac. Sci Technol.A 9 (1991) 619

    Google ученый

  • 49.

    П. Мартин IEEE Trans. Plasma Sci. 18 (1990) 855.

    Google ученый

  • 50.

    L. Holland, Вакуумное осаждение тонких пленок (Chapman and Hall, London, 1966), также L. Holland, Elec. Компоненты 19 Май (1972) 493.

    Google ученый

  • 51.

    Д. М. Маттокс Электрохим. Technol. 2 (1964) 295.

    Google ученый

  • 52.

    IdeM. Д. М. МАТТОКС J. Vac. Sci. Technol. 10 (1973) 47.

    Google ученый

  • 53.

    Д. Г. Тир J. Phys. Д. 9 (1976) L187.

    Google ученый

  • 54.

    W.-X. Ni J. Knall M. A. Hasan G. U. Hansson J.-E. Сандгрен С. А. Барнетт Л. К. Маркерт и Дж. Э. Грин Phys. Ред. B 40 (1989) 10449.

    Google ученый

  • 55.

    Э. Часон, П. Бедросян, К. М. Хорн, Дж. Ю. Цао и С. Т. Пикрауз заявл. Phys. Lett. 57 (1990) 1793.

    Google ученый

  • 56.

    C.-H. Хор.Ай и С. А. Барнетт Phys Rev. Lett. 67 (1991) 2826.

    PubMed Google ученый

  • 57.

    Б. Белмекки и М. С. Рэйвен Фил. Mag. A 52 (1985) 19.

    Google ученый

  • 58.

    Э. У. Корнельсен и М. К. Сенья Appl Phys. Lett. 9 (1966) 112

    Google ученый

  • 59.

    М. С. Рэйвен и Б. Белмекки Тонкие сплошные пленки 80 (1981) 85.

    Google ученый

  • 60.

    Дж. А. Торнтон J. Vac. Sci. Technol. 11 (1974) 666

    Google ученый

  • 61.

    Мовчан Б.А., Мовчан А. У. Демчишин Phys. Встретились. Металлург. 28 (1969) 83.

    Google ученый

  • 62.

    С. Крейг и Г. Л. Хардинг J. Vac. Sci. Technol. 19 (1981) 205.

    Google ученый

  • 63.

    С. А. Стоун и Н. М. Гонием, , там же. J. Vac. Sci. Technol. 9 (1991) 759.

  • 64.

    М. Хоули, И. Д. Рейстрик, Дж. Г. Бири и Р. Дж. Холтон Наука 251 (1991) 1587.

    Google ученый

  • 65.

    К. Гербер, Д. Ансельметти, Дж. Г. Беднорц, Дж. Маннхарт и Д. Г. Шлом Природа 350 (1991) 279.

    Google ученый

  • 66.

    Р. В. Вук Внутр. Металлы Ред. 27 (1982) 209.

    Google ученый

  • 67.

    Д. Кирк и М. С. Рэйвен J. Phys. D 9 (1976) 2015.

    Google ученый

  • 68.

    Б. Льюис Тонкие сплошные пленки 50 (1978) 233.

    Google ученый

  • 69.

    Д. Уолтон J. Chem. Phys. 37 (1962) 2182.

    Google ученый

  • 70.

    Р. А. Сигсби в Nucleation, под редакцией А. К. Зеттлемойер (Марсель Деккер, Нью-Йорк, 1969) стр. 176.

    Google ученый

  • 71.

    Третьятченко С.Г. Physica C 199 (1992) 7.

    Google ученый

  • 72.

    Ф. К. Франк и Дж. Х. Ван дер Мерве Proc. Рой. Soc. Лондон сер. A 198 (1949) 205.

    Google ученый

  • 73.

    К. Н. Ту, Дж. У. Майер и Л. К. Фельдман, Электронная наука о тонких пленках (Макмиллан, Нью-Йорк, 1992) с. 161.

    Google ученый

  • 74.

    Дж. Х. Ван дер Мерве Крит. Rev. Solid State Mater. Sci. 17 (1991) 187.

    Google ученый

  • 75.

    У. А. Тиллер, Наука о кристаллизации (Издательство Кембриджского университета, Кембридж, 1991) с. 349.

    Google ученый

  • 76.

    Дж. Р. Гавалер заявл. Phys. Lett. 23 (1973) 480.

    Google ученый

  • 77.

    M. R. Daniel A. I. Braginski G. W. Rowland J. R. Gavaler and A. T. Santhanam, в «Достижения в криогенной инженерии», 24 под редакцией k. Д. Тиммерхаус, г. П. Рид и А. Ф. Кларк (Plenum Press, Нью-Йорк, 1978) стр. 459, также Р. Т. Кампвирт, К. Т. Ву и Дж. В. Хафстром, там же. с. 465.

    Google ученый

  • 78.

    К. Т. Ву, Р. Т. Кампвирт и Дж. W. Hafstrom J. Vac. Sci. Technol. 14 (1977) 134.

    Google ученый

  • 79.

    С. Морохаши и С. Хасуо J. Appl. Phys. 61 (1987) 4835.

    Google ученый

  • 80.

    Дж. Г. Беднорз и К. А. Мюллер Z. Phys. B 64 (1986) 189.

    Google ученый

  • 81.

    М. К. Ву Дж. Р. Эшберн К. Дж. Торнг П. Х.Хор Р. Л. Мэн Л. Гао, З. Дж. Хуан Ю. К. Ван К. В. Чу Phys. Rev. Lett. 58 (1987) 908.

    PubMed Google ученый

  • 82.

    Х. Маеде Ю. Танака М. Фукутоми Т. Асано Jpn. J. Appl. Phys. 27 (1988) Л209.

    Google ученый

  • 83.

    З. З. Шэн и А. М. Германн Природа 332 (1988) 55.

    Google ученый

  • 84.

    Д. М. Гинзберг, «Физические свойства высокотемпературных сверхпроводников», т. Я, под редакцией д. М. Гинзберг (World Scientific, Лондон, 1989) с. 1.

    Google ученый

  • 85.

    П. Бердал и Р. Б. Бакиус, «Распыление высокотемпературных сверхпроводников: библиография», LBL-25722, UC-406 (Центр перспективных материалов, Лаборатория Лоуренса Беркли, Калифорнийский университет, 1988) с.5.

  • 86.

    Д. Джедамзик, G.E.C. J. Res. Развивать. 8 (1990) 92.

    Google ученый

  • 87.

    П. Вагнер, Х. Адриан и С. Томе-Роза Physica C 195 (1992) 258–262.

    Google ученый

  • 88.

    Дж. М. Грейс Д. Б. Макдональд М. Т. Рейтен Дж. Олсон Р. Т. Кампвирт К. Э. Грей J. Vac. Sci.Technol. A 10 (1992) 1600–1603.

    Google ученый

  • 89.

    Ю. Сайто Т. Набатаме П. Кобрин и Дж. Cheung J. J. Appl. Phys. 30 (1991) L820-L822.

    Google ученый

  • 90.

    Л. Кудрие, Б. Мерси и Х. Мюррей Суперсекунда. Sci. Technol. 6 (1993) 119.

    Google ученый

  • 91.

    Б. С. Ян X. П. Ван С. К. Ван Р. К. Ван С. Г. Цуй и С. Л. Ли, Supercond. Sci. Technol. 4 (1991) 143.

    Google ученый

  • 92.

    С. Дж. Ли, Э. Д. Рипперт, Б. Й. Джин, С. Н. Сонг, С. Дж. Хву, К. Поппельмайер и Дж. Б. Кеттерсон заявл. Phys. Lett. 51 (1987) 1194.

    Google ученый

  • 93.

    Д. С. Бербридж С.К. Дью, Б. Т. Салливан, Н. Фортье, Р. Р. Парсонс, П. Дж. Малхерн, Дж. Ф. Кэролан и А. Чакладер Solid State Commun. 64 (1987) 749

    Google ученый

  • 94.

    Дж. Л. Макус, Л. Маритато, К. М. Фалько, Дж. П. Кронин, Г. П. Раджендран, Э. В. Ульманн и Д. Р. Ульманн заявл. Phys. Lett. 51 (1987) 2164.

    Google ученый

  • 95.

    M. Scheuermann, C.C. Chi, C.C. Tsuei, D. S. Yee, J. J. Cuomo, R. B. Laibowitz, R.H. Koch, B. Braren, R. Srinivasan и M. M. Plechaty, ibid. заявл. Phys. Lett. 51 (1987) 1951.

  • 96.

    О. Мичиками и М. Асахи JpN. J. Appl. Phys. 30 (1991) 939.

    Google ученый

  • 97.

    К. Терасима, Х. Комаки и Т. Ёсида IEEE Trans. по плазменным наукам. 18 (1990) 980.

    Google ученый

  • 98.

    К. П. Фоли С. В. Филипчук Н. Саввидес Д. Л. Дарт К.-Х. Мюллер и Дж. К. Макфарлейн IEEE Trans. Магнетикс 27 (1991) 3036.

    Google ученый

  • 99.

    С. И. Шах и П. Ф. Карсия заявл. Phys. Lett. 51 (1987) 2146.

    Google ученый

  • 100.

    E. E. Inameti M. S. Raven W. M. Wan and B. Г. Мюррей Вакуум 43 (1992) 61.

    Google ученый

  • 101.

    С. Синий и П. Boolchard заявл. Phys. Lett. 58 (1991) 2036.

    Google ученый

  • 102.

    Н. Савидес и А. Катсарос, там же. заявл. Phys. Lett. 58 (1991) 2036, в печати.

  • 103.

    E. E. Inameti M. S. Raven W. M. Wan and B. Г. Мюррей Вакуум 43 (1992) 121

    Google ученый

  • 104.

    Р. К. Эстлер Н. С. Ногар Р. Э. Мюнхаузен X. Д. Ву С. Фолтын и А. Р. Гарсия Rev. Sci. Instrum. 62 (1991) 437.

    Google ученый

  • 105.

    П. К. Галлахер Х. М. О'Брайан С.А. Саншайн и Д. В. Мерфи Mater. Res. Бык. 22 (1987) 995.

    Google ученый

  • 106.

    Э. Саломонс, Н. Куман, Р. Брауэр, Д. Г. Де Гроот, Р. Griessen Solid State Commun. 64 (1987) 1141.

    Google ученый

  • 107.

    Р. Борман и Дж. Нолтинг заявл. Phys. Lett. 54 (1989) 2148.

    Google ученый

  • 108.

    М. Карппинен и Л. Ниинисто Суперсекунда. Sci. Technol. 4 (1991) 334

    Google ученый

  • 109.

    П. Шлегер, В. Н. Харди и Б. X. Ян Physica C 176 (1991) 261.

    Google ученый

  • 110.

    Б. Раво К. Мишель М.Хервью Дж. Прово и Ф. Штудер, в «Сверхпроводимости», под редакцией Дж. Г. Беднорца и К. А. Мюллера (Springer-Verlag, Берлин, Гейдельберг, 1990) с. 66

    Google ученый

  • 111.

    Дж. Д. Йоргенсен, Б. В. Телятина, А. П. Пауликас, Л. Дж. Новицки, Г. В. Крэбтри, Х. Клаус и В. К. Квок Phys. Ред. B. 41 (1990) 1863.

    Google ученый

  • 112.

    М. Токумото Х.Ихара Т. Мацубара М. Хирабаяси Н. Терада Х. Оянаги К. Мурата и Ю. Кимура JpN. J. Appl. Phys. 26 (1987) L1565.

    Google ученый

  • 113.

    Дж. У. Лорам и К. А. Мирза, «Обзор исследований 1992 г.» (Междисциплинарный исследовательский центр сверхпроводимости, Кембриджский университет, Кембридж) с. 26

  • 114

    Р. Дж. Кава Б. Батлог С. Х. Чен Э. А. Ритман С. М. Захурак и Д. Вердер Природа 329 (1987) 423.

    Google ученый

  • 115.

    Р. Х. Хэммонд и Р. Борман Physica C 162–164 (1989) 703.

    Google ученый

  • 116.

    H. S. Kwok и Q. Y. Ying, ibid. Physica C 177 (1991) 122.

  • 117.

    М. Р. Хан, Т. Л. Хилтон, К. Чар, М. Р. Бисли и А. Капитульник J.Vac. Sci Technol.A 10 (1992) 82.

    Google ученый

  • 118.

    Р. Э. Сомех М. Г. Бламир З. Х. Барбер К. Батлер Дж. Х. Джеймс Г. В. Моррис Э. Дж. Томлинсон А. П. Шварценбергер В. М. Стоббс и J. Э. Эветтс Природа 326 (1987) 857.

    Google ученый

  • 119.

    О. Митиками, Х. Асано, Ю. Като, С. Куно и К. Танабэ JpN. J. Appl.Phys. 26 (1987) L1199.

    Google ученый

  • 120.

    Х. Окума Т. Мотику Ю. Канке З. Вен С. Йокояма Х. Асоно И. Игучи и Э. Ямака JpN. J. Appl. Phys. 26 (1987) L1484.

    Google ученый

  • 121.

    T. Aida, T. Fukazawa, K. Takagi и K. Miyauchi, ibid. JpN. J. Appl. Phys. 26 (1987) L1489.

  • 122.

    Дж. Ф. Ланчбери J. Phys. D 21 (1988) 538.

    Google ученый

  • 123.

    К. Танабе, Д. К. Латроп, С. Е. Рассек, Р. А. Бурман J. Appl. Phys. 66 (1989) 3148.

    Google ученый

  • 124.

    М. С. Рэйвен, Э. Э. Инамети, Б. Г. Мюррей и Ю. М. Ван Вакуум 43 (1992) 127.

    Google ученый

  • 125.

    Р. Саймон Физика сегодня 44 (1991) 64.

    Google ученый

  • 126.

    С. К. Тьюксбери, Л. А. Хорнак и М. Хатамян Soild State Elect. 32 (1989) 947.

    Google ученый

  • 127.

    Н. Ньюман К. Чар С. М. Гаррисон Р.У. Бартон, Р. К. Табер, С. Б. Эом, Т. Х. Гебал и Б. Wilkens заявл. Phys. Lett. 57 (1990) 520.

    Google ученый

  • 128.

    Б. Ф. Коул G.-C. Лян Н. Ньюман К. Чар Г. Захарчук и Дж. С. Мартенс заявл. Phys. Lett. 61 (1990) 1727.

    Google ученый

  • 129.

    Э. Э. Инамети, Ю. М. Ван, Б. Г. Мюррей и М. С. Рэйвен Суперсекунда.Sci. Technol. 4 (1991) 620.

    Google ученый

  • 130.

    G. Linker X. X. Xi O. Meyer Q. Li and J. Geerk Solid State Commun. 69 (1989) 249.

    Google ученый

  • 131.

    М. С. Рэйвен, Э. Э. Инамети, Б. Г. Мюррей и Ю. М. Ван Суперсекунда. Sci. Technol. 4 (1991) 225.

    Google ученый

  • 132.

    IdeM. М. С. Рэйвен, Э. Э. Инамети, Б. Г. Мюррей, Ю. М. Ван , Physica C 178 (1991) 275.

  • 133.

    IdeM. M. S. Raven, E. E. Inameti, B. G. Murray, Y. M. Wan , Elec. Lett. 27 (1991) 1309.

  • 134.

    Б. Г. Мюррей, М. С. Рэйвен, Э. Э. Инамети и У. М. Ван Вакуум 43 (1992) 131.

    Google ученый

  • 135.

    С. Э. Бэбкок MRS Bull. 17 (1992) 20.

    Google ученый

  • 136.

    Д. Т. Шоу, идеМ. MRS Bull. 17 (1992) 39

  • 137

    Ю. Иидзима Н. Танабэ О. Коно и Ю. Икено заявл. Phys. Lett. 60 (1992) 769

    Google ученый

  • T1235 - Симисторы Snubberless ™ на 12 А в D2PAK

    Максимальный ток срабатывания затвора (мА) (I, II, III):

    35, 35, 35

    Максимальный ток срабатывания затвора (мА) (I, II, III, IV):

    -

    Повторяющееся пиковое напряжение в закрытом состоянии (В) (макс.):

    600

    Цена за единицу (долл. США):

    0.481

    Страна происхождения:

    КИТАЙ

    Введение

    Введение

    c-MET представляет собой рецепторную тирозинкиназу, активируемую фактором роста гепатоцитов / фактором рассеяния (HGF), его единственным известным лигандом, или в отсутствие HGF другими факторами, такими как плексины [1].Белок c-MET посттрансляционно расщепляется на две субъединицы; внеклеточная альфа-субъединица связана дисульфидными связями с однопроходной трансмембранной бета-субъединицей. Активация HGF c-MET вызывает гомодимеризацию и трансфосфорилирование тирозинов (Tyr) 1234/1235 в каталитическом домене c-MET. Фосфорилирование Tyr 1234/1235 критически важно для последующего фосфорилирования внутриклеточного многофункционального стыковочного сайта, что ведет к рекрутированию эффекторов и последующей передаче сигналов ниже по множеству путей [1].HGF обычно представляет собой паракринный фактор, экспрессируемый мезенхимой для активации c-MET в соседнем эпителии. Ось передачи сигналов HGF / c-MET делает возможным инвазивный рост, регулируя пролиферацию, выживание и миграцию. Эта ось также имеет решающее значение для регенерации кожи и печени и обычно неправильно регулируется при многих формах рака [4-8].

    Во время эмбриогенеза миогенные клетки-предшественники нуждаются в c-MET для миграции из дермомиотома в развивающийся зачаток конечности [2]. HGF, происходящий из мезенхимы конечностей, необходим для деэпителизации и миграции мышечных предшественников [3].Благодаря множеству нижестоящих сигнальных путей роль c-MET в развитии мышц многогранна. Нулевая мутация c-Met зародышевой линии заставляет мышечные предшественники оставаться в дермомиотоме, но не влияет на их пролиферацию [3], в то время как мутация, которая нарушает связывание c-MET с одним из его эффекторов, GRB2, ингибирует пролиферацию мышечных предшественников только после миграции клеток. в развивающуюся конечность [9]. Таким образом, c-MET по-разному влияет на развитие мышц в зависимости от клеточного контекста и связывания эффектора.

    c-Met также экспрессируется во взрослых покоящихся сателлитных клетках (SC) [10] на протяжении активации миобластов и дифференцировки миоцитов, а затем подавляется, но не отсутствует в формирующихся мышечных трубках [11]. Кроме того, HGF участвует во время регенерации мышц [12], но SC не являются единственным типом клеток, экспрессирующих c-Met, присутствующим в регенерирующей мышечной среде [13], поэтому неясно, какие типы клеток нуждаются в передаче сигналов c-MET во время восстановительный процесс. HGF оказывает хемотаксическое [14] и митогенное действие [15] на первичные миобласты, предполагая, что активация c-MET может быть важной для регенерации мышц in vivo.Хотя эти открытия действительно подразумевают, что c-MET участвует в SC-опосредованной регенерации мышц, роль c-MET в биологии мышечных стволовых клеток генетически не изучена.

    Мы предположили, что SCs / миобласты нуждаются в функции c-MET во время регенерации мышц, и разработали генетическую стратегию для проверки этой гипотезы. Путем условной инактивации c-MET конкретно в SC мы обнаружили, что c-MET требуется для SC-опосредованной регенерации мышц в ответ. к острой мышечной травме. Любопытно, что c-MET не требовался для активации SC, пролиферации миобластов или дифференцировки миоцитов.Мы действительно идентифицировали роль c-MET в усилении миграции SC / миобластов. Мы также обнаружили неожиданную роль c-MET в регуляции слияния миоцитов во время образования мышечной трубки, вовлекая c-MET в координацию миграции миобластов и слияния дифференцированных миоцитов.

    Результаты СК требуют c-MET во время регенерации мышц.

    Чтобы устранить функцию c-MET, особенно во взрослых SC, мы объединили условный аллель c-Met, содержащий сайты loxP, фланкирующие экзон 16 (c-Met F [5]), который кодирует АТФ-связывающий домен, необходимый для фосфорилирования Tyr 1234/1235, с аллелем Pax7-CreER T2 (Pax7 CE [16]) для индуцируемой тамоксифеном (TMX), Cre-опосредованной рекомбинации loxP в SC.Либо LacZ, либо YFP Cre-индуцибельный маркер линии передачи был включен с использованием локуса Rosa26 (R26R LacZ или YFP [17,18]). TMX вводили контрольным (Pax7 CE / + ; c-Met + / + ; R26R LacZ или YFP ; обозначается как R26R LacZ или YFP контроль) и мутантам (Pax7 CE / + ; c-Met F / F ; R26R LacZ или YFP ; обозначаемые как R26R LacZ или мутант YFP ) взрослых мышей в течение 5 дней подряд. Был введен 10-дневный период ожидания для оборота c-MET.Для определения эффективности инактивации c-MET мы приготовили массу культур из задних конечностей мутантных мышей R26R YFP и контрольных мышей. Миобласты выделяли с помощью FACS на основе репортера YFP. ОТ-ПЦР и вестерн-анализы этих клеток подтвердили, что индуцируемая рекомбинация эффективно удаляет экзон 16 c-Met (рис. 1A), что приводит к продукции необработанного мутантного белка (рис. 1B) с отмененным фосфорилированием по Tyr 1234/1235 (рис. 1C). . Таким образом, активность c-MET может быть эффективно устранена в SC с использованием этой генетической системы.

    10.1371 / journal.pone.0081757.g001 Рисунок 1 c-MET необходим для SC-опосредованной регенерации мышц.

    A-C) Контрольные и мутантные миобласты выделяли с помощью FACS с помощью флуоресценции YFP (клетки сортировали только по данным в A-C). A) Анализ RT-PCR показывает делецию экзона 16 80 п.о. в мутантных клетках. B) Вестерн-анализ общего белка c-MET показывает присутствие как предварительно обработанной, так и процессированной форм белка c-MET в контрольных клетках, в то время как мутантные клетки не имеют процессированного белка c-MET.C) Вестерн-анализ со специфическим антителом к ​​c-MET фосфо Tyr 1234/1235 показывает, что активация c-MET отменена в мутантных клетках. D) Окрашивание гематоксилином и эозином срезов мышц 10 dpi показывает устойчивую регенерацию мышц, на что указывают клетки с центрально локализованными ядрами, в контрольной ткани, в то время как мутантная мышца показывает меньшее количество регенерированных волокон меньшего размера (стрелки, недавно регенерированные волокна; черная линия, граница между поврежденными и неповрежденная ткань; масштабная линейка = 50 мкм). E) Контрольная и мутантная мышечная ткань, показывающая IF против саркомерного MHC в неповрежденных мышечных срезах с разрешением 10 и 20 точек на дюйм (масштабная линейка = 50 мкм).F) Количественная оценка количества регенерированных волокон на 0,38 мм площади 2 в 20 dpi контрольных и мутантных срезах мышц (p = 3,36E-6 t-тест; N = 3 мыши; 3 поля на мышь; полосы ошибок = SEM). G) Количественная оценка диаметра регенерированных волокон в контрольных и мутантных срезах мышц с разрешением 20 dpi (p = 0,0005 t-тест; N = 3 мыши; 3 поля на мышь; полосы ошибок = SEM).

    Мы проверили роль c-MET в SC во время регенерации, используя модель повреждения, вызванного кардиотоксином (CTX). CTX вводили в переднюю большеберцовую мышцу (TA) через 10 дней после инъекций TMX.Через 10 дней после травмы (dpi), эталон для эффективной регенерации мышц, в контрольной мышце было множество регенерированных волокон с центрально локализованными ядрами. Мутантная мышца показала серьезный дефект регенерации мышц, характеризующийся резким сокращением регенерированных волокон и обширной фиброзной ткани (рис. 1D). Иммунофлуоресценция (IF) для маркера мышечных волокон, тяжелой цепи миозина (MHC), показала, что при 5 dpi (рисунок S1A) и 10 dpi (рисунок 1E) у мутантов было меньше и меньше (рисунок S1B, C) регенерированных мышечных волокон по сравнению с контроля, прямо демонстрируя потребность в c-MET в SC для своевременной регенерации мышц в ответ на острое повреждение.При 20 dpi мутантная мышца поддерживала меньшее количество регенерированных волокон меньшего размера (рис. 1E-G), что позволяет предположить, что c-MET требуется для SCs для полной регенерации мышцы после острого повреждения.

    Обширный фиброз свидетельствует о плохой регенерации и частично является продуктом TCF4 + фибробластов соединительной ткани мышц. Обычно фибробласты TCF4 + присутствуют на низких уровнях в неповрежденной мышце, становятся более многочисленными в течение первых нескольких дней регенерации мышц и значительно уменьшаются на 10 dpi [19].В отсутствие устойчивой регенеративной реакции на острое повреждение фибробласты TCF4 + остаются многочисленными и приводят к накоплению фиброзной ткани в мышцах [19]. Действительно, мы наблюдали увеличение плотности клеток TCF4 + в 10 dpi, плохо регенерированных мутантных мышечных срезах по сравнению с 10 dpi контрольной мышцей (рис. 2A, B). При 20 dpi мы наблюдали повышенный уровень фиброза в поврежденной мутантной мышце по сравнению с контрольной мышцей (рис. 2C). Эти данные дополнительно подтверждают, что СК нуждаются в c-MET для устойчивого регенеративного ответа на острое мышечное повреждение, и что отсутствие c-MET в SC коррелирует с усилением фиброза после травмы.

    10.1371 / journal.pone.0081757.g002 Рисунок 2 Повышенная плотность фибробластов TCF4 + и фиброз во время регенерации, когда в SC отсутствует c-MET.

    A) Контрольная и мутантная мышечная ткань, показывающая IF против TCF4 и ламинина в мышечных срезах 10 dpi (стрелки, TCF4 + DAPI + ядра, внешние по отношению к волокнам, заключенным в ламинин; на вставке показаны увеличенные области; масштабная линейка = 50 мкм). B) Количественное определение TCF4 + DAPI + ядер, внешних по отношению к ламинину, на 0,15 мм площади 2 10 dpi (p = 1,19E-6 t-тест; N = 3 мыши; 3 поля на мышь; полосы ошибок = SEM).C) Окрашивание трихромом и гематоксилином срезов мышц с разрешением 20 dpi показывает фиброзную ткань (синее пятно) по всей поврежденной области мутантной мышцы (стрелки, вновь регенерированные волокна; масштабная линейка = 50 мкм).

    c-MET не важен для выживания, активации, пролиферации или дифференцировки SC.

    c-MET контролирует многие клеточные функции [1]. Нарушение регенерации мышц (рис. 1D-G) может быть результатом любого количества дисфункций SC. Поэтому мы проверили, нужен ли c-MET для покоя, активации, пролиферации и / или дифференцировки SC, поскольку дефекты любого из них могут влиять на регенерацию.

    Преждевременная активация СК приводит к истощению популяции СК [20]. Эффект c-MET на покой SC был протестирован с помощью гистохимии X-gal неповрежденных мышечных срезов от R26R LacZ контрольных и мутантных мышей. Положительные по бета-галактозидазе (β-GAL +) СК были распределены с одинаковой плотностью в контроле и мутантах (рис. 3А). Кроме того, количество покоящихся SCs на отдельных волокнах от мышцы длинного разгибателя пальцев (EDL) не различается между контрольными и мутантными волокнами (2.4 ± .4 и 2.2 ± .3 соответственно; p = 0,95 t испытание; N = 3 мыши; n = 9 волокон на мышь). Таким образом, c-MET, по-видимому, не требуется в течение этого периода времени для поддержания покоя популяции SC до активации.

    10.1371 / journal.pone.0081757.g003 Рисунок 3 c-MET не требуется для обслуживания или дифференциации SC.

    A) Гистохимия X-gal, примененная к неповрежденной мышце TA от контрольных и мутантных мышей, которым инъецировали TMX (стрелки, X-gal-положительные клетки; масштабная полоса = 50 мкм).B - E) Культивированные отдельные волокна из EDL контрольных и мутантных мышей, которым инъецировали TMX. Волокна культивировали в течение 24 часов B) и исследовали с помощью IF для MYOD и β-GAL (стрелки, MYOD + β-GAL + клетка) или D) 72 часа и исследовали IF для MYOG и β-GAL (стрелки, MYOG + β-GAL + клетка). ; масштабная линейка = 20 мкм). Количественная оценка C) MYOD + β-GAL + на общее количество β-GAL + клеток (p = 0,46 t-тест; N = 3 мыши, n = 50 клеток на мышь; полосы ошибок = SEM) и E) MYOG + β-GAL + от общего β -GAL + клетки (p = 0,80 t тест; N = 3 мыши; n = 100 клеток на мышь; планки ошибок = SEM).F) IF для β-GAL и MHC, нанесенного на контрольные и мутантные мышечные срезы TA с разрешением 10 dpi (стрелки, MHC + β-GAL + клетки; масштабная полоса = 50 мкм).

    СК на культивируемых одиночных волокнах последовательно экспрессируют маркеры активации (MYOD) и дифференцировки (MYOGENIN (MYOG)) [21,22]. Чтобы проверить роль c-MET на этих этапах, отдельные волокна из контрольной и мутантной мышцы EDL собирали и культивировали, а соответствующие маркеры анализировали с помощью IF. Сходные уровни MYOD + β-GAL + (на общую β-GAL +) клеток наблюдались на контрольных и мутантных отдельных волокнах, культивируемых в течение 24 часов (рис. 3B, C).Аналогичным образом, аналогичные уровни MYOG + β-GAL + (на общую β-GAL +) клеток наблюдались на контрольных и мутантных волокнах, культивируемых в течение 72 часов (Рисунок 3D, E). Таким образом, передача сигналов c-MET, по-видимому, не требуется для активации SC или дифференцировки миобластов с помощью этого анализа ex vivo. Соответственно, мутантные клетки β-GAL + экспрессировали маркер терминальной дифференцировки, MHC, в мышечной ткани 10 dpi, демонстрируя, что мутантные клетки способны активировать и дифференцироваться in vivo (рис. 3F). Вместе эти данные демонстрируют, что c-MET не требуется для прогрессирования SC через характерные стадии активации миобластов и дифференцировки миоцитов, либо ex vivo на отдельных волокнах, либо in vivo в ответ на CTX-индуцированное повреждение.

    Неспособность мутанта SC к устойчивой регенерации новых мышечных волокон (рис. 1D-F) может быть результатом снижения пролиферации SC. Для оценки пролиферации SC использовали два метода. Сначала отдельные волокна от R26R LacZ контрольных и мутантных мышей культивировали в течение 72 часов, в течение которых миобласты пролиферируют и накапливаются в клональных кластерах (рис. 4A). Используя размер кластера в качестве показателя пролиферации, мы обнаружили очень похожие профили экспансии между контрольными и мутантными SC (рис. 4B).Во-вторых, мы оценили распространение in vivo. R26R LacZ мутантным и контрольным мышам вводили TMX и травмировали, как описано. Затем мышам вводили один раз в день 5-этинил-2'-дезоксиуридин (EdU) от 2 до 5 дней после травмы, когда скорость пролиферации миобластов наиболее высока после травмы. Количественная оценка клеток β-GAL + EdU + (включая отдельные клетки и волокна) показала, что из общего количества клеток β-GAL + DAPI + в поврежденной области как контрольные, так и мутантные миобласты имели одинаковые скорости включения EdU (β-GAL + EdU + / β-GAL + DAPI +; Рисунок 4C, D).Хотя пролиферация мутантных и контрольных миобластов была сопоставима, количество β-GAL + DAPI + клеток на поле повреждения было значительно снижено в мутантных мышечных срезах (рис. 4E). Общее количество ядер DAPI + на поврежденную область было сходным между контролем и мутантом (рис. 4F), что позволяет предположить, что c-MET требуется для накопления SC в месте повреждения. Поскольку c-Met исключительно важен для миграции мышечных предшественников во время эмбриогенеза [2], мы подозревали, что c-Met может вносить вклад в миграцию миобластов во время миорегенерации.

    10.1371 / journal.pone.0081757.g004 Рисунок 4 c-MET не влияет на пролиферацию миобластов.

    A) Репрезентативное изображение клеток β-GAL + в клональных кластерах на отдельных волокнах EDL, культивируемых в течение 72 часов (масштабная линейка = 20 мкм). B) Гистограмма, показывающая количество клеток β-GAL + на кластер на контрольных и мутантных отдельных волокнах EDL, культивируемых в течение 72 часов (N = 3 мыши; n = 50 клеток на мышь). C) Репрезентативные изображения ТА-мышцы с разрешением 5 точек на дюйм от контрольных и мутантных мышей, зондированных IF для β-GAL и EdU и окрашенных DAPI (стрелки, β-GAL + EdU + клетки; масштабная полоса = 50 мкм).D) Количественное определение β-GAL + EdU + / β-GAL + DAPI + клеток в 5 dpi срезах ТА мышц (p = 0,36 t-тест; N = 3 мыши; n = 866 для контроля, 333 для мутанта; полосы ошибок = SEM). E) Количественная оценка β-GAL + DAPI + клеток на 0,15 мм 2 поврежденной области ТА-мышцы (p = 0,02 t-тест; N = 3 мыши; n = 4 поврежденных мышечных поля на мышь; полосы ошибок = SEM). F) Количественная оценка DAPI + клеток на 0,15 мм 2 поврежденной области ТА-мышцы (p = 0,18 t-тест; N = 3 мыши; n = 4 поврежденных мышечных поля на мышь; полосы ошибок = SEM).

    c-MET регулирует миграцию миобластов

    Неспособность мутантных миобластов мигрировать из неповрежденных областей мышцы в поврежденную область может объяснять плохой регенеративный фенотип (Figure 1D-G). Чтобы оценить роль c-MET в миграции миобластов, культуры миобластов были приготовлены из контрольных и мутантных мышей R26R LacZ и обогащены культурами путем дифференциального посева, что оценивалось с флуоресцентным субстратом β-GAL, Imagene Green, и подтверждено, что они содержат ~ 90 % отмеченных миогенных клеток для отслеживания (Рисунок S2).Клетки помещали в среду для миграции (см. Материалы и методы), и за миграцией клеток следили с помощью визуализации живых клеток. Мы проанализировали 3 аспекта миграции клеток: морфологию клеток, расстояние миграции от точки происхождения и скорость. Индивидуальные контрольные миобласты показали устойчивое образование ламеллиподий на переднем крае клетки, определяемое направлением миграции (пример на фиг. 5A, верхняя серия; видео S1 для мигрирующих контрольных клеток). Напротив, мутантные клетки имели более короткое и менее частое образование ламеллиподий (пример в нижнем ряду рис. 5A; видео S2 для мигрирующих мутантных клеток).Следы миграционных путей от клеток, отображаемые в течение 6 часов, показали уменьшение миграционных расстояний от точки происхождения в мутантных клетках по сравнению с контрольными клетками (рис. 5B). Средняя скорость была рассчитана для отдельных миобластов, культивированных в течение 6 часов. В отсутствие экзогенного HGF контрольные клетки мигрировали быстрее, чем мутантные клетки, предполагая, что аутокринная передача сигналов HGF [23] или активация c-MET другим фактором [24] обеспечивала оптимальную миграцию миобластов (синие столбцы на рис. 5C). Экзогенный HGF увеличивал скорость миграции в контрольных клетках.Мутантные клетки, однако, не мигрировали быстрее при воздействии HGF, что согласуется с инактивацией c-MET у мутанта (черные столбцы на рис. 5C), а c-MET является эксклюзивным рецептором, опосредующим хемотаксический эффект HGF.

    10.1371 / journal.pone.0081757.g005 Рисунок 5 c-MET играет роль в морфологии клеток, пройденном расстоянии и скорости во время миграции миобластов.

    A) Последовательность изображений модулирующего контраста Хоффмана (HMC), показывающих живые миобласты в среде миграции. Изображения тех же клеток получали каждые 4 минуты в течение 68 минут (стрелки - ламеллиподии в контрольной клетке; наконечники стрелок - выступы мембраны в мутантной клетке; масштабная линейка = 20 мкм.Б) Следы, показывающие миграционные пути 15 миобластов. Положения клеток записывали каждые 4 минуты в течение 6 часов (оси = ± 300 мкм). C) Средняя скорость миобластов в среде миграции без (без GF) или с добавкой HGF в концентрации 4 нг / мл. Изображения снимались каждые 4 минуты, измерения скорости регистрировались в течение 6 часов. (p <0,02 t тест; N = 3 мыши; n = 10 клеток на мышь; планки ошибок = SEM).

    Эффект c-MET на миграцию миобластов напоминает известную роль c-MET в регуляции цитоскелета [8].Действительно, мы обнаружили, что мутантные миобласты часто лишены окрашенных фаллоидином ламеллиподий (рис. 6A, C). Мы также исследовали INTEGRIN-β1 (INTβ1) в мигрирующих миобластах; интегрины присутствуют в ламеллиподиях и важны для миграции клеток [25], известно, что они взаимодействуют с c-MET [1], а INTβ1 влияет на миграцию в миобластах [26]. IF показал распределение INTβ1 по ламеллиподиям и периядерным областям в контрольных миобластах, в то время как мутантные клетки показали потерю организованного распределения, напоминающую ламеллиподии и периядерную окраску, что указывает на аберрантное распределение INTβ1 в мутантных миобластах (фиг.6B, D).

    10.1371 / journal.pone.0081757.g006 Рисунок 6 c-MET способствует образованию ламеллиподий и периядерной локализации INTβ1.

    A) Типичные изображения клеток, окрашенных фаллоидином и DAPI с IF для YFP (стрелка, ламеллиподии; наконечник стрелки, длинный выступ актина; масштабная полоса = 5 мкм). B) Репрезентативные изображения клеток с IF для INTβ1 и YFP (стрелка, периядерная локализация INTβ1; масштаб такой же, как на (A)). C) Средний процент клеток YFP + с ламеллиподиями, окрашенными фаллоидином, как показано в примере (A) (p =.00029 т испытание; N = 3; n = 120 ячеек; планки погрешностей = SEM). D) Средний процент клеток YFP + с периядерным INTβ1, как показано в примере (B) (p = 0,013 t-тест; N = 3; n = 120 клеток; планки ошибок = SEM).

    В совокупности эти данные подтверждают, что миобласты взрослых нуждаются в функции c-MET для эффективной, но не абсолютной подвижности. Миобласты, по-видимому, используют передачу сигналов c-MET для усиления миграции, независимо от экзогенного источника HGF, а стимулированная HGF подвижность миобластов требует c-MET.Нарушение миграции мутантных миобластов, вероятно, частично связано с динамикой цитоскелета актина и распределением INTβ1.

    c-MET мутантные миобласты дефектны в слиянии миобластов

    Помимо миграции, цитоскелет важен для слияния миоцитов [27-29]. Миоциты будут легко сливаться и образовывать миотрубки при выращивании в среде для дифференцировки (см. Материалы и методы). Чтобы исследовать возможную роль c-MET во время образования мышечной трубки, мутантные и контрольные миобласты выращивали в среде для дифференцировки и визуализировали через 24 и 48 часов.Мы наблюдали временную морфологию уплощения мутантных клеток через 24 часа и меньшее количество меньших и дисморфных мышечных трубок, образованных в мутантной культуре по сравнению с контролем через 24 и 48 часов (рис. 7A). Эти данные указывают на потребность в c-MET во время формирования мышечной трубки.

    10.1371 / journal.pone.0081757.g007 Рисунок 7 Миобластам требуется c-MET для эффективного слияния.

    A) Изображения HMC, показывающие одинаковые поля живых миобластов с низкой плотностью в среде дифференцировки в T0, 24 и 48 часов.(шкала = 100 мкм). B) Репрезентативные изображения контрольных и мутантных миобластов R26R YFP с высокой плотностью после 3 дней в среде для дифференцировки. Клетки зондировали с помощью IF на MHC и YFP и окрашивали DAPI (шкала = 100 мкм). C) Индекс дифференциации (MHC + YFP + ядра на ядра YFP +) и D) Индекс неслитых клеток (MHC + YFP + клетки с одним ядром на общее количество MHC + YFP + ядер) количественно оценивали в 3-дневных культурах дифференцировки. Для каждого условия были протестированы две независимые культуры клеток.Клетки с низкой плотностью высевали из расчета 13000 клеток на см 2 ; клетки с высокой плотностью высевали из расчета 40000 клеток на см 2 . Подсчитывали не менее 110 клеток MHC + YFP + для каждой культуры и состояния.

    Чтобы определить, имеют ли мутантные миоциты слияние или дефект терминальной дифференцировки, контрольные и мутантные миобласты R26R YFP выращивали в среде для дифференцировки в течение 3 дней, а затем зондировали с помощью IF на MHC и YFP. Контрольные миоциты слились с образованием многоядерных MHC + мышечных трубок через 3 дня (рис. 7B).Мутантные миоциты показали качественный дефект слияния, характеризуемый множеством округлых клеток MHC + YFP +, содержащих одно ядро, а также дисморфическими мышечными трубками MHC + (рис. 7B). Чтобы определить, были ли округлые клетки апоптотическими, мы проанализировали расщепленную CASPASE-3 (CAS3) и сравнили 3-дневные мутантные и контрольные дифференцирующиеся культуры (рис. S3A, B). Хотя в мутантных культурах было немного больше клеток CAS3 + YFP +, это вряд ли объясняло высокий процент неслитых клеток MHC +, присутствующих в мутантных культурах (фигура 7D).Кроме того, мы не обнаружили двойных положительных клеток CAS3 + MHC + (рис. S3C), что согласуется с предыдущими выводами о том, что окончательно дифференцированные мышечные клетки не подвергаются апоптозу [30]. Затем мы заподозрили, что дефект миграции мутантов может влиять на слияние миоцитов просто потому, что клетки не могут мигрировать на большие расстояния друг к другу так же эффективно, как контроли. Поэтому мы тестировали клетки как с высокой, так и с низкой плотностью в анализе слияния. Индексы дифференцировки показали небольшое увеличение количества мутантных клеток MHC + на общее количество клеток YFP + по сравнению с контрольными культурами при обеих плотностях (фигура 7C), что указывает на то, что дифференцировка не была нарушена в мутантных клетках в этих условиях.Однако мутантные культуры имели в> 2 раза больше не слившихся клеток MHC + по сравнению с контролем как при низкой, так и при высокой плотности клеток (рис. 7D). Маловероятно, что минимальное количество других типов клеток в дифференцирующихся культурах физически блокировало слияние мутантных миоцитов, поскольку многие клетки MHC + YFP + с одним ядром были обнаружены в непосредственной близости друг от друга (рис. 7B). Эти данные предполагают, что миграция на большие расстояния не влияет на скорость слияния мутантов и что c-MET необходим для оптимального слияния миоцитов и образования мышечной трубки, прямо или косвенно.

    Обсуждение

    Мы продемонстрировали генетическую потребность в c-Met в SCs во время регенерации мышц в ответ на острое повреждение in vivo. Предыдущие исследования с использованием нейтрализующих антител к лиганду c-MET, HGF, показали, что блокирование этой сигнальной оси препятствует регенерации взрослых мышц in vivo [12]. Поскольку существуют другие типы резидентных клеток в мышцах, экспрессирующие c-MET [13], неясно, какие клетки нуждаются в активации c-MET. Наша SC-специфическая инактивация функции c-Met является прямым доказательством того, что SC представляют собой по крайней мере одну клеточную популяцию, требующую активности c-MET во время регенерации мышц.Используя различные анализы in vivo и in vitro в сочетании с анализами маркеров клонов, мы смогли определить, что мутантные SC c-Met не были дефектными в отношении пролиферации и дифференцировки. Скорее, они были дефектными в базальной, а также в стимулированной HGF подвижности in vitro, что сопровождалось уменьшением образования ламеллиподий и аномальным внутриклеточным распределением INTβ1. Мы также документируем неожиданный дефект слияния мутантных миобластов in vitro, предполагая роль c-MET в этом процессе. Эти первичные дефекты (миграция и слияние) в мутантных SC помогают объяснить дефекты регенерации мускулов in vivo, т.е.е. уменьшение количества миогенных клеток, а также уменьшение размеров и количества регенерированных миофибрилл.

    Ось передачи сигналов c-MET-HFG в активации и пролиферации SC

    Путем анализа скоростей включения EdU среди миогенных клеток с клональной меткой in vivo мы обнаружили, что пролиферация мутантных c-Met и контрольных клеток в поврежденной / регенеративной области была сходной, несмотря на то, что в мутанте было значительно меньше миогенных клеток (рис. 4). Мы также не обнаружили существенной разницы в клональной экспансии SC на отдельных волокнах между мутантными и контрольными клетками, анализ предположительно не зависит от миграции клеток (рис. 4).Наши данные удивительны, поскольку хорошо известно, что введение HGF ускоряет активацию SC и увеличивает пролиферацию SC [11,13,31-34]. Одно из возможных объяснений состоит в том, что другие факторы активации и пролиферации in vivo и добавки в культуральные среды маскируют потребность в передаче сигналов HGF-c-MET. Члены семейства FGF являются главными кандидатами на такую ​​компенсаторную роль, поскольку они также используют рецепторные тирозинкиназы, такие как c-MET. Кроме того, bFGF является мощным фактором пролиферации SCs в культуре [35,36], а передача сигналов FGF необходима для активации или пролиферации SC во время регенерации мышц [37].Следует отметить, что нуль-мутант c-Met не влияет на пролиферацию, а только на отслаивание и миграцию миогенных предшественников в дермомиотоме [3]. Кроме того, тот же условный аллель c-Met, использованный в нашем исследовании, впервые был использован в анализах регенерации печени. Хотя мутантные гепатоциты не реагировали на HGF in vitro, они не были дефектными в пролиферации после повреждения in vivo [5]. Наши данные предоставляют еще один клеточный контекст, в котором c-MET не требуется для пролиферации. Учитывая, что рекомбинированный условный аллель c-Met продуцирует необработанный мутантный белок, неспособный к фосфорилированию Tyr 1234/1245 (рисунок 1), предполагаемый сигнал нулевой, наши данные подтверждают, что передача сигнала c-MET в SC не играет существенной роли в их активации. и пролиферация, и д. изменить предыдущие представления об этой сигнальной оси в биологии SC.

    Ось передачи сигналов c-MET-HFG в миграции SC

    Результаты нашего отслеживания в реальном времени миобластов, меченных клонами, действительно подтверждают роль c-MET в обеспечении эффективной миграции миобластов. Мы также обнаружили, что функция c-MET необходима для оптимальной «базальной» миграции (т.е. мутантные клетки c-Met действительно мигрируют) в отсутствие экзогенного HGF (Рисунок 5). Одна возможность состоит в том, что аутокринная передача сигналов HGF делает возможной миграцию миобластов [23]. Это может показаться противоречащим исследованиям, которые пришли к выводу, что HGF является хемоаттрактантом для миобластов [14,38], поскольку не будет градиента для хемоаттрактанта.Однако, поскольку экзогенный HGF может индуцировать миграцию (это исследование и [14,38]), передача сигналов c-MET не насыщается клеточно-автономным источником HGF, оставляя открытой возможность для миобластов обнаруживать экзогенный градиент HGF. Другая возможность снижения базальной миграции мутантных SCs заключается в том, что c-MET участвует в модуляции др. Клеточных компонентов для подвижности HGF-независимым образом [24].

    Передача сигналов

    HGF ведет к снижению актиновых стрессовых волокон и подвижности клеток [39] за счет активации малых GTP-связывающих белков Ras и Rac [40].В миобластах, индуцированная HGF подвижность требует белков ремоделирования актина WAVE-2 и N-WASP [41]. В соответствии с ролью c-MET в реорганизации актина во время миграции, мы наблюдали мутантные клетки c-Met, образующие меньшие клеточные удлинения во время миграции, имели более короткие диапазоны миграции от точки происхождения и мигрировали медленнее, чем контроли (Рисунок 5). Кроме того, мутантные миобласты c-Met обычно лишены сложных ламеллиподий, что согласуется со сниженной подвижностью. Мутантные клетки также имели более низкую частоту околоядерной локализации INTβ1 по сравнению с контрольными клетками (Рисунок 6.). Недавно было документально подтверждено, что INTβ1-опосредованная миграция вовлекает рециклинг INTβ1 из плазматической мембраны в околоядерный компартмент [42]. Таким образом, мы предлагаем механистические требования для c-MET в рециклинге INTβ1 для эффективной миграции.

    Наши результаты in vitro помогают объяснить дефект регенерации мышц, наблюдаемый у SC-специфичного мутанта c-Met in vivo: мутантные миобласты обладали пониженной способностью мигрировать из неповрежденных областей мышцы, что приводило к уменьшению присутствия миогенных клеток в поврежденных. площадь.В связи с этим должен происходить высвобождение HGF в месте повреждения или рядом с ним, чтобы стимулировать миграцию SC посредством передачи сигналов c-MET. Таким образом, роль c-MET в SCs для регенерации взрослых мышц сходна с его ролью в миграции дермомиотомных клеток [2,3]. Другой связанный in vivo дефект в SC-специфичном мутанте c-Met - это увеличение TCF4 + фибробластов в поврежденной области (рис. 2). Известно, что SC и фибробласты расширяются в непосредственной близости во время ранней регенерации, а эффективная регенерация мышц в конечном итоге приводит к рецессии фиброгенных клеток.Хотя молекулярный механизм (ы), контролирующий их взаимодействие, не совсем понятен, удаление большинства SC приводит к длительному увеличению TCF4 + фибробластов в плохо регенерированном месте повреждения [19]. Мы предполагаем, что уменьшение поступления SC, либо из-за их удаления, либо из-за их нарушенной миграционной способности, вызывает длительное накопление фибробластов, которые в конечном итоге участвуют в формировании фиброза.

    Ось передачи сигналов c-MET-HGF в миогенной дифференцировке и слиянии

    Мы задокументировали способность мутантных SCs c-Met дифференцироваться in vitro (Рисунок 7) и образовывать MHC + регенерированные волокна in vivo (Рисунок 3), аналогично контрольным SC.С другой стороны, было показано, что введение HGF задерживает дифференцировку SC in vitro и может ингибировать регенерацию мышц in vivo [11,43]. Эти наблюдения «увеличения функции лиганда» не противоречат нашим данным «потеря функции рецептора». Кажется вероятным, что стимуляция пролиферации SC и ингибирование дифференцировки SC с помощью HGF являются связанными процессами. Поскольку мы не обнаружили существенной роли c-MET в пролиферации SC, неудивительно, что мы также не обнаружили его роль в влиянии на дифференцировку.Тем не менее, возможно, что среда in vivo и культуральная среда in vitro маскируют такую ​​потребность в c-MET в нашей экспериментальной парадигме потери функции.

    Мы также неожиданно обнаружили, что миобласты сливаются реже в отсутствие функции c-MET (Figure 7). В отличие от развития, миогенные предшественники, лишенные c-MET, никогда не отслаиваются от дермомиотома, что препятствует последующему анализу слияния мышечных клеток в конечностях [2]. In vitro, мигрирующие миобласты, как известно, замедляются до начала слияния и образования мышечных трубок [44,45].Кроме того, было описано, что формирование мышечной трубки происходит в два этапа. Первые миобласты сливаются, образуя зарождающиеся миотрубки, которые затем рекрутируют больше миобластов для второго раунда слияния [29]. Мы отмечаем, что мутантные миобласты c-Met инициировали меньше первичных волокон, чем контрольные миобласты после 24 часов в среде дифференцировки (Рисунок 7). Даже через 48 часов мутантные волокна оставались маленькими и короткими (рис. 7), что убедительно свидетельствует о том, что первая стадия слияния является дефектной. Этот дефект на первом этапе слияния затрудняет определение того, участвует ли он также непосредственно во втором этапе слияния.Интересно, что временной профиль экспрессии дифференцирующихся миобластов показал снижение уровней c-Met через 48 часов и резкое увеличение уровней Hgf между 48-96 часами [11], что сильно указывает на роль HGF, продуцируемого формирующимися мышечными трубками, в рекрутировании. нижний c-Met, экспрессирующие миобласты для второго раунда слияния. Следовательно, остается возможным, что c-Met непосредственно участвует в регуляции обеих стадий слияния. С другой стороны, мы не можем исключить, что дефект слияния c-Met мутантных миобластов, описанный здесь, является вторичным следствием их дефекта миграции, поскольку события слияния зависят от клеток, вступающих в контакт посредством миграции.Результаты нашего анализа слияния клеток с высокой плотностью предполагают, что дефект c-Met мутантных SCs не зависит от их дефекта миграции на большие расстояния (Рисунок 7). Поскольку c-Met мутантные SCs подвижны, но нарушают правильное распределение мембранных и цитоскелетных компонентов, они могут быть неспособны правильно выровняться для слияния. Как упоминалось выше, мутантные клетки c-Met обнаруживают дефект в распределении INTβ1 (фиг. 6). Поскольку INTβ1 необходим для слияния [46], его аномальное распределение может вносить вклад в дефект слияния, наблюдаемый в мутантных клетках c-Met.

    В этом исследовании мы использовали генетический подход для выяснения роли c-MET в регенерации мышц путем условной инактивации c-Met, особенно в SC. Мы пришли к выводу, что активность c-MET в SCs важна для их миграции и слияния, но не для их активации, пролиферации или дифференцировки. Не менее важно то, что наши данные предоставляют важную информацию для переоценки различных предполагаемых ролей c-MET / HGF в предыдущих исследованиях.

    Материалы и методы: Животные и сбор тканей

    Мышь c-Met F / F (FVB; 129P2-Mettm1Sst / J) была подарком от Dr.Снорри С. Торгейрссон из Национального института рака, Национальные институты здравоохранения, Бетесда (описано в [5]). Описан аллель Pax7 CE (B6; 129-Pax7 tm2.1 (cre / ERT2 ) Fan / J) [16]. Оба R26R lacz (B6.129S4-Gt (ROSA) 26Sortm1Sor / J) [17] и R26R YFP (B6.129X1-Gt (ROSA) 26Sor tm1 (EYFP ) Cos / J) [18] репортер мыши были получены из лаборатории Джексона. Соответствующие схемы спаривания были использованы для создания мышей смешанного фона с генотипами, описанными в тексте.Однопометники использовались в качестве контроля, когда это было возможно. Генотипирование мышей проводили с помощью ПЦР (праймеры, описанные в [5,16]. Использовали взрослых самок и самцов мышей в возрасте 2-6 месяцев (при этом количество самцов или самок соответствовало контрольным и мутантным для описанных экспериментов, за исключением что для анализа отдельных волокон использовались только самцы). Мы проводили эксперименты на каждой группе (одинаковое количество контрольных и мутантов) животных параллельно. Из-за времени, необходимого для накопления животных желаемых генотипов от генетических скрещиваний для параллельных Для экспериментов использовали животных в возрасте от 2 до 6 месяцев.Мышам давали тамоксифен (TMX) (Sigma; разбавленный до 20 мг / мл в кукурузном масле (Sigma)), 3 мг на 40 г веса тела на внутрибрюшинную инъекцию, один раз в день последовательно в течение 5 дней. Все эксперименты проводились через 10 дней после последней инъекции. Мышей анестезировали, используя 2,2,2-трибромэтанол (Sigma), который растворяли в 2-метил-2-бутаноле (Sigma) в виде 100% (мас. / Об.) Исходного раствора. Рабочее разведение делали свежим ежемесячно в PBS при 2,5%, фильтровали через шприц-фильтр 0,22 мкм (VWR), хранили при 4 ° C и использовали в дозе 10 мкл на грамм веса тела путем внутрибрюшинной инъекции.Для травмы 50 мкл 10 мкМ кардиотоксина (CTX) (Sigma) вводили с помощью инсулинового шприца (BD) в ТА-мышцы. EdU (Invitrogen) вводили внутрибрюшинно в дозе 0,1 мг на 20 г массы тела на инъекцию один раз в день через 2-5 дней после травмы. Мышей умерщвляли смещением шейного отдела позвоночника, и ТА-мышцы собирали путем осторожного разрезания сухожилий, чтобы удалить всю неповрежденную мышцу, фиксировали в течение 8 минут ледяным 4% параформальдегидом (EMS) в фосфатно-солевом буфере (PBS; Gibco), инкубировали каждую ночь в течение ночи. 10% и 20% сахарозы PBS, затем помещают на пробку с использованием Tragacanth (Sigma) и мгновенно замораживают в течение 30 секунд в 2-метилбутане (Sigma), охлаждаемом жидким азотом.Это исследование было проведено в строгом соответствии с рекомендациями Руководства по уходу и использованию лабораторных животных Национального института здоровья. Все манипуляции с мышами были одобрены Комитетом по уходу и использованию животных (IACUC) Научного института Карнеги (номер разрешения A3861-01).

    Культура клеток, FACS и RT-PCR. Миобласты

    получали путем массового культивирования всех мышц задних конечностей. Мышцы рассекали, измельчали ​​и инкубировали в 0,2% коллагеназе типа I (Sigma) в среде DMEM при 37 ° C с осторожным встряхиванием в течение 1.5 ч. Затем мышцы растирали в 10% FBS в DMEM, промывали PBS и инкубировали в 0,2% диспазе (Gibco) в DMEM при 37 ° C при осторожном встряхивании в течение 30 минут. Клетки фильтровали через сетчатый фильтр для клеток 70 мкм, высевали на 10-сантиметровые планшеты для тканевых культур, покрытых матригелем (BD Biosciences), в 20% FBS, 5% лошадиной сыворотке, 1% Penn / Strep (Invitrogen), 1% Glutamax (Invtrogen), DMEM. (называемые средой для пролиферации, в отличие от сред дифференцировки и миграции (см. ниже)) и инкубировали (37 ° C, 5% CO 2 ).Клетки инкубировали в течение 3 дней, удаляли с планшетов обработкой 0,25% трипсином / ЭДТА (Life Technologies) в течение 7 минут, дифференцированно высевали в среде для пролиферации на чашки без покрытия в течение 1 часа для удаления немиогенных клеток (культуры, поддерживаемые популяцией клеток. который был ~ 90% отмечен как миогенный согласно анализу Imagene Green, описанному ниже), а затем возвращен на планшеты с покрытием Matrigel. Клетки поддерживали в среде для пролиферации до 3 пассажей с дифференцированным посевом между пассажами. Формирование миотрубок в этих культурах происходило нечасто.Иногда клетки замораживали в течение 5 дней после сбора, а затем один раз размораживали для использования в будущем.

    Для анализа FACS первичные клетки культивировали в течение 3 дней, пассировали один раз и культивировали еще 2 дня для увеличения популяции миобластов перед сортировкой. Выделение FACS на основе флуоресценции YFP было выполнено с помощью программного обеспечения BD FACS ARIA III и FACS Diva с использованием канала 488 и стробированием сначала для размера клеток с использованием прямого и бокового рассеяния, а затем с использованием стробирования для клеток YFP +. Мы отметили, что наша методика диссоциации и культивирования дала аналогичные количества SC из FACS и препаратов в разных чашках.Очищенные клетки FACS использовали сразу после сортировки на РНК и выделения белка. РНК выделяли с использованием набора для выделения РНК Arcturus PicoPure (Applied Biosystems), праймерами для c-Met ОТ-ПЦР были ttaggcaatgaggtgtcccac и cagccgtcagacaattggcac.

    Отдельные волокна получали путем осторожного удаления мышцы Extensor Digitorum Longus (EDL), следя за тем, чтобы не повредить сухожилие на любом конце мышцы. EDL помещали в 0,2% коллагеназу типа II (Gibco), DMEM, на водяную баню при 37 ° C при осторожном встряхивании в течение 1 часа.Среду заменили предварительно нагретой DMEM, и отдельные волокна диссоциировали путем осторожного растирания (во время которого некоторые SC могли высвободиться из волокон) с использованием полированных пламенем стеклянных пипеток Пастера, которые были предварительно покрыты лошадиной сывороткой для ограничения прилипания волокон. к стеклу. Волокна культивировали путем суспендирования в среде для пролиферации (инкубировали при 37 ° C, 5% CO 2 ) в чашках, которые были покрыты лошадиной сывороткой для ограничения прилипания волокон к пластику. Присутствие немиогенных клеток на культивируемых волокнах было минимальным (<1%), как определено с помощью иммунофлуоресценции (IF) для маркера линии β-GAL (см. Ниже для IF).

    Миобласты, меченные вестерн-блоттингом

    YFP, получали и выделяли с помощью FACS (описанного выше), и белок экстрагировали из осадка клеток с использованием реагента для экстракции белка T-Per Tissue Protein Extraction Reagent (Thermo), 1 мМ PMSF, 1x коктейль из ингибиторов фосфатазы остановки (Thermo), полная протеаза Таблетка-ингибитор (Roche). Осадки разрушали с использованием Pestle (Kimble Chase), центрифугировали при 4 ° C в микроцентрифуге на максимальной скорости, и супернатант добавляли к 4-кратному буферу для образцов SDS для достижения конечной 1-кратной концентрации. Образцы кипятили 5 минут, а затем разделяли на 7.5% SDS-PAGE (Bio-Rad) с маркером молекулярной массы Kaleidascope (Bio-Rad). Вестерн-перенос на мембрану PVDF для иммуноблоттинга (Bio-Rad) выполняли в течение ночи при 4 ° C с использованием системы Bio-Rad mini-Protein II Transfer. Мембрану блокировали в 5% обезжиренном сухом молоке гвоздики, 0,1% Tween 20 (Sigma), TBS в течение 1 ч при комнатной температуре, инкубировали с первичным антителом в блокирующем растворе в течение ночи при 4 ° C (Goat anti-c-MET (R & D, AF527) 1: 500, кроличьи анти-фосфо-c-MET Y1234 / 1235 (Cell Signaling, 3077S) 1: 500, мышиные анти-GAPDH (Chemicon, MAB374) 1: 1000), промытые 0.1% Tween 20 TBS, 3 раза по 10 минут каждый, инкубируют со вторичными антителами в течение 1 ч при комнатной температуре (конъюгированные с HRP антитела к козьим (Invitrogen), анти-кроличьи (Invitrogen) и анти-мышиные (Millipore) в соотношении 1:10 000). ), промывали 0,1% Tween 20 TBS, 2 раза по 5 минут каждый, с последующей третьей промывкой 2 часа, затем реакцией ECL с использованием фемтохемилюминесцентного субстрата (Thermo) и экспонировали на рентгеновской пленке.

    Иммуноокрашивание и количественная оценка.

    10 мкм срезов ТА-мышцы на предметных стеклах SuperFrost Plus (Fisher) проницаемо для проницаемости 0.1% Triton-X 100 (Sigma), PBS в течение 20 минут при комнатной температуре, один раз промыли 0,05% Triton-X 100, PBS (PBS / T), а затем инкубировали в блокирующем растворе Mouse IgG1 от M.O.M. Набор (Vector Lab), разбавленный в PBS / T из расчета 1 капля на 1,5 мл, в течение 6 часов или в течение ночи при 4 ° C. Затем срезы промывали PBS и инкубировали в 10% нормальной козьей сыворотке (Genetex), 1% блокирующем порошке (Perkin Elmer), PBS / T (NGB) в течение 30 минут при комнатной температуре. Первичные антитела (мышиный IgG2 b против саркомерного миозина (DSHB, супернатант, MF20) 1:20, мышиный IgG против эмбрионального миозина (DSHB, супернатант, F1.652) 1:20, кроличий анти-β-GAL (Cappel, # 55976, в настоящее время от MP Biomedicals) 1: 5000, мышиный IgG2 a anti-TCF4 (Millipore) 1: 250 (слайды, обработанные раствором для демаскировки антигена (Vector ) кипячением в течение 10 минут перед окрашиванием TCF4 [19]) разбавляли в NGB и наносили на срезы на 6 часов или в течение ночи при 4 ° C. Срезы промывали 3 раза PBS / T, а затем инкубировали со вторичными антителами, разведенными в NGB, в течение 1 ч при комнатной температуре (Alexa Fluor 488, конъюгированный против мышиного IgG1 1: 1000, Alexa Fluor 568, конъюгированный против мышиного IgG2 b. 1: 500, конъюгированные с Alexa Fluor 488 антитела против кролика 1: 1000, все от козы (Invitrogen), и антитела против куриного IgG DyLight 549 1: 500 от козы (Rockland)).Слайды промывали PBS / T, EdU определяли с помощью набора для реакции Click-iT (Invitrogen), инкубировали в DAPI 1 мкг на мл PBS / T в течение 5 минут при комнатной температуре, промывали PBS / T и затем устанавливали с помощью Fluoromount- G (Южный Биотех). Диаметр мышечных волокон измеряли как самый короткий диаметр, количественно определяли только клетки с центрально локализованными ядрами. Полученные поля измерены 0,38 мм 2 .

    Отдельные волокна фиксировали в 4% PFA в течение 8 минут, промывали в PBS, 3x, 5 минут на промывку, проницаемость с помощью 0.5% Triton-X 100, PBS в течение 15 минут, а затем промыли PBS / T. Волокна инкубировали в NGB в течение ночи при 4 ° C, а затем в первичных антителах, разведенных в NGB в течение ночи при 4 ° C (мышиный IgG1 anti-Pax7 [16] 1:20, мышиный IgG1 anti-MYOD (DAKO, M351201) 1: 1000). , Мышиный IgG1 против МИОГЕНИНА (DSHB, супернатант, F5D) 1:50, кроличий анти-β-GAL 1: 5000). Волокна промывали PBS / T, инкубировали с флуоресцентными вторичными антителами, как описано выше, в NGB, а затем DAPI, промывали PBS / T и помещали с Fluoromount G на предметные стекла SuperFrost Plus.

    Миобласты, культивированные на предметных стеклах с 8-луночной камерой (Thermo), фиксировали в 4% PFA, PBS в течение 8 минут при комнатной температуре, промывали PBS, пропитывали 0,5% Triton-X, PBS в течение 15 минут, промывали PBS / T и инкубировали с NGB в течение 1 ч при комнатной температуре. Первичные антитела наносили в NGB на 2 часа при комнатной температуре (мышиный IgG2 b против саркомерного миозина (DHSB, MF20) 1:20, кроличьи анти-GFP (Invitrogen, G10362) 1: 500, куриные анти-GFP (Aves ) 1: 500, крысиные анти-INTEGRIN β1 (Millipore) 1: 200, кроличьи анти-расщепленные CASPASE-3 (клеточные сигналы) 1: 200), затем PBS / T, 3х, 5 минут на промывку.Фаллоидин Alexa Fluor 488 (Invitrogen) в разведении 1:40 наносили на клетки с флуоресцентными вторичными антителами. Флуоресцентное вторичное антитело в промывках NGB, DAPI и PBS / T и установка такие, как описано выше. Ламеллиподии количественно определяли как клетки, проявляющие окрашивание фаллоидином, как показано на Фигуре 6А стрелкой. Периядерный INTβ1 был количественно определен как клетки, демонстрирующие распределение INTβ1, как показано на Фигуре 6B, стрелкой.

    Анализ миграции живых клеток

    Миобласты высевали на ламинине (Sigma) в 12-луночный планшет, 10000 клеток на лунку, и культивировали в течение ночи в 10% FBS, 1% Penn / Strep, DMEM (среда для миграции).Перед визуализацией в лунки добавляли свежую миграционную среду с 4 нг / мл HGF [14] (Invitrogen) или без него. Флуоресцентный субстрат β-GAL, Imagene Green (Invitrogen), использовали в соответствии с протоколом, предложенным производителем. Изображения получали каждые 4 минуты из 3 различных полей в каждой лунке в течение 6 часов, скорости отдельных клеток измеряли с помощью программного обеспечения Metamorph. Следы миграции были основаны на данных о положении ячеек, сгенерированных Metamorph (координаты x и y), и собраны с помощью Microsoft Excel.

    Анализ слияния

    Для визуализации живых организмов миобласты высевали на матригеле в 24-луночный планшет, 13000 клеток / см 2 . Перед визуализацией среду для пролиферации заменяли 2% FBS, 1% Penn / Strep, DMEM (средой для дифференциации). Изображения снимались каждые 5 минут в течение 48 часов и обрабатывались с помощью Metamorph.

    Для иммунофлуоресценции миобласты получали из 2 мышей, каждая для контроля и мутанта, и анализировали независимо (без смешивания). Контрольные и мутантные культуры выращивали параллельно для сравнения.Клетки высевали на 8-луночное предметное стекло, покрытое матригелем, при плотности 13000 (низкая плотность) или 49000 (высокая плотность) клеток / см 2 . В лунки добавляли среду для дифференцировки, и клетки выращивали в течение 3 дней, затем фиксировали в 4% PFA, PBS. Индекс дифференцировки определяли по количеству ядер в клетках MHC + YFP + на ядра в клетках YFP +. Индекс неслитых клеток определяли по клеткам MHC + YFP + с одним ядром на общее количество ядер в клетках MHC + YFP +.

    Микроскопия

    Изображения срезов мышц, окрашенных гематоксилином, эозином и трихромом, были получены с помощью микроскопа Nikon 800, оснащенного 10x /.45 Объектив Plan Apo и камера Canon EOS T3 с использованием программного обеспечения для получения изображений EOS Utility. Флуоресцентные изображения (DAPI, Alexa Fluor 488, 568 и 647) срезов мышц были получены с использованием либо Zeiss Axioscope, оснащенного объективом 20x / 0,5 Plan Neofluar, и камеры Axiocam с использованием программного обеспечения для получения изображений Zeiss, либо конфокальной камеры Leica SP5, оснащенной 40x / 1,25. и масляные объективы 63x / 1.4 Plan Apo с использованием программного обеспечения Leica для получения изображений. Изображения клеток на отдельных волокнах получали с помощью установки Leica SP5.Визуализацию живых клеток проводили с помощью Nikon TE2000 10x ELWD с использованием модуляционного контраста Хоффмана (HMC) и камеры Photometrics Coolsnap HQ с использованием программного обеспечения Metamorph.

    Оставить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *