Гк рф ст 290: ГК РФ Статья 290. Общее имущество собственников квартир в многоквартирном доме 

Содержание

Статья 290. Общее имущество собственников квартир в многоквартирном доме

1. Собственникам квартир в многоквартирном доме принадлежат на праве общей долевой собственности общие помещения дома, несущие конструкции дома, механическое, электрическое, санитарно-техническое и иное оборудование за пределами или внутри квартиры, обслуживающее более одной квартиры.
2. Собственник квартиры не вправе отчуждать свою долю в праве собственности на общее имущество жилого дома, а также совершать иные действия, влекущие передачу этой доли отдельно от права собственности на квартиру.

Комментарий к статье 290 ГК РФ

1. Особенностью права общей собственности на общее имущество в многоквартирном доме является то, что общая собственность возникает непосредственно в силу факта приобретения гражданами в собственность конкретных помещений.

Собственникам помещений в многоквартирном доме принадлежат на праве общей долевой собственности помещения в данном доме, не являющиеся частями квартир и предназначенные для обслуживания более одного помещения в данном доме, в том числе межквартирные лестничные площадки, лестницы, лифты, лифтовые и иные шахты, коридоры, технические этажи, чердаки, подвалы, в которых имеются инженерные коммуникации, иное обслуживающее более одного помещения в данном доме оборудование (технические подвалы), а также крыши, ограждающие несущие и ненесущие конструкции данного дома, механическое, электрическое, санитарно-техническое и иное оборудование, находящееся в данном доме за пределами или внутри помещений и обслуживающее более одного помещения, земельный участок, на котором расположен данный дом, с элементами озеленения и благоустройства и иные предназначенные для обслуживания, эксплуатации и благоустройства данного дома объекты, расположенные на указанном земельном участке. Границы и размер земельного участка, на котором расположен многоквартирный дом, определяются в соответствии с требованиями земельного законодательства и законодательства о градостроительной деятельности (ч. 1 ст. 36 ЖК).

Доля в праве общей собственности на общее имущество в многоквартирном доме собственника помещения в этом доме пропорциональна размеру общей площади указанного помещения (ч. 1 ст. 37 ЖК).

Собственники помещений в многоквартирном доме владеют, пользуются и в установленных ЖК и гражданским законодательством пределах распоряжаются общим имуществом в многоквартирном доме (ч. 2 ст. 36 ЖК).

2. Другой особенностью права общей собственности на общую часть многоквартирного дома является то, что в отличие от общего правила (ст. 252 ГК) о праве участника общей долевой собственности на выдел своей доли собственник доли в праве общей собственности на общее имущество многоквартирного дома такого права на выдел не имеет. В данном случае каждому собственнику квартиры принадлежит доля в праве собственности на общее имущество, а не реальная доля в материальном объекте.

Участник общей собственности не вправе отчуждать свою долю в общей собственности, отказываться от нее в пользу физических или юридических лиц, а также совершать иные действия, влекущие утрату им доли в общей собственности, отдельно от принадлежащей ему на праве собственности квартиры. И это естественно, ибо отчуждение или передача в пользование объектов общей собственности в многоквартирном доме делают невозможным для других собственников осуществлять свое право на это недвижимое имущество. Доля каждого собственника квартиры в праве общей собственности в многоквартирном доме следует судьбе права собственности на квартиру. При купле-продаже квартиры доля нового собственника квартиры в праве общей собственности на объекты общего пользования в многоквартирном доме соответствует доле предшествующего собственника.

Как считается доля собственника в общем имуществе в многоквартирном доме? Какая есть по этому вопросу судебная практика?

Согласно ч. 1 ст. 36 ЖК РФ собственникам помещений в многоквартирном доме принадлежит на праве общей долевой собственности общее имущество в многоквартирном доме. Жилищным кодексом РФ установлено, что доля в праве общей собственности на общее имущество в многоквартирном доме собственника помещения в этом доме пропорциональна размеру общей площади указанного помещения (ч.1 ст. 37 ЖК РФ).

До принятия Жилищного кодекса РФ собственники помещений в многоквартирном доме имели возможность определять доли в праве общей собственности решением общего собрания или иным законным соглашением участников долевой собственности на общее имущество в соответствии со ст. 9 Федерального закона от 15.06.1996 № 72-ФЗ «О товариществах собственников жилья». Федеральный закон от 29.12.2004 № 189-ФЗ «О введении в действие Жилищного кодекса Российской Федерации», отменив упомянутый закон о товариществах собственников жилья, установил, что доля в праве общей собственности на общее имущество в многоквартирном доме пропорциональна размеру общей площади принадлежащего на праве собственности помещения в многоквартирном доме, если принятым до вступления в силу настоящего Федерального закона решением общего собрания собственников помещений или иным соглашением всех участников долевой собственности на общее имущество в многоквартирном доме не установлено иное. То есть, если собственниками были выбран иной способ определения этих долей до 1 марта 2005 года, то их решения не утрачивают свою силу и после введения в действие Жилищного кодекса Российской Федерации.

Согласно ч. 1 ст. 41 ЖК РФ собственникам комнат в коммунальной квартире принадлежат на праве общей долевой собственности помещения в данной квартире, используемые для обслуживания более одной комнаты. Доля в праве общей собственности на общее имущество в коммунальной квартире собственника комнаты в данной квартире пропорциональна размеру общей площади указанной комнаты (ч. 1 ст. 42 ЖК РФ). Доля в праве общей собственности на общее имущество в многоквартирном доме собственника комнаты в коммунальной квартире, находящейся в данном доме, пропорциональна сумме размеров общей площади указанной комнаты и определенной в соответствии с долей в праве общей собственности на общее имущество в коммунальной квартире этого собственника площади помещений, составляющих общее имущество в данной квартире (ч.2 ст. 42 ЖК РФ).

Сведения о размерах принадлежащих собственникам помещений в данном многоквартирном доме долей в праве общей собственности на общее имущество содержаться в реестрах собственников помещений в многоквартирном доме, которые обязаны вести управляющая организация, правление товарищества собственников жилья, жилищного или жилищно-строительного кооператива, иного специализированного потребительского кооператива (ч. 3.1 ст.45 ЖК РФ).

Некоторые примеры из судебных решений по вопросам определения доли собственника в общем имуществе в многоквартирном доме.

1. Собственники помещений в многоквартирном доме имеют право требования признания общей долевой собственности на общее имущество, зарегистрированное в реестре за одним лицом.  

«Если общим имуществом владеют собственники помещений в здании (например, владение общими лестницами, коридорами, холлами, доступ к использованию которых имеют собственники помещений в здании), однако право индивидуальной собственности на общее имущество зарегистрировано в реестре за одним лицом, собственники помещений в данном здании вправе требовать признания за собой права общей долевой собственности на общее имущество. Суд рассматривает это требование как аналогичное требованию собственника об устранении всяких нарушений его права, не соединенных с лишением владения (статья 304 ГК РФ)» – Постановление Пленума Высшего Арбитражного Суда РФ от 23 июля 2009 г. № 64 «О некоторых вопросах практики рассмотрения споров о правах собственников помещений на общее имущество здания»

2. Реконструкция объекта, изменяющая общую площадь помещений, расположенных в многоквартирном жилом доме, меняет размер долей в праве общей собственности на общее имущество других собственников жилых и нежилых помещений данного дома.

«В соответствии со статьями 36, 37 Жилищного кодекса Российской Федерации реконструкция объекта, в результате которой изменилась общая площадь помещения, принадлежащего истцу помещения, расположенного в многоквартирном жилом доме, влечет изменение размера долей в праве общей собственности на общее имущество в этом доме других собственников жилых и нежилых помещений данного дома» –Постановление Федерального арбитражного суда Поволжского округа от 4 июня 2009 г. №  А06-5228/2008

3. Жилищный кодекс РФ определяет доли в праве общей собственности на общее имущество в многоквартирном доме, а не реальная доля в материальном объекте.

«С учетом положений ст. 37 ЖК РФ, ст. 290 ГК РФ в установленном законом порядке подлежит определению доля в праве общей собственности на общее имущество в многоквартирном доме, но не реальная доля в материальном объекте» – Апелляционное определение СК по гражданским делам Московского областного суда от 15 июля 2015 г. по делу N 33-17061/2015

4. При определении доли каждого собственника в праве общей собственности на общее имущество не учитываются площади помещений, не являющиеся индивидуализированной собственностью, и площади помещений, входящих в состав общего имущества.

«При определении доли каждого собственника не учитываются площади помещений, не являющиеся индивидуализированной собственностью, и площади помещений, входящих в состав общего имущества; таким образом, при определении доли собственника следует исходить из площади помещения, принадлежащего собственнику, и совокупной площади всех жилых и нежилых помещений данного многоквартирного дома, зарегистрированных на праве собственности, с учетом данных реестра собственников помещений в доме» – Определение Московского городского суда от 17 мая 2017 г. N 4г-5145/17

5. Определение доли в праве общей собственности в коммунальной квартире осуществляется исходя из размеров комнаты, без учета иных помещений, которые находятся в индивидуальной собственности лица.

«Исходя из ч. 1 ст. 42 ЖК РФ доля в праве общей собственности в коммунальной квартире определяется исходя из размеров собственно комнаты, без учета иных помещений, которые находятся в индивидуальной собственности лица» – Апелляционное определение СК по гражданским делам Пермского краевого суда от 16 марта 2015 г. по делу N 33-2354/2015

Правомерна ли установка двери в квартирном холле?

Правомерна ли установка двери в квартирном холле?

07.08.19

Текст из материала газеты «Первая полоса» № 6 (111), июль 2019, «Спорные вопросы жилищного законодательства ― однозначные ответы».

Лестничные площадки и общедомовые коммуникации входят в состав общего имущества собственников помещений в многоквартирном доме (ч. 1 ст. 36 ЖК РФ, ст. 290 ГК РФ).

 

Право общей долевой собственности на общее имущество принадлежит собственникам помещений в здании в силу закона вне зависимости от его регистрации в Едином государственном реестре прав на недвижимое имущество и сделок с ним (ч. 1 ст. 37 ЖК РФ). Собственники помещений в многоквартирном доме владеют, пользуются и в установленных законодательством пределах распоряжаются общим имуществом в многоквартирном доме (ч. 2 ст. 36 ЖК РФ). Бремя расходов на содержание общего имущества в многоквартирном доме несут собственники помещений в нем, пропорционально принадлежащим им долям в праве общей собственности на общее имущество в таком доме (ст. 39 ЖК РФ).

Уменьшение размера общего имущества в многоквартирном доме возможно только с согласия всех собственников помещений в данном доме путем его реконструкции (ч. 3 ст. 36 ЖК РФ).

Если реконструкция, переустройство и (или) перепланировка помещений невозможны без присоединения к ним части общего имущества в многоквартирном доме, на такие реконструкцию, переустройство и (или) перепланировку помещений должно быть получено согласие всех собственников помещений в многоквартирном доме (ч. 2 ст. 40 ЖК РФ).

В соответствии с п. 10 Правил содержания общего имущества в многоквартирном доме, утвержденных Постановлением Правительства РФ от 13.08.2006 № 491, общее имущество должно содержаться в соответствии с требованиями законодательства РФ в состоянии, обеспечивающем соблюдение характеристик надежности и безопасности многоквартирного дома, безопасность для жизни и здоровья граждан, сохранность имущества физических или юридических лиц, государственного, муниципального и иного имущества.

Согласно п. 11 вышеуказанных Правил содержание общего имущества в зависимости от состава, конструктивных особенностей, степени физического износа и технического состояния общего имущества включает в себя в том числе меры пожарной безопасности в соответствии с законодательством Российской Федерации о пожарной безопасности.

Оборудование двери в квартирном холле нарушает п. 23 «к» Правил противопожарного режима в Российской Федерации, утвержденных Постановлением Правительства РФ от 25.04.2012 № 390 «О противопожарном режиме», которыми установлен запрет на устройство в лестничных клетках и поэтажных коридорах кладовых и других подсобных помещений, а также хранение под лестничными маршами и на лестничных площадках вещей, мебели и других горючих материалов.

Аналогичные выводы изложены в Апелляционном определении Омского областного обеспечива суда от 20.03.2019 по делу № 33-1583/2019; Апелляционном определении Новосибирского областного суда от 12.07.2018 по делу № 336684/2018.

Колесников Виктор Алексеевич,

юрист, генеральный директор ООО УК «ФЛЭТ» (Красноярск)

 

Первая часть статьи «Спорные вопросы жилищного законодательства ― однозначные ответы» ― Как происходит налогообложение жилищно-коммунальных услуг?

Вторая часть статьи «Спорные вопросы жилищного законодательства ― однозначные ответы» ― Оператор связи может безвозмездно использовать общее имущество МКД, даже заключив договор с абонентом, проживающим в доме?

Третья часть статьи «Спорные вопросы жилищного законодательства ― однозначные ответы» ― Кто и из каких средств должен нести расходы на организацию дворового освещения?

Наши материалы в социальных сетях:

Официальный портал муниципального образования 'Город Томск': Обращение

Кому: Администрация Ленинского района города Томска

Обращение (04/14/2016):
Я являюсь председателем Совета Дома по ул. К. Маркса 42. От лица жителей дома обращаюсь со следующими вопросами: 1. Включен ли наш дом в Региональную программу капитального ремонта? Если да, то на какой срок запланирован ремонт? Если нет, возможно ли провести инспекцию состояния дома с целью включения его в данную программу? Кроме того, хотелось бы узнать, каким годом датирована постройка нашего дома. 2. Возможен ли перенос транзитных труб из подвального помещения нашего дома, вызывающих у жителей массу неудобств? С уважением, Шильнов А.Г., председатель Совета Дома по адресу ул. К. Маркса 42

Ответ (05/06/2016):
Уважаемый Андрей Геннадьевич! На Ваше обращение в администрацию Ленинского района Города Томска по вопросу переноса транзитной теплотрассы из подвального помещения дома № 42 по ул. Карла Маркса сообщаем, что указанные транзитные тепловые сети (если они выполняют только транзитные функции) не могут быть отнесены к общему имуществу собственников помещений в многоквартирном доме, поскольку основным критерием отнесения того или иного объекта к общему имуществу собственников помещений в могоквартирном доме, является их предназначение для обслуживания более одного помещения в соответствующем многоквартирном доме (ч.1 ст.290 ГК РФ, ст.36 ЖК РФ). По информации ОАО «ТомскРТС», теплотрасса, проложенная через подвал дома № 42 по ул. Карла Маркса, является собственностью муниципального образования «Город Томск» и находится в оперативном управлении ОАО «ТомскРТС». При данных обстоятельствах собственник (владелец) транзитных тепловых сетей обязан нести бремя их содержания в соответствии со ст. 210 ГК РФ и нести ответственность за ущерб, причиненный 3-м лицам, в связи с его ненадлежащим содержанием в соответствии со ст.15, 210, 1064 ГК РФ. Ситуации с транзитными сетями довольно распространенное явление, поэтому собственникам помещений в доме, в котором имеются транзитные сети, следует предусмотреть соответствующие условия их эксплуатации в договоре с ресурсоснабжающей организацией. По решению собственников, управляющая компания ООО «Жилсервис «Ленинский» вправе заключить соглашение (договор) с ресурсоснабжающей организацией (РСО) о содержании или эксплуатации транзитных сетей, которые проходят через подвал дома. По такому соглашению (договору) управляющая компания ООО «Жилсервис «Ленинский» может на возмездной основе принять эксплуатационную ответственность за транзитные сети, трубопроводы, запорно-регулирующую арматуру на транзитных трубопроводах и тепловые узлы, расположенные, внутри подвального помещения, которое является общим имуществом собственников помещений в доме. В случае нежелания управляющей компании заключать соглашение об эксплуатационной ответственности, следует предусмотреть заключение соглашения с РСО о беспрепятственном доступе представителей РСО к транзитным объектам. В этом случае РСО будет нести ответственность за техническое состояние этих сетей и их исправность. В соответствии с ч. 3 ст. 44 ЖК РФ принятие решений о пользовании общим имуществом собственников помещений в многоквартирном доме иными лицами, в том числе о заключении договоров на установку и эксплуатацию рекламных конструкций, если для их установки и эксплуатации предполагается использовать общее имущество собственников помещений в многоквартирном доме относится к компетенции общего собрания собственников помещений в многоквартирном доме. Таким образом, для решения вопроса о перекладке теплотрассы в обход подвального помещения дома № 42 по ул. Карла Маркса жильцам указанного дома следует повторно обратиться с письменным заявлением в департамент городского хозяйства администрации Города Томска, приложив к заявлению решение собственников помещений в доме по этому вопросу, оформленное надлежащим образом протоколом общего собрания собственников. Департамент, в соответствии с положением о департаменте городского хозяйства администрации Города Томска, утвержденным решением Думы Города Томска от 25.04.2014 № 998, организует в границах муниципального образования «Город Томск» электро-, тепло-, газо-, водоснабжение населения, водоотведение, в пределах полномочий, установленных законодательством Российской Федерации (пп. 1, п. 11 Положения) и организует, в установленном действующим законодательством и муниципальными правовыми актами порядке, контроль за работами по ремонту и содержанию сетей и сооружений инженерно-технического обеспечения, гидротехнических сооружений, являющихся муниципальной собственностью (пп. 6, п. 11 Положения).

Собственники нежилых помещений и плата за содержание общего имущества в многоквартирном доме

Собственники нежилых помещений нередко отказываются платить за содержание и ремонт общего имущества многоквартирного дома. Это неправильная позиция, они должны оплачивать содержание и ремонт наравне с владельцами жилых помещений. Узнайте, почему.

Что делать УО, если собственник не платит долги за ЖКУ

Обязанность по оплате содержания и ремонта ОИ в МКД

Управляющие организации выставляют собственникам нежилых помещений счета за содержание и ремонт общего имущества многоквартирных домов. Собственники таких помещений отказываются оплачивать полученные платёжные документы, аргументируя это тем, что договорные отношения с УО у них отсутствуют.

В силу п. 2 ст. 8.1 ГК РФ право собственности на имущество, подлежащее государственной регистрации, возникает, изменяется и прекращается с момента внесения соответствующей записи в государственный реестр, если иное не установлено законом.

Собственник несёт бремя содержания принадлежащего ему имущества (ст. 210 ГК РФ).

Общее имущество в многоквартирном доме принадлежит собственникам помещений на праве общей долевой собственности, согласно п. 1 ч. 1 ст. 36 ЖК РФ. К общему имуществу МКД относятся помещения, не являющиеся частями квартир и предназначенные для обслуживания более одного помещения в таком доме:

  • межквартирные лестничные площадки;
  • лестницы;
  • лифты;
  • лифтовые и иные шахты;
  • коридоры;
  • технические этажи;
  • чердаки;
  • подвалы, в которых имеются инженерные коммуникации;
  • иное оборудование, обслуживающее более одного помещения.

Каждый участник общей долевой собственности обязан соразмерно со своей долей участвовать в уплате налогов, сборов и иных платежей по общему имуществу, а также в издержках по его содержанию и сохранению (ст. 249 ГК РФ).

Собственники помещений в МКД несут бремя расходов на содержание общего имущества в многоквартирном доме (ч. 1 ст. 39 ЖК РФ).

В соответствии с ч. 2 ст. 154 ЖК РФ плата за жилое помещение и коммунальные услуги собственника помещения в МКД включает в себя плату за услуги и работы по управлению таким домом, за содержание и текущий ремонт общего имущества в МКД, за коммунальные ресурсы, потребляемыепри использовании и содержании ОИ в МКД.

Обязанность собственника оплачивать расходы на содержание и ремонт не обусловлена наличием договорных отношений с управляющей организацией. Такой вывод можно найти в п. 24 Обзора судебной практики применения законодательства РФ о контрактной системе в сфере закупок товаров, работ, услуг  для обеспечения государственных и муниципальных нужд, утверждённого Президиумом Верховного Суда РФ от 28.06.2017.

В силу ч. 2.3 ст. 161 ЖК РФ и п. 10 постановления Правительства РФ от 13.08.2006 № 491, выполнение работ и оказание услуг по содержанию общего имущества многоквартирного дома является для управляющей организации обязательным в соответствии с законодательством РФ. УО не может отказаться от выполнения таких работ и оказания услуг даже в случае, когда не заключён государственный или муниципальный контракт.

То, что собственник нежилого помещения не предпринял действий по заключению контракта для исполнения обязанности по несению расходов на общее имущество, не освобождает его от обязанности вносить соответствующую плату.

Таким образом, собственник нежилого помещения, расположенного в многоквартирном доме, в силу прямого указания закона, обязан нести расходы на содержание общего имущества, если иное не предусмотрено законом или договором.

Взыскание долгов в сфере ЖКХ (часть I)

Взыскание задолженности у собственников нежилых помещений

Собственники нежилых помещений в многоквартирных домах обязаны оплачивать жилищно-коммунальные услуги по таким же правилам, что и собственники жилых помещений. Управляющая организация может требовать от собственника нежилого помещения своевременно вносить плату за содержание и ремонт общего имущества многоквартирного дома.

Если собственник нежилого помещения отказывается платить управляющей организации за содержание и ремонт общего имущества, сначала следует попытаться решить вопрос миром и объяснить собственнику нежилого помещения, почему за ним закреплена обязанность вносить плату за содержание и ремонт жилого помещения: отправлять долговые платёжки, письма или попытаться заключить соглашение о погашении задолженности.

Если собственник отказывается оплачивать счета, УО следует перейти к досудебному взысканию долгов: до подачи заявления в суд должнику нужно направить претензию с требованием оплатить задолженность в добровольном порядке. Согласно ч. 5 ст. 4 АПК РФ, должник обязан ответить на такую претензию в течение 30 календарных дней.

Если должник ответит отказом или вовсе не ответит на претензию, управляющая организация может обратиться с исковым заявлением в суд. Рассмотрением таких заявлений занимается Арбитражный суд. Но бывает, что споры доходят и до Верховного Суда РФ.

Пример такого спора приведён в определении ВС РФ от 28.11.2017 по делу № 305-ЭС17-10430. В нём суд указал на то, что управляющая организация может взыскать долг за содержание и ремонт общего имущества с собственника нежилого помещения.

Как поставить на учёт частичное погашение задолженности за ЖКУ

Выводы

Вносить плату за содержание и ремонт должны как собственники жилых помещений в многоквартирных домах, так и владельцы нежилых помещений. Размер такой платы устанавливается соразмерно доле участника общей долевой собственности на общее имущество МКД.

Незаключение договора между управляющей организацией и собственником жилого помещения не освобождает собственника от обязанности вносить плату за содержание и ремонт общего имущества в МКД.

Некоторые актуальные вопросы содержания общего имущества многоквартирных домов



Вопросы содержания и использования общедомового имущества многоквартирных домов вызывают интерес у большинства населения Российской Федерации, так как не малая часть проживает именно в многоквартирных домах. В данной статье рассматривается два взаимосвязанных темы: перечень объектов, относящихся к общему и имуществу многоквартирного дома и бремя расходов на содержание общедомового имущества.

Ключевые слова: общее имущество, дом, многоквартирный дом, общедомовое имущество, долевая собственность, общее имущество многоквартирных домов.

В настоящее время российское законодательство определяет многоквартирные дома как совокупность двух и более квартир, имеющих самостоятельные выходы либо на земельный участок, прилегающий к жилому дому, либо в помещения общего пользования в таком доме. Кроме того, такой дом содержит в себе не только жилые помещения, находящиеся в собственности, но и элементы общего имущества собственников помещений в этом доме. [1] Или как жилой дом, в котором квартиры имеют общие внеквартирные помещения и инженерные системы. [2] Проще говоря — это система жилых и нежилых помещений. Нежилые помещения представляют собой общее домовое имущество, которое находится в общей долевой собственности, и содержание, а также использования которого оказывают влияние на размеры плат собственников и на качество жизни граждан, проживающих в этих домах и их безопасность.

Действующее законодательство перечисляет состав такого имущества в разных нормативных правовых актах: статья 36 Жилищного Кодекса РФ, статья 290 Гражданского Кодекса РФ, однако в них не представлен полноценный перечень объектов общего имущества многоквартирного дома. [3]

Рассматриваемая норма становится дискуссионной, так как одни правоведы соглашаются с перечнем, приведенным в статье 36 ЖК РФ (в соответствии с которой включаются помещения не являющиеся частями квартир и предназначены для обслуживания более одного помещения в данном доме: лифты, лестницы, коридоры; крыши; санитарно-техническое, электрическое и другое оборудование; земельный участок, на котором расположен многоквартирный дом) [4], а другие представляют собственную классификацию объектов, основываясь на их предназначении и оборотоспособности.

Например, с точки зрения Кудиной С. А. необходимо выработать критерии в связи, с которыми имущество будет относиться к общедомовому, в противном случае просто расширение имеющегося перечня приведет еще к большей правовой путанице. Представляется, что в отсутствии критериев для разграничения общего имущества от иного невозможно определить круг вещей, для которых должен действовать режим долевой собственности. [5]

Согласимся с данной точкой зрения, так как основываясь на данных причинах и при анализе нормативных правовых актов, где содержится информация об элементах общего имущества, можно выделить следующие характерные признаки такого имущества:

  1. Общее имущество — это недвижимое и движимое имущество, которые являются неделимой частью многоквартирного дома

Логически рассуждая, приходим к следующему выводу: нельзя говорить о том, что если лифт является структурной частью дома, но при этом не относится к правовой дефиниции недвижимого имущества, то он считается отдельным объектом. Также, как и тепло-водоснабжение, инженерно-техническое оборудование. Представляется, что именно к таким случаям относится данный критерий, соответственно являясь элементом дома, он приобретает его черты. [3]

  1. Целевое назначение общего имущества — это удовлетворение потребностей всех собственников, при этом оно не имеет функционального назначения и не относится к какому-то одному собственнику.

Этот критерий трактуется Конституционным судом РФ как то, что право на общее имущество многоквартирного дома является производным от прав собственности на жилые помещения в данном доме (ст. 289 ГК РФ, ч.1 ст.36 ЖК РФ) и не подлежит отдельной государственной регистрации и отчуждение доли на общее имущество невозможно в силу указания ч.2 ст. 290 ГК РФ. [6]

Право долевой собственности — своего рода тоже проблемой, относящейся к бремени расходов на содержание общего имущества многоквартирного дома. В практике реально возможно освобождение от таких расходов в связи с признанием помещения автономным и относящимся к индивидуальной собственности.

В судебной практике встречаются две позиции, наиболее распространенной из которой ранее являлась та, что трактуется как «обязанность нести расходы на содержание общего имущества в многоквартирном доме вне зависимости от автономности объекта», однако 22 мая 2018 года Верховный Суд РФ в своем определении выделил признаки, по которым помещение может признаваться автономным и соответственно с собственника снимается обязанность по содержанию общего имущества многоквартирного дома. Это такие признаки, как: наличие собственной крыши и (или) собственных несущих стен, на которые опираются плиты перекрытий; наличие отдельных от дома системы отопления, водопровода, канализации, энергоснабжения, вентиляции и другие. [7]

После чего, Определением ВС РФ от 5 июня 2018 года было отказано управляющей компании в удовлетворении иска, так как помещение занимаемое, является встроенно-пристроенным нежилым помещением и предназначено для самостоятельного использования с отдельными входами и отдельной крышей. [8]

Следует сказать о том, что данные критерии противоречат другой позиции Верховного Суда РФ, речь о которой пойдет далее.

  1. Общее имущество принадлежит всем собственникам помещений многоквартирных домов.

Как уже ранее отмечалось, что право на общедомовое имущество многоквартирного дома является производным от прав собственности, соответственно невозможно приобрести право собственности на жилое помещение в данном доме, но не приобрести право долевой собственности на общее имущество.

Если имущество является общим, то это означает, что и бремя содержания распространяется на всех собственников жилых помещений — это закрепляется ч.1 ст. 39 Жилищного Кодекса РФ. В эту плату входит плата за капитальный ремонт и за содержание общего имущества, коммунальные ресурсы. Проблема же состоит в том, что нередки споры о взыскании задолженности по оплате услуг за обслуживание многоквартирных домов. Такие ситуации возникают по причине того, что собственники жилых помещений не изъявляют желания оплачивать расходы на содержание общего имущества наравне с остальными: в многоквартирном доме есть группы объектов одного целевого назначения, например, квартир и для квартир с повышенным уровнем комфорта нужно обеспечить доступ к дополнительным объектам общего имущества или же в доме находится автомойка. [9]

Несмотря на то, что постановлением Правительства РФ указывается, что размер платы устанавливается одинаковым для всех собственников помещений [10], а постановление Пленума Верховного Суда Российской Федерации от 27.06.2017 года № 22 «О некоторых вопросах рассмотрения судами споров по оплате коммунальных услуг и жилого помещения, занимаемого гражданами в многоквартирном доме по договору социального найма или принадлежащего им на праве собственности» указано, что собственники помещений обязаны нести бремя содержания общедомового имущества независимо от объема фактического использования [11], получается следующее: платят все одинаково, но потребляют по разному, то есть некоторые собственники находятся в более выходных условиях. И судебная практика допускает различные позиции к возможности установления разной платы. Думается, отсутствие единой позиции порождает еще больше вопросов и споров.

Ранее упоминалось нами о том, что на практике реально возможным является освобождение от бремени содержания общедомового имущества, если это имущество будет признано автономным. Действительно, Верховный Суд РФ назвал критерии в связи, с которыми объекты признаются автономными, но эти критерии вызывают сомнения, так как противоречат вышеупомянутой правовой позиции. Пермяков М. А. следующему выводу о том, что именно это противоречие тормозит выработку единой позиции и соответственно суды по-разному могут трактовать эти критерии, что будет приводить к неправильному применению норм материального и процессуального права. [9] Нельзя не согласиться с этим, данное замечание подтверждается судебной практикой. Следует учесть, что в любом случае суды при рассмотрении данной категории дел обращают внимание на автономность помещений:

Решением Богородского городского суда Нижегородской области от 4 июля 2017 иск управляющей компании о взыскании задолженности по содержанию общего имущества многоквартирного дома был оставлен без удовлетворения, отказывая в удовлетворении исковых требований суд первой инстанции пришел к выводу, что принадлежащее истцу на праве собственности нежилое помещение не находится в многоквартирном доме, поскольку не имеет общих стен, относящихся к общему имуществу многоквартирного дома, но уже 17 октября 2017 года Нижегородский областной суд в апелляционном определении указал, что согласно плану первого этажа многоквартирного дома, нежилое помещение не является самостоятельным сооружением, в материалах дела отсутствуют доказательства того, что пристрой имеет отдельные системы отопления, водоотведения канализации, и удовлетворил иск о взыскании задолженности по содержанию общего имущества многоквартирного дома. [12]

В поддержку дифференцированного подхода выступают многие правоведы, так предлагается дифференцированный подход для определения доли в праве общей собственности на общее имущество собственника помещения, который заключался бы в определении помещения входящим в состав общего имущества, а для такой идентификации необходимо иметь следующие сведения: сведения о месте нахождения каждого помещения, его характеристиках (размеры, функциональное назначение), о составе групп однородных объектов выделенного имущества, которые обслуживает конкретный объект общего имущества. [13]

Таким образом, целесообразнее действительно закрепить критерии признания объектов общедомовым имуществом и критерии признания объектов автономными для того, чтобы в целом избежать несправедливого взимания платы за содержание общедомового имущества с собственников жилых помещений.

Литература:

  1. Постановление Правительства РФ от 28.01.2006 № 47 (ред. от 27.07.2020) «Об утверждении Положения о признании помещения жилым помещением, жилого помещения непригодным для проживания, многоквартирного дома аварийным и подлежащим сносу или реконструкции, садового дома жилым домом и жилого дома садовым домом»// Российская газета. — 2006. — № 0.
  2. «Методическое пособие по содержанию и ремонту жилищного фонда. МДК 2–04.2004» (утв. Госстроем России) // Справочно-правовая система «КонсультантПлюс».
  3. Пашнина Ирина Валерьевна, Сафонов А. В. Общее имущество в многоквартирном доме // StudNet. 2020. № 2.
  4. Жилищный кодекс Российской Федерации: от 29 дек. 2004 г. № 188-ФЗ: [в ред. от 30.12.2020] // Российская газета. — 2005. — № 1.
  5. Кудина С. А. Понятие, признаки и состав общего имущества многоквартирного дома // Вестник УЮИ. 2017. № 2 (76).
  6. Постановление Конституционного Суда Российской Федерации от 10 ноября 2016 г. № 23-П // Собрание законодательства РФ. — 2016. — № 47. — Ст. 6724.
  7. Определение Верховного Суда РФ от 22.05.2018 № 305-ЭС18–5094 по делу N А40–116546/2016 // Справочно-правовая система «КонсультантПлюс».
  8. Определение Верховного Суда Российской Федерации от 05.06.2018 г. № 309-ЭС18–6191 // Справочно-правовая система «КонсультантПлюс».
  9. Пермяков Максим Андреевич. Бремя содержания общедомового имущества собственниками помещений в многоквартирном доме // Проблемы экономики и юридической практики. 2018. № 5.
  10. Постановление Правительства РФ от 13.08.2006 № 491 (ред. от 29.06.2020) «Об утверждении Правил содержания общего имущества в многоквартирном доме и правил изменения размера платы за содержание жилого помещения в случае оказания услуг и выполнения работ по управлению, содержанию и ремонту общего имущества в многоквартирном доме ненадлежащего качества и (или) с перерывами, превышающими установленную продолжительность» // Российская газета. — 2006. — № 0.
  11. Постановление Пленума Верховного Суда Российской Федерации от 27.06.2017 года № 22 «О некоторых вопросах рассмотрения судами споров по оплате коммунальных услуг и жилого помещения, занимаемого гражданами в многоквартирном доме по договору социального найма или принадлежащего им на праве собственности» // Российская газета. — 2017. — № 144.
  12. Апелляционное определение Нижегородского областного суда от 17.10.2017 по делу № 33–11889/2017 // Справочно-правовая система «КонсультантПлюс».
  13. Цуканова Е. Ю., Новикова Ю. В. Понятие и виды общего имущества в многоквартирном жилом доме. — 2017.

Основные термины (генерируются автоматически): общее имущество, дом, общедомовое имущество, многоквартирный дом, помещение, долевая собственность, Верховный Суд РФ, имущество, собственник помещений, судебная практика.

Общее имущество собственников квартир в многоквартирном доме

Юридическая энциклопедия МИП онлайн - задать вопрос юристу » Гражданское право - разделы » Собственность » Общее имущество собственников квартир в многоквартирном доме

Перечни имущества, которое находится в коллективной собственности, его обслуживание.

В ст. 290 Кодекса содержатся основополагающие нормативные положения касательно специфики общедомового имущества, принадлежащего владельцам квартир в многоквартирных домах. Далее мы рассмотрим, что понимают под коллективным имуществом в таких домах, как появляется общедолевая собственность на данное имущество, а также некоторые другие аспекты.

Понятие общего имущества в МКД

Помимо непосредственно жилых помещений, владельцы квартир, находящихся в МКД, обладают имущественным правом на объекты коллективного имущества. Понятие определяется исходя из специфики такого имущества и его правового положения.

Объединение имущества, которое не относится к жилью в МКД, но находится в собственности различных лиц

Сам факт того, что физическое лицо получает имущественное право на жилое помещение в МКД, свидетельствует о том, что у данного гражданина уже возникает право на общедомовые объекты инфраструктуры.

Другими словами, субъект гражданских отношений не осуществляет волеизъявления, а получает данное право в силу установленных юридических фактов. Волеизъявление субъекта существует лишь в отношении непосредственно жилого помещения, которое приобретается гражданином, но в силу того, что существование квартиры отдельно от остальной инфраструктуры коллективного пользования невозможно в принципе, рассмотрение общедомового и внутриквартирного имущества стоит осуществлять в объединении.

Пользование и распоряжение общедомовым имуществом может осуществляться по взаимному согласию владельцев квартир в МКД. При возникновении споров и разногласий касательно пользования общедомовыми объектами инфраструктуры вопросы могут быть решены в порядке судебного слушания.

Перечни имущества, которое находится в коллективной собственности, его обслуживание

Действующие ранее и имеющие силу на настоящий момент законодательные акты устанавливали различные перечни общедомового имущества, которое находится в собственности у жителей МКД.

В настоящее время два нормативных документа регламентируют перечень общедомового имущества, которое находится в коллективной долевой собственности у жильцов МКД:

  • ст. 36 ЖК РФ;
  • ст. 290 ГК РФ.

ГК РФ регламентирует объекты коллективного пользования, которые принадлежат владельцам жилых помещений в МКД наряду с их непосредственно занимаемыми площадями для целей личного проживания:

  • общедомовые помещения;
  • несущие конструктивные элементы МКД;
  • техническое, электрическое и прочее оборудование и агрегаты, находящиеся внутри или за пределами квартиры.

Несколько расширенный список общедомового имущества находит определение в ЖК РФ:

  • помещения в МКД, имеющие целевое назначение по обслуживанию более одной квартиры, а именно:
    - o лестничные площадки;
    - o лифтовое оборудование;
    - o коридорные помещения;
    - o этажи технического назначения;
    - o подвалы и чердаки.
  • прочие помещения, которые не принадлежат на праве собственности кому-либо из владельцев квартир в МКД, предназначенные для целей удовлетворения различных потребностей жителей, в том числе для организации досуга, культурно-массовых мероприятий, занятий физкультурой и спортом и др.;
  • крыши, несущие и ненесущие конструктивные элементы МКД;
  • участок земли, на котором расположен МКД, в том числе совместно с зелеными насаждениями и прочими элементами благоустройства придомовой территории.

Появление общедолевой собственности на общедомовые объекты инфраструктуры

И в ГК РФ, и в ЖК РФ определяется норма о появлении общей долевой собственности на объекты коллективного пользования у владельцев квартир в МКД. Изначально в Законе об основах федеральной жилищной политики (в настоящее время утратил силу) указывалось на возможность использования в таких случаях как долевой, так и совместной собственности.

Тем не менее, использование долевой собственности более предпочтительно в таких случаях, чем совместной, что и было принято во внимание законодателем. Так, при использовании совместной собственности вместо долевой продажи квартир были бы затруднительны в силу факторов:

  • необходимости определения доли на общедомовое имущество;
  • дальнейшего отчуждения квартиры вместе с этой долей;
  • необходимости новому собственнику после приобретения жилого помещения в МКД объединять свою часть объектов общедомового имущества с остальными.

Критерий, в силу которого осуществляют определение доли в составе общедолевой собственности

Доля на объекты общедомового имущества определяется исходя из совокупной площади занимаемого собственником жилого помещения. Определение доли производится пропорционально площади квартиры, находящейся в собственности.

Другими словами, чем больше площадь жилого помещения, чем большая доля из состава общедомового имущества причитается владельцу квартиры в МКД.

Значение общедомового собрания и процесса его проведения с точки зрения права

Ст. 44 ЖК РФ содержит в себе положение о том, каким значением с точки зрения права располагает общее собрание собственников помещений в многоквартирном доме.

Общее собрание собственников помещений в многоквартирном доме – это орган, решающий управленческие вопросы посредством обсуждения и утверждения решений.

Компетенция, которой располагает общее собрание собственников помещений в многоквартирном доме касательно обсуждения и утверждения нижеследующих решений:

  • о реконструкции МКД;
  • о границах использования участка земли, на котором располагается МКД, и ввод ограничений на пользование данным участком;
  • о выборе метода формирования фонда капремонта;
  • о передаче в пользование общедомового имущества другим лицам;
  • о выборе метода осуществления управления МКД;
  • прочие вопросы.

Ст. 45 ЖК РФ также гласит о некоторых правовых особенностях, на основе которых должно происходить общее собрание собственников помещений в многоквартирном доме:

  • проведение требуется как минимум один раз в 12 месяцев;
  • помимо обязательного ежегодного любой владелец квартиры в МКД имеет право высказать инициативу о реализации внеочередного;
  • общее собрание собственников помещений в многоквартирном доме будет действительным, если в таковом участвовали собственники, владеющие более чем 1/2 голосов от их совокупного числа;
  • вопросы могут решаться только в отношении заявленных ранее, таким образом, любое отклонение от не включенных в повестку дня вопросов будет рассматриваться как неправомочное.

Результатом осуществления любого собрания, в том числе и внеочередного, является протокол. Порядок оформления и удостоверения данного документа регламентируется общедомовым собранием.

Управомоченное лицо (к примеру, председательствующий совета МКД) обязано довести до сведения всех владельцев жилых площадей в МКД о вопросах, решенных в результате общедомового собрания, не позже 10 календарных дней с момента решения соответствующих вопросов повестки дня.

Автор статьи

Кузнецов Федор Николаевич

Опыт работы в юридической сфере более 15 лет; Специализация - разрешение семейных споров, наследство, сделки с имуществом, споры о правах потребителей, уголовные дела, арбитражные процессы.

Перенос гена

CEP290 спасает клеточный фенотип врожденного амавроза Лебера

Abstract

Мутации в CEP290 являются наиболее частой причиной врожденного амавроза Лебера (LCA), тяжелого наследственного дегенеративного заболевания сетчатки, от которого в настоящее время нет лечения. Аутосомно-рецессивный CEP290 -ассоциированный LCA является хорошим кандидатом для генной заместительной терапии, а клетки, полученные от пораженных людей, дают исследователям возможность изучать болезни человека и терапевтическую коррекцию гена in vitro .Здесь мы сообщаем о разработке лентивирусных векторов, несущих полноразмерный CEP290 с целью коррекции специфического для заболевания фенотипа CEP290 в клетках человека. Был сконструирован лентивирусный вектор, содержащий управляемый ЦМВ человеческий полноразмерный CEP290 . После трансдукции клеток-предшественников фоторецепторов, специфичных для пациента, полученных из ИПСК, анализ ОТ-ПЦР и вестерн-блоттинг выявили экспрессию, производную от вектора. Поскольку CEP290 играет важную роль в цилиогенезе, была исследована способность культур фибробластов от CEP290 -ассоциированных пациентов с LCA формировать реснички.В культурах, полученных от этих пациентов, меньше клеток образовывало реснички по сравнению с непораженными контрольными клетками. Образовавшиеся реснички были короче в клетках, полученных от пациента, чем в клетках, полученных от здоровых людей. Важно отметить, что лентивирусная доставка CEP290 спасала дефект цилиогенеза. Успешное создание и вирусный перенос полноразмерного CEP290 приближает нас к цели предоставления генной и клеточной терапии для пациентов, страдающих этой распространенной формой LCA.

Ключевые слова: Перенос генов, Стволовые клетки пациента, LCA

Введение

Врожденный амавроз Лебера (LCA) - термин, используемый для обозначения группы тяжелых наследственных заболеваний сетчатки, характеризующихся плохим зрением в течение первого года жизни. , нистагм и незаписываемая электроретинограмма 1 . LCA почти всегда наследуется по аутосомно-рецессивному типу, и около 30% пациентов с LCA имеют мутации в гене CEP290 , что делает его наиболее частым фактором 2,3 .CEP290 представляет собой центросомный белок, который локализован в соединительной ресничке фоторецепторов 4,5 и участвует как в цилиогенезе, так и в перемещении ресничек 6-9 . Пациенты с CEP290 -ассоциированной LCA сохраняют некоторые ядра колбочек в центральной фовеальной области, богатой конусами. Однако эти фоторецепторы колбочек имеют аномальные внутренние и внешние сегменты, что приводит к серьезной потере зрения у большинства пациентов 10,11 . Исследования МРТ продемонстрировали, что анатомия внутричерепных зрительных путей пациентов с CEP290 -ассоциированными LCA нормальна, что позволяет предположить, что лечение на основе генов и / или клеток может восстановить зрение 10 , если терапия может быть проведена в достаточно раннем возрасте, чтобы таламический и корковый центры все еще были способны интерпретировать информацию, передаваемую от ганглиозных клеток сетчатки.

Очень обнадеживающим в последнем отношении является улучшение зрения, которое наблюдалось у ряда субъектов, включенных в клинические испытания опосредованной аденоассоциированным вирусом (AAV) генной терапии для RPE65 -ассоциированного LCA 12-14 . Хотя, несомненно, можно будет разработать какой-либо эффективный подход к переносу гена для лечения LCA, ассоциированного с CEP290 , размер CEP290 не позволяет использовать систему векторов AAV для упаковки полноразмерного гена.Таким образом, использование лентивируса (который имеет больший предел упаковки - 8-10 т.п.н. по сравнению с 4,7 т.п.н. 15 ) будет выгодным, поскольку он может вместить полноразмерную кДНК CEP290 (7972 нт). Более того, лентивирусные векторы могут трансдуктировать клетки многих типов в глазу, включая фоторецепторы 16,17 , которые являются клетками сетчатки, наиболее подверженными мутациям CEP290 .

Технологии на основе индуцированных плюрипотентных стволовых клеток (ИПСК) теперь предоставляют исследователям возможность моделировать и изучать болезни человека и оценивать различные терапевтические методы in vitro .Недавно мы смогли продемонстрировать, что трансплантация полученных из ИПСК клеток-предшественников фоторецепторов, полученных от нормальных мышей, восстанавливает структуру и функцию сетчатки на мышиной модели дегенеративного заболевания сетчатки 18 . Мы также использовали специфичные для пациента клетки-предшественники сетчатки, полученные из ИПСК, для исследования патофизиологии аутосомно-рецессивного пигментного ретинита (RP), вызванного мутациями в MAK и USh3A 19,20 . Вместе эти исследования иллюстрируют полезность технологии ИПСК для исследования патофизиологических механизмов, участвующих в наследственных заболеваниях сетчатки, и закладывают основу для исследования in vitro стратегий замены генов для лечения этих заболеваний.

Здесь мы описываем разработку лентивирусного вектора, экспрессирующего полноразмерный человеческий CEP290, и демонстрируем его способность восстанавливать дефект цилиогенеза, наблюдаемый в фибробластах, полученных от пациента. Кроме того, мы сообщаем о создании и характеристике ИПСК от мышей и людей, пораженных CEP290 -ассоциированной LCA, а также о последующей дифференцировке и характеристике предшественников фоторецепторов. Наконец, мы демонстрируем перенос гена в клетки-предшественники фоторецепторов, происходящие от ИПСК, с использованием этого вектора.

Результаты

Полноразмерный человеческий

CEP290 упакован в лентивирусный вектор

CDS CEP290 слишком велик (~ 8 КБ) для упаковки в систему AAV, которая успешно использовалась для лечения RPE65 -ассоциированных LCA 12,13,21 . Однако лентивирус имеет гораздо больший предел упаковки (8-10 т.п.н.) и способен эффективно трансдуктировать постмитотические клетки сетчатки 15 . Поэтому мы создали кассетную плазмиду лентивирусного трансгена, несущую кодирующую последовательность CEP290 , управляемую промотором цитомегаловируса (CMV) ( ).При упаковке (LV-CMV-hCEP290) титр был определен как минимум 1 × 10 8 единиц трансдукции на миллилитр (ЕД / мл). Используя аналогичную конструкцию с промоторным элементом фактора элонгации 1 альфа ( EF1a ) (1190 п.н. против 585 п.н.), мы не смогли получить титры выше 5 × 10 6 ТЕ / мл - слишком низкие для использования в последующем гене. перенос экспериментов. Эти результаты согласуются с ранее опубликованными исследованиями, предполагающими, что для лентивирусов по мере увеличения размера плазмиды эффективность вирусной упаковки снижается 22 .Таким образом, полноразмерная кодирующая последовательность CEP290 дикого типа в сочетании с промотором CMV, по-видимому, имеет предельный размер для эффективной упаковки лентивируса.

Упаковка лентивируса и экспрессия полноразмерной кассеты с лентивирусным трансгеном CEP290

( a ). LTR - длинный терминальный повтор; cPPT - центральный полипуриновый тракт; CMV - промотор цитомегаловируса; wPRE - посттранскрипционный регуляторный элемент сурка. (b ) ОТ-ПЦР в трансдуцированных LV-hCEP290 клетках JK1 выявляет дозозависимое увеличение экспрессии трансгена.( c – g ) Фазоконтрастные изображения клеток JK1 либо нетрансдуцированных ( c ), либо трансдуцированных с помощью LV-CEP290 с MOI 1 ( d ), 2 ( e ) и 5 ​​( f ) ) или LV-GFP при MOI 5 ( г, , вкладка, показывающая экспрессию GFP). ( h-i ) Анализ жизнеспособности клеток пропидия иодида (PI) нетрансдуцированных клеток ( h ) и клеток, трансдуцированных LV-CEP290 при MOI 5 ( i ). ( j ) гистограмма, отображающая жизнеспособность клеток.Шкала шкалы = 400 мкМ.

Чтобы продемонстрировать опосредованную вектором экспрессию CEP290 , мы сначала трансдуцировали линию мышиных клеток, JK1, при увеличивающейся множественности инфекции (MOI). Наблюдали дозозависимое увеличение транскрипта CEP290 человека, как определено с помощью ОТ-ПЦР ( ). Через 5 дней после трансдукции заметное снижение жизнеспособности клеток было очевидным для культур, трансдуцированных при MOI 5: были обнаружены слипание, морфологические изменения и гибель ( ).Поскольку слипание не происходило в культурах, трансдуцированных равными количествами лентивирусного вектора, экспрессирующего GFP ( ), мы предположили, что сверхэкспрессия продукта гена CEP290 цитотоксична. Для более точной оценки цитотоксичности, индуцированной трансдукцией, были выполнены анализы жизнеспособности клеток ( ). Через 5 дней после трансдукции в культурах, трансдуцированных полноразмерным CEP290 с MOI 2, было обнаружено небольшое увеличение количества клеток, трансдуцированных с помощью йодида пропидия, дальнейшее статистически значимое увеличение было обнаружено в культурах, трансдуцированных с MOI 5, по сравнению как с нетрансдуцированным, так и с трансдуцированным GFP (MOI 5) контролем ( ).Не было обнаружено значительного увеличения гибели клеток в культурах, трансдуцированных при MOI, равном 1. Таким образом, последующие эксперименты были выполнены таким образом, чтобы прогнозируемая доза CEP290 была ниже расчетного уровня цитотоксичности. Дополнительные контрольные трансдукции с идентичным лентивирусным вектором, экспрессирующим неродственные белки (мультицистронные факторы транскрипции OCT4, SOX2, KLF4 и cMYC), не дали различий в жизнеспособности клеток при MOI 5 по сравнению с нетрансдуцированными клетками (, дополнительный рис.S1 ). В совокупности эти данные показывают, что, хотя мы смогли успешно упаковать и экспрессировать полноразмерный CEP290 через лентивирусную векторную систему, сверхэкспрессия этого гена цитотоксична.

Лентивирусный вектор, экспрессирующий человеческий

CEP290 , трансдуцирует происходящие из ИПСК предшественники фоторецепторов

. Для проверки способности описанного выше вектора переноса лентивирусного гена трансдуктировать типы клеток, релевантные для обработки in vivo CEP290, ассоциированной с LCA, Сначала нам нужно было получить специфические для пациента плюрипотентные стволовые клетки и использовать их для получения специфичных для пациента предшественников фоторецепторов.Для начала кожные фибробласты, выделенные от мышей (BXD24 / TyJ-Cep290 rd16 / J мышь 4 ) и людей с известными болезнетворными мутациями в CEP290 , были нацелены на генерацию ИПСК посредством принудительной экспрессии транскрипции. факторы OCT4 (POU5F1), SOX2, KLF4 и cMYC 23 . Приблизительно через три недели после трансдукции плотно упакованные колонии клеток с большим соотношением ядра и цитоплазмы (типичное для ИПСК) были идентифицированы как в мышиной ( ), так и в человеческой культуре ( ).После расширения экспрессия транскриптов плюрипотентности NANOG, OCT4, KLF4, LIN28A, и DNMT1 была подтверждена с помощью rt-PCR ( ).

Поколение ИПСК

( a , b ) Изображения светлого поля (10x) колоний ИПСК rd16 ( a ) и пациента B294 ( b ). ( c , d ) ОТ-ПЦР-анализ экспрессии маркера плюрипотентности в ИПСК мыши ( c ) и B294 ( d ). ( e - h ) Изображения H & E (10X) rd16 ( e и f ) и B294 ( g и h ) тератом, полученных из ИПСК, содержащих энтодерму (стрелка), мезодерму (звездочка) и эктодерма (наконечник стрелы).( i - n ) Иммуногистохимия мышей ( i - k ) и человека ( l - n ) тератомы ИПСК: энтодерма ( i и l ), мезодерма ( j и m ), и эктодерма ( k и n ). ИПСК - индуцированные плюрипотентные стволовые клетки, GFAP - глиальный фибриллярный кислый белок. Изображения собраны с 10-кратным объективом.

Для оценки способности ИПСК мышей и пациентов дифференцироваться в ткани, специфичные для каждого из трех зародышевых листков эмбриона, мы использовали анализы образования тератомы у мышей с ослабленным иммунитетом.Через четыре недели после инъекции мышиных ИПСК и через восемь недель после инъекции ИПСК, специфичных для пациента, тератомы были резецированы и оценены гистологически. Окрашивание парафиновых срезов гемотоксилином и эозином выявило наличие тканей, специфичных для каждого из трех зародышевых листков зародыша в мышиных ( ) и специфичных для пациента ( , пациент B294) тератомах, происходящих от ИПСК. Аналогичным образом, иммуноокрашивание антителами, направленными против эндодермального маркера альфа-фетопротеина ( , мышь и человек, соответственно), мезодермального маркера гладкомышечного актина ( ) и эктодермального маркера глиального фибриллярно-кислого белка ( ) указывает на образование тканей. специфичен для каждого из трех зародышевых листков эмбриона в тератомах, происходящих от ИПСК мыши и человека.

Для получения фоторецепторных клеток-предшественников (PRPCs) мы использовали наш ранее описанный протокол ступенчатой ​​дифференцировки 19,24 . Через 33 дня (мышь) или 90 дней (человек) в культуре мы оценили транскрипты маркеров клеток сетчатки с помощью ОТ-ПЦР. И мышиные, и человеческие дифференцированные культуры экспрессировали транскрипты CRX , RHO , OPSN1SW , RCVRN и ROM1 ( , мыши и человека, соответственно). Более того, маркеры клеток сетчатки OTX2 и OPSN1SW экспрессировались как в мышиных ( ), так и в человеческих ( ) дифференцированных культурах, на что указывает иммунофлуоресценция.Чтобы дополнительно продемонстрировать, что дифференцированные человеческие CEP290 специфичные для пациента клетки принимают судьбу нервной эктодермы / фоторецепторных клеток, иммуноцитохимический анализ, нацеленный на маркер фоторецепторных клеток рековерин, мезодермальные маркеры, актин гладких мышц (α-SMA) и миозин, и эндодермальный маркер α-фетопротеин (энтодермальный маркер). В то время как области нейральной дифференциации (то есть нервные розетки) были интенсивно положительными по восстановлению ( дополнительный рис. S2A ), ни α-SMA ( дополнительный рис.S2B ), миозин ( дополнительный рисунок. S2C ), ни α-фетопротеин ( дополнительный рисунок. S2C ) не могут быть обнаружены.

Генерирование предшественников фоторецепторов на основе ИПСК

(a-b ) ОТ-ПЦР в rd16 ( a ) и B294 ( b ) предшественниках фоторецепторов, полученных от ИПСК, через 31 и 90 дней, соответственно, после дифференцировки. ( cf ) Иммуноцитохимический анализ 31-дневных культур rd16 ( c и d ) и 90-дневных культур B294 ( e и f ) показывает экспрессию маркеров сетчатки OTX2 ( c и d ) и опсина колбочек ( d. и f ).

Чтобы продемонстрировать опосредованную вектором экспрессию CEP290 в типе клеток, релевантных заболеванию, мы сначала трансдуцировали PRPC, полученные из ИПСК, от мышей rd16 с помощью LV-CMV-hCEP290. Через одну неделю после трансдукции мы оценили присутствие транскрипта CEP290 , полученного из вектора, путем амплификации части транскрипта, кодирующего удаленный в rd16 домен (DRD) 25 . Транскрипт DRD не обнаруживался в необработанных культурах, но был амплифицирован из клеток, трансдуцированных лентивирусным вектором ( ), демонстрируя, что экспрессия трансгена CEP290 может осуществляться в PRPC, полученных из iPSC из модели мыши rd16.

Лентивирус, экспрессирующий полноразмерный CEP290, трансдуцирует культуры предшественников фоторецепторов

( a ) ОТ-ПЦР (в двух экземплярах) культур предшественников фоторецепторов rd16, трансдуцированных LV-hCEP290, при множественности инфекции (MOI) 1 и 2 ( b ) ОТ-ПЦР в клетках-предшественниках фоторецепторов из B294 и B062, трансдуцированных LV-CEP290. ( c ) Вестерн-блот клеток-предшественников фоторецепторов из B294, трансдуцированных LV-CEP290. Untx - непереведенный; G - GFP-трансдуцированный лентивирус / отрицательный контроль; LV - трансдуцированный лентивирус CEP290; 1 и 2 - биологические копии; NT - без шаблона; П - плазмида / положительный контроль; М - маркер.

Затем мы попытались подтвердить лентивирусную трансдукцию и экспрессию CEP290 дикого типа в PRPC, происходящих от iPSC, от пациентов-людей с молекулярно подтвержденным LCA, ассоциированным с CEP290 . Культуры от двух пациентов были трансдуцированы на 90-й день протокола дифференцировки с помощью LV-CMV-hCEP290. Через неделю после трансдукции мы оценили экспрессию трансгена с помощью ОТ-ПЦР. Чтобы различать эндогенный транскрипт и транскрипт, полученный из вектора, мы использовали праймеры, комплементарные 3 ’конца транскрипта и нижележащему элементу WPRE, который не присутствует в эндогенном транскриптоме человека.Как и в случае с мышиными клетками, мы смогли обнаружить опосредованный вектором транскрипт в культурах, трансдуцированных LV-CMV-hCEP290, но не в нетрансдуцированных контрольных культурах ( ). Вестерн-блоттинг с антителом против CEP290 продемонстрировал, что в отличие от нетрансдуцированных культур PRPC, трансдуцированные LV-CMV-hCEP290, экспрессировали полноразмерный белок CEP290 (на что указывает наличие полосы 290 кДа как в лизатах сетчатки, так и в лизатах трансдуцированных клеток, ). ). Взятые вместе, эти результаты указывают на возможность упаковки большого трансгена CEP290 в лентивирусные векторы и использования этих векторов для трансдукции полученных из ИПСК клеток-предшественников фоторецепторов, пораженных CEP290 -ассоциированной LCA.

Опосредованное лентивирусами

CEP290 Добавление гена спасает дефект цилиогенеза в дермальных фибробластах, полученных от пациентов с LCA

CEP290 играет критическую роль в формировании первичных ресничек и транспорте цилиарных белков 6,7,26 . Нокдаун эксперименты на клетках hTERT-RPE показали, что потеря CEP290 ингибирует образование первичных ресничек 26 . Для исследования фенотипа цилиогенеза в специфичных для пациента клетках LCA фибробласты от четырех пациентов с различными генотипами CEP290 и здорового контрольного индивидуума культивировали в бессывороточных условиях.Первичные реснички и базальные тельца были обнаружены с помощью иммуноцитохимического окрашивания антителами, направленными против ацетилированного тубулина (который маркирует аксонемы первичных ресничек) и гамма-тубулина (который маркирует базальные тела первичных ресничек), соответственно ( ). Подсчет клеток на конфокальных изображениях выявил значительно меньше клеток с ресничками в культурах пациентов с LCA B054 (34,1% ± 3,0%), B062 (41,6% ± 3,7%) и B620 (50,5% ± 3,6%) по сравнению с таковыми из здорового контроля. индивидуальный (WT - 64.4% ± 3,2%) ( ). Хотя клетки, выделенные от пациента B294, продуцировали меньше ресничек (56,7% ± 3,6%), чем клетки, выделенные от здорового человека, это различие не достигло статистической значимости. Гамма-тубулин-положительные базальные тельца без аксонемы или низкорослые / дисморфные аксонемы часто выявлялись в специфичных для пациента клетках ( , наконечники стрелок и вкладки с большим увеличением).

CEP290 Мутации вызывают дефект цилиогенеза

( a-e ) Иммуноцитохимический анализ культур человеческих фибробластов, выделенных у здорового контрольного индивидуума ( a ) и 4 пациентов с CEP290, ассоциированным с LCA ( be ).Базальные тельца были обнаружены с анти-гамма тубулином (красный), первичные реснички с антиацетилированным тубулином (зеленый; вставки) и ядра с DAPI (синий). Изображения были собраны с помощью 100-кратного высокопроизводительного объектива. ( f ) Столбцы представляют собой процент клеток, положительных по ацетилированному тубулину. Планки погрешностей представляют стандартную ошибку (n ≥ 6 культур). ** p <0,01, *** p <0,001, **** p <0,0001. Контрольный индивидуум без WT, B054 - пациент с гомозиготными мутациями IVS26, B062 - пациент с мутацией IVS26 и мутацией сдвига рамки Val247del1gT, B294 пациенты с мутацией IVS26 и мутацией сдвига рамки Thr833 del2acAG, B620 - пациент с мутацией IVS26 и мутацией сдвига рамки 6277delG.

Чтобы определить, спасет ли замена гена CEP290 специфический для болезни фенотип цилиогенеза, были нацелены культуры фибробластов B054, B062 и B620 (образцы со статистически значимыми дефектами цилиогенеза). Культуры фибробластов трансдуцировали LV-CMV-hCEP290. Как указано выше, трансдуцированные культуры подвергали голоданию по сыворотке для индукции образования первичных ресничек. Процент мерцательных клеток в трансдуцированных культурах B054 (, , 34,1% ± 3,0% и 50.2% ± 3,6% соответственно) и B620 ( , 50,5 ± 3,6% и 60,7 ± 2,8% соответственно) значительно увеличились по сравнению с нетрансдуцированными клетками от тех же людей ( , p <0,01 и p <0,05. , соответственно). Более того, процент клеток, образующих реснички в трансдуцированных культурах B620, больше не отличался значительно от такового в неповрежденном контроле. Хотя трансдукция B062 увеличивала процент клеток, образующих ресничку, по сравнению с нетрансдуцированным контролем B062 (48.7% ± 3,4% против 41,6% ± 3,7% соответственно), разница не была статистически значимой (данные не показаны).

Добавление гена CEP290 устраняет дефект цилиогенеза

( ad ) Иммуноцитохимический анализ культур фибробластов человека, выделенных от пациента B054 ( a, b ) и пациента B620 ( c, d ) либо без лечения ( a и c ) или трансдуцированный лентивирусным вектором, экспрессирующим полноразмерный CEP290 с MOI 2 ( b и d ).Базальные тельца были обнаружены с помощью анти-гамма-тубулина (красный), а первичные реснички - с помощью анти-ацетилированного тубулина (зеленый). Ядра окрашивали DAPI (синий). Изображения были собраны с помощью 100-кратного высокопроизводительного объектива. ( e ) Графическое изображение процента клеток с ресничками в каждой культуре. Планки погрешностей представляют стандартную ошибку (n ≥ 6 культур). ( f ) Графическое изображение длины ресничек в каждой культуре (n ≥ 100 клеток). * p <0,05, ** p <0,01, *** p <0.001. MOI - множественность заражения. DAPI - 4 ’, 6-диамидино-2-фенилиндол.

Для дальнейшего тестирования эффективности нашей стратегии переноса генов была проведена длина первичных ресничек, как до, так и после трансдукции линий B054 и B620 (первичные реснички измеряли от основания, на базальном теле, до кончик аксонемы). Как показано в , когда измеряли длину ресничек, трансдуцированные культуры демонстрировали значительно более длинные реснички, чем их нетрансдуцированные аналоги.Кроме того, длина первичных ресничек после трансдукции существенно не отличалась от длины непораженного контроля. Взятые вместе, эти результаты демонстрируют, что опосредованное лентивирусами добавление полноразмерного CEP290 способно спасти фенотип аномального цилиогенеза в клетках пациентов с CEP290 -ассоциированной LCA.

Обсуждение

Восстановление зрения у пациентов с RPE65 -ассоциированным врожденным амаврозом Лебера с помощью генной заместительной терапии 12,13,21 стало обнадеживающей вехой для всех пациентов с наследственным заболеванием сетчатки.Однако многие наследственные заболевания сетчатки представляют собой две дополнительные проблемы: 1) ген, который слишком велик для упаковки в AAV, и 2) продукт гена, кодирующий структурный белок, который для правильного функционирования должен экспрессироваться в соответствующей пропорции с другими компонентами. CEP290 -ассоциированная LCA является таким заболеванием. Кодирующая последовательность CEP290 имеет длину ~ 8 т.п.н., что исключает использование AAV в качестве носителя для лечения полноразмерной кДНК. Кроме того, известно, что CEP290 физически взаимодействует с многочисленными компонентами в переходной зоне первичных ресничек 6,25-27 .Таким образом, можно было бы разумно ожидать найти - как мы это сделали в этом исследовании - что благоприятный ответ на замену гена CEP290 будет происходить только в довольно узком диапазоне экспрессии гена.

Мы воспользовались относительно большой упаковочной способностью лентивируса [8-10 kb 15 ], а также его способностью стабильно трансдуцировать постмитотические клетки сетчатки, чтобы разработать вирусный вектор, способный доставлять полноразмерный Кодирующая последовательность CEP290 как для специфичных для пациента фибробластов, так и для PRPC, производных от ИПСК.Хотя мы смогли продемонстрировать опосредованную вектором экспрессию мРНК CEP290 в клетках JK1, трансдуцированных высокими концентрациями вектора, эти клетки проявляли низкую жизнеспособность по сравнению с клетками, трансдуцированными с равной MOI вектора, экспрессирующего GFP, что позволяет предположить, что произошла гибель клеток. в результате сверхэкспрессии CEP290 . Следует отметить, что мы также наблюдали токсичность у мышей, у которых др. Ассоциированный с ресничками белок, BBS1, был сверхэкспрессирован 28 . Наши наблюдения согласуются с предыдущими исследованиями, которые показали, что фоторецепторы чувствительны к уровню экспрессии трансгена.Напр., При кислород-индуцированной ретинопатии сверхэкспрессия трансмембранных белков клаудина приводит к неправильной локализации в цитозольный компартмент и неоваскуляризации 29 . Сходным образом пятикратная сверхэкспрессия аллеля родопсина человека у мышей вызывает дегенерацию фоторецепторов, аналогичную той, которая обнаруживается при пигментном ретините 30 . Tan et al. Также сообщили о зависимом от дозы родопсине дегенеративном фенотипе у трансгенных мышей 31 .

Kim и др. Сообщили, что клетки hTERT-RPE1 неспособны формировать реснички, когда CEP290 истощается посредством siRNA 26 .Более того, модель мыши rd16 для CEP290 -ассоциированная LCA лишена образования первичных ресничек 7 . Таким образом, мы предположили, что пациенты с мутациями в CEP290 будут демонстрировать дефект цилиогенеза. Действительно, лишенные сыворотки фибробласты от трех из четырех пациентов с LCA образовывали значительно меньше и короче первичных ресничек, чем у здоровых контрольных индивидуумов. Важно отметить, что, когда мы обрабатывали эти клетки LV-CMV-hCEP290, мы спасли как количество клеток, образующих реснички, так и длину ресничек у двух из трех протестированных пациентов, подчеркнув тот факт, что разные генотипы и генетический фон могут приводить к разным результатам. уровни клеточной патологии.В настоящее время механизм, с помощью которого различные комбинации аллелей болезней вносят вклад в фенотип (ы) LCA, не полностью изучен. Однако Drivas и др. Недавно идентифицировали функциональные домены в CEP290, которые вносят вклад в связывание мембран и микротрубочек, а также в цилиогенез 7 . Один из аллелей пациента B062 выражает мутацию усечения в N-концевом домене. Полученный белок лишен С-концевого домена связывания микротрубочек [аминокислоты 1695-1966 7 ] и связан с нарушением образования ресничек в этих клетках in vitro .Эти наблюдения согласуются с предыдущими результатами модели rd16 на мышах, предполагающими потребность в этом домене для образования и поддержания первичных ресничек в фоторецепторах 4,7 . Хотя доставка полноразмерных CEP290 имела тенденцию к восстановлению цилиогенеза у этого пациента, количество ресничек не увеличивалось значительно в обработанных клетках. Возможно, в патогенезе заболевания играют роль другие факторы. Действительно, вариации генов MKKS и BBS , как сообщалось, модифицируют фенотип CEP290 32,33 .Тем не менее, демонстрация восстановления цилиогенеза является важным шагом в лечении этих и других пациентов с CEP290 -ассоциированной LCA. При культивировании клеток-предшественников фоторецепторов in vitro образование ресничек трудно оценить. Ацетилированные тубулин-положительные структуры могут быть идентифицированы в плотно упакованных нервных розетках 20 , однако проследить эти структуры до клетки происхождения проблематично. Т.о., трансплантация скорректированных клеток-предшественников фоторецепторов будет важным будущим исследованием для определения функционального спасения этих клеток, поскольку полное созревание и образование ресничек действительно происходит после трансплантации.

Хотя тщательное титрование LV-CMV-hCEP290 позволило нам избежать побочных эффектов сверхэкспрессии трансгена in vitro , манипуляции с титром вируса сами по себе могут оказаться непрактичными для клинических применений. Вероятно, потребуется доставить очень определенное количество белка CEP290 к конкретному типу клеток, например к фоторецепторам. Этого можно достичь, используя эндогенный промотор CEP290 для управления экспрессией кДНК CEP290 . Однако для многих генов, таких как CEP290 , эндогенные промоторные элементы еще не идентифицированы.Таким образом, разработка подхода к переносу гена, в котором трансген управляется под контролем его нативного промотора, потребует дальнейшего исследования. Альтернативный подход, который позволил бы лечить на основе переноса генов широкий спектр дегенеративных заболеваний сетчатки, заключался бы в разработке библиотеки синтетических промоторов, каждый из которых был бы способен к очень специфическому уровню экспрессии трансгена в конкретном типе клеток сетчатки.

Мы прогнозируем, что эффективность любого подхода генной терапии для лечения LCA, ассоциированного с CEP290 , также будет сильно зависеть как от тяжести генотипов пациентов, так и от степени потери фоторецепторных клеток во время лечения. .У некоторых пациентов фовеальные колбочки сохраняются в зрелом возрасте 10,34 , и этих колбочек достаточно, чтобы поддерживать хорошее зрение. Другим кажется, что эти клетки никогда не функционируют, хотя их можно увидеть с помощью оптической когерентной томографии (например, пациент 1 10 ). Для последних может быть полезной доставка CEP290 полной длины непосредственно к фовеальным конусам.

Хотя лентивирус является эффективной векторной системой для упаковки кДНК размером до 8 т.п.н., для генов размером более CEP290 потребуется другая векторная система.Однако может оказаться возможным адаптировать дизайн кассеты трансгена в текущем исследовании к другим векторным системам, чтобы обеспечить эффективное конструирование конструкций, которые превышают пределы упаковки лентивируса и AAV с широким спектром промоторов. Например, векторная система вируса простого герпеса может содержать вставки размером до ~ 150 т.п.н. 35 и может легко преобразовывать делящиеся и постмитотические типы клеток, не вызывая иммунологического ответа 36,37 .

Лентивирус интегрируется в геномную ДНК трансдуцированных клеток и, таким образом, имеет потенциал для инсерционного мутагенеза 38 .Это не так важно при терапии сетчатки, чем при лечении клеток других органов или кроветворной системы, потому что сетчатку можно легко исследовать с микроскопическим разрешением после лечения. Если обнаруживается, что какие-либо трансдуцированные клетки демонстрируют аномальный рост, они могут быть уничтожены с помощью лазерной фотокоагуляции или криотерапии без вреда для остальной части глаза. Более того, продолжающееся развитие технологий глубокого секвенирования позволит оценить безопасность конкретных конструкций путем изучения распределения векторной интеграции по всему геному 39-41 .

Трудности, связанные с большим размером груза, необходимостью точной экспрессии генов и опасения, связанные с инсерционным мутагенезом, могут быть преодолены, если технологии редактирования генома могут быть усовершенствованы. Эффекторные нуклеазы, подобные активатору транскрипции (TALEN) 42,43 и регулярно чередующиеся кластерные короткие палиндромные повторы (CRISPR) 44,45 , могут быть сконструированы для прямой коррекции генов в определенных участках генома и могут оказаться полезными для из . vivo генная коррекция, а также ex vivo коррекция ИПСК 46-48 перед трансплантацией в больные ткани.

Таким образом, мы показали, что лентивирусная конструкция способна трансдуктировать как мышиные, так и человеческие клетки с полноразмерной кДНК CEP290 , и что эта трансдукция приводит к экспрессии полноразмерного транскрипта и функциональному восстановлению дефекта цилиогенеза у пациента. клетки. Хотя эта работа приближает нас на один шаг к генным и клеточным методам лечения CEP290 -ассоциированной LCA, стратегии для обеспечения надлежащего уровня экспрессии CEP290 в обработанных клетках все еще должны быть разработаны, прежде чем распространять эту работу на пациентов-людей.

Материалы и методы

Пациенты

Все пациенты предоставили письменное информированное согласие на участие в этом исследовании, которое было одобрено институциональным наблюдательным советом Университета Айовы (одобрение проекта № 200202022) и придерживалось принципов, изложенных в Декларации. Хельсинки. Пациент B054 является носителем двух аллелей с наиболее частой мутацией, IVS26 c.2991 + 1655 A> G (IVS26). Пациент B062 несет IVS26 c.2991 + 1655 A> G на одном аллеле и делецию одной пары оснований в кодирующей последовательности в положении аминокислоты 247 (Val247 del1gT) на другом аллеле.Пациент B294 также несет две гетерозиготные мутации в локусе CEP290 . Один аллель несет мутацию IVS26, другой аллель несет делецию двух пар оснований в кодирующей последовательности в положении аминокислоты 835 (Thr835 del2acAG). Пациент B620 несет мутацию IVS26 на одном аллеле CEP290 и интронную делецию нуклеотида 6277 (6277delG).

Культура клеток

Мы решили протестировать векторную токсичность на легко размножающейся фибробластоподобной клеточной линии JK1, поскольку количество фибробластов у пациентов ограничено.Кроме того, дифференцирующиеся культуры клеток-предшественников фоторецепторов демонстрируют апоптоз, индуцированный дифференцировкой, что затрудняет проведение убедительных анализов клеточной гибели. Клетки JK1 (Cell Biolabs) и фибробласты пациентов культивировали в полной среде [MEMα (Life Technologies), содержащей 10% фетальной бычьей сыворотки (Life Technologies) и 0,2% Primocin ™ (Invivogen)].

Лентивирусная трансдукция

Клетки JK1 (Cell Biolabs, Сан-Диего, Калифорния) трансдуцировали лентивирусом, экспрессирующим человеческий CEP290 при множественности инфицирования 1, 2 и 5 в присутствии полибрена (Sigma-Aldrich, St.Луис, Миссури) в течение шести часов в MEMα (Life Technologies). Дифференцированные культуры-предшественники фоторецепторов трансдуцировали 1 × 10 5 или 2 × 10 5 единиц трансдукции. После трансдукции клетки культивировали в полной среде в течение пяти дней.

Характеристика экспрессии

CEP290
rt-PCR

Тотальную РНК выделяли и амплифицировали, как описано выше, с использованием прямого праймера GCAATGAGCGACTTTTCATCAGAC и обратного праймера ACAACACCACGGAATTGTCAGTGC. POLR2A транскриптов амплифицировали в качестве внутреннего контроля (таблицы S1 и S2).

Иммуноблоттинг

Сетчатка человека была получена из Iowa Lions Eye Bank после информированного согласия ближайших родственников донора и подготовлена ​​для иммуноблоттинга, как описано ранее 19 . Дифференцированные культуры клеток-предшественников фоторецепторов человека от пациента B294 на 60 день трансдуцировали 2 × 10 5 TU LV-CMV-CEP290. Контрольные культуры оставались нетрансдуцированными.Через одну неделю после трансдукции клетки обрабатывали 0,25% трипсином-ЭДТА (Gibco), гомогенизировали в буфере для лизиса [50 мМ трис-HCl, pH 7,6, 150 мМ NaCl, 10 мМ CaCl 2 , 1% тритон X-100, 0,02% NaN 3 , (Sigma Aldrich)] и центрифугировали. Концентрации белка в супернатанте определяли с помощью BCA в соответствии с инструкциями производителя (Pierce, Rockford, IL). По пятьдесят микрограммов каждый подвергали SDS-PAGE (4-20% акриламида), переносили в PVDF и зондировали анти-человеческим CEP290 (Abcam, Кембридж, Англия; 1: 1000).Блоты визуализировали с помощью реагентов ECL (GE Healthcare Life Sciences, Питтсбург, Пенсильвания) и экспонировали на рентгеновской пленке (Fisher Scientific, Питтсбург, Пенсильвания).

Количественная оценка гибели клеток

клеток JK1 высевали с плотностью 2,5 × 10 5 клеток на лунку. Через шестнадцать часов после посева клетки трансдуцировали вектором VSVG-LV-CMV-hCEP290 при MOI 1, 2 или 5. Контрольные культуры трансдуцировали при MOI 5 с помощью VSVG-LV-CMVGFP или оставляли без обработки. Через пять дней после трансдукции клетки диссоциировали с помощью 0.05% трипсин-ЭДТА (Life Technologies) и гибель клеток определяли количественно с помощью набора Tali® Apoptosis Kit - Annexin V Alexa Fluor® 488 и пропидия йодида (Life Technologies) и цитометра Tali® Image-based (Life Technologies) в соответствии с инструкциями производителя. .

iPSC generation

За животными, использованными в этих исследованиях, ухаживали в соответствии с Комитетом по уходу и использованию институциональных животных (Университет Айовы, Айова-Сити, Айова; разрешение № 130815). Дермальные фибробласты мыши от BXD24 / TyJ-Cep290 rd16 / J мыши 4 (The Jackson Laboratory, Bar Harbor, ME) и человеческие дермальные фибробласты от пациентов с LCA с мутациями в CEP290 были перепрограммированы посредством вирусной трансдукции факторы транскрипции OCT4, SOX2, KLF4 и cMYC, как описано ранее 19,24 .Колонии ИПСК, полученные из Rd16, культивировали в плюрипотентной среде [(DMEM / F12; Life Technologies), 15% инактивированной нагреванием фетальной телячьей сыворотке (Lifeblood Medical Inc., Адельфия, Нью-Джерси), 0,0008% -меркаптоэтаноле (Sigma-Aldrich), 1X заменимые аминокислоты (NEAA; Life Technologies), 1 × 10 6 единиц / л фактора ингибирования лейкемии (LIF; Millipore, Billerica, MA), 0,2% Primocin ™ (Invivogen)] на планшетах с покрытием Matrigel ™ (BD Biosciences , Франклин Лейкс, Нью-Джерси). ИПСК LCA человека культивировали в среде mTser1 на планшетах с покрытием Corning® Synthemax ™ (Corning, Inc.).

Характеристика ИПСК

rt-PCR

Общую РНК выделяли из ИПСК пассажа 10 с использованием набора RNeasy Mini (Qiagen, Germantown, MD) в соответствии с инструкциями производителя. Сто нанограмм РНК-матрицы амплифицировали в одностадийных реакциях ОТ-ПЦР с использованием системы одностадийной ОТ-ПЦР Superscript III (Life Technologies) с праймерами, гибридизирующимися с NANOG, OCT4, KLF4, DNMT1, и LIN82A транскрипты мыши (таблица S1) или человека (таблица S2).

Образование тератом

Мышей с тяжелым комбинированным иммунодефицитом (SCID; Jackson Laboratories) использовали для оценки способности ИПСК образовывать тератомы, содержащие ткани всех трех зародышевых листков. Приблизительно 2 × 10 6 клеток ресуспендировали в 100 мкл забуференного физиологического раствора Хэнка (HBSS; Life Technologies) и вводили внутримышечно в заднюю конечность хозяев SCID. Через 6-8 недель после инъекции опухоли резецировали и анализировали на наличие тканей эктодермального, мезодермального и энтодермального происхождения.

Гистология

Тератомы фиксировали в 10% формалине, заливали парафином, делали срезы и окрашивали гемотоксилином и эозином с использованием стандартных протоколов.

Иммуноцитохимия

Срезы тератомы депарафинизировали, фиксировали в 4% параформальдегиде и окрашивали антителами против альфа-фетопротеина (R&D Systems, Миннеаполис, Миннесота; 1: 100), глиального фибриллярного кислого белка (GFAP; Life Technologies ; 1: 100) и актин гладких мышц (Abcam; 1: 100).Слайды закрывали, как описано выше, и отображали на флуоресцентном микроскопе EVOS (Life Technologies).

Дифференцировка ИПСК

ИПСК Rd16 и LCA культивировали на планшетах с ультранизким связыванием (Corning Life Sciences, Тьюксбери, Массачусетс) в среде для образования эмбриоидных тел [DMEM F-12 (Life Technologies), замена 10% нокаутной сыворотки (Life Technologies), 2% добавка B27 (Life Technologies), 1% N2 добавка (Life Technologies), 1% L-глутамин (Life Technologies), 1X NEAA (Life Technologies), 0.2% Primocin ™ (Invivogen), 1 нг / мл Dkk-1 (R&D Systems), 1 нг / мл IGF-1 (R&D Systems), 1 нг / мл Noggin (R&D Systems) и 0,5 нг / мл bFGF (R&D Systems) )] на 4-5 дней. Эмбриоидные тельца (200-300 на лунку) высевали на 6-луночные планшеты (Corning), покрытые коллагеном (BD Bioscience, Сан-Хосе, Калифорния; 25 мкг / мл), ламинином (Life Technologies; 50 мкг / мл) и фибронектином. (Sigma-Aldrich; 100 мкг / мл) и культивировали в среде дифференцировки 1 [DMEM F-12 (Life Technologies), 2% добавка B27 (Life Technologies), 1% добавка N2 (Life Technologies), 1% L-глутамин ( Life Technologies), 1X NEAA (Life Technologies), 0.2% Primocin ™ (Invivogen), 10 нг / мл Dkk-1 (R&D Systems), 10 нг / мл IGF-1 (R&D Systems), 10 нг / мл Noggin (R&D Systems) и 5 ​​нг / мл bFGF (R&D Systems) )]. Эмбриоидные тельца дифференцировались в течение десяти дней, а затем в течение шести дней в среде для дифференциации два [(среда для дифференциации один плюс 10 мкМ DAPT (Calbiochem, Gibbstown, NJ)] и еще 12 дней культивирования в среде дифференцировки три [(среда для дифференциации два плюс 2 нг / мл aFGF (R&D Systems)]. Предшественники фоторецепторов человека культивировали еще 60 дней в среде дифференцировки 4 [DMEM F-12 (Life Technologies), 2% добавка B27 (Life Technologies), 1% добавка N2 (Life Technologies), 1% LGlutamine (Life Technologies), 1X NEAA (Life Technologies), 0.2% Primocin ™ (Инвивоген)].

Характеристика дифференцировки

rt-PCR

Общая РНК была выделена и амплифицирована, как описано выше, с использованием праймеров, гибридизующихся с транскриптами OTX2, OPSN1SW, и ROM1 (таблица S3).

Иммуноцитохимия

Клетки-предшественники фоторецепторов, полученные из ИПСК из модели мыши rd16, были зафиксированы, окрашены и визуализированы, как описано выше, с антителами, нацеленными против Otx2 (R&D Systems; 1: 100) и Opsn1sw (EMD Millipore, Billerca, MA ; 1: 100).Клетки пациентов с LCA окрашивали антителами, направленными против OTX2 (EMD Millipore; 1: 100) и OPSN1SW (EMD Millipore; 1: 100).

Цилиогенез в культурах фибробластов пациентов

Фибробласты от четырех пациентов (B054, B062, B294 и B620) и здорового контрольного индивидуума культивировали на предметных стеклах камеры, покрытых коллагеном, в бессывороточных условиях [MEMα (Life Technologies), 2% в / в Primocin (Life Technologies)] на 72 часа. Клетки фиксировали в 4% параформальдегиде и метаноле и окрашивали антителами, направленными против ацетилированного тубулина (1: 200, Sigma-Aldrich) и гамма-тубулина (Sigma-Aldrich; 1: 1000).Слайды закрывали монтажной средой на основе поли (винилового спирта) (PVA), содержащей 1,4-диазабицикло [2.2.2] октан (DABCO) (100 мкг / мл PVA, Sigma-Aldrich; 25% об. / Об. Глицерина, Sigma -Aldrich; 0,1 М трис-HCl, pH 8-8,5, 25 мкг / мл DABCO, Sigma-Aldrich) и 4 ', 6-диамидино-2-фенилиндол дигидрохлорид (DAPI) (Sigma-Aldrich; 1: 10 000).

Восстановление цилиогенеза в культурах фибробластов пациентов

Фибробласты пациентов B054, B062, B294 и B620 были трансдуцированы лентивирусом, экспрессирующим CEP290 , при множественности инфицирования 2 в присутствии полибрена (Sigma-Aldrich) в течение шести часов в MEMα (Life Technologies) и культивировали в полной среде в течение шести дней.Пять тысяч трансдуцированных клеток пассировали в каждую лунку покрытых коллагеном 16-луночных камерных слайдов. На следующий день клетки культивировали в бессывороточных условиях [MEMα (Life Technologies), 0,2% Primocin ™ (Life Technologies)] в течение 72 часов. Клетки фиксировали и окрашивали на ацетилированный тубулин и гамма-тубулин, как указано выше.

Конфокальный микроскопический анализ цилиогенеза

После цилиогенеза и маркировки антителами фибробластов пациента слайды были закодированы, чтобы исключить любую систематическую ошибку в эксперименте.Клетки и реснички были визуализированы, а затем подсчитаны двумя людьми, оба из которых были замаскированы для идентичности групп лечения. Изображение ресничек получали с помощью конфокального микроскопа Leica DM 2500 SPE (Leica Microsystems, Wetzlar, Германия). Поля клеток были обнаружены с использованием DAPI с последующей визуализацией каналов ацетилированного и гамма-тубулина. Первичные реснички считали как удлиненные или пунктированные ацетилированные тубулин-положительные структуры, локализованные в ядрах или непосредственно в перинуклеарных.

Количественная оценка длины ресничек

Реснички визуализировали с помощью конфокальной микроскопии, как описано выше, с использованием высокопроизводительного объектива 63X.Реснички измеряли с использованием программного обеспечения Leica LAS-AF, версия 3.2.0 (Leica Microsystems). Вкратце, изображения были увеличены и реснички (n ≥ 100) были измерены с использованием инструмента масштабной линейки, указанного для объектива 63X. Были измерены реснички с четкой маркировкой гамма-тубулина (базальное тело) у основания и ацетилированного тубулина (аксонема), отходящего от базального тела.

Статистический анализ

Попарная значимость определялась с использованием двустороннего t-критерия в программе GraphPad Prism. Р ≤ 0.05 считалось значительным. Точки данных, лежащие за пределами 1,5-кратного межквартильного размаха, были исключены из анализа.

Теория всего. Теория всего 290 гк рф комментариев

Новая редакция ст. 290 ГК РФ

1. Собственники квартир в многоквартирном доме владеют на правах долевой собственности общими помещениями дома, несущими конструкциями дома, механическим, электрическим, санитарно-техническим и другим оборудованием снаружи или внутри квартиры. , обслуживающая более одной квартиры.

2. Собственник квартиры не вправе отчуждать принадлежащую ему долю в общем имуществе жилого дома, а также совершать иные действия, влекущие за собой передачу этой доли отдельно от права собственности на квартиру.

Комментарий к Ст. 290 ГК РФ

1. Спецификация объектов, входящих в общую собственность собственников квартир в многоквартирном доме, содержится в ст. 36 ЖК.

2. В ст. 37 ЖК уточняет, что доля в общей собственности конкретного собственника помещения пропорциональна размеру общей площади занимаемого им помещения, а также установлено, что доля в общей собственности определяется судьбой право собственности на указанное помещение.

3. Правовая природа доли в собственности общего имущества дома. Общая собственность многоквартирного дома принадлежит собственникам квартир на праве общей долевой собственности в силу прямого указания в п.1 комментируемой статьи (этот же термин используется в статьях 36 - 39 ТК. ).Однако такая долевая собственность существенно отличается от общей категории долевой собственности в гл. 16 ГК. В отношении доли в общей собственности дома ст. Изобразительное искусство. 246, 250, 252 ГК.

Смысл использования структуры долевой собственности в отношениях, возникающих из-за общего имущества дома, заключается в том, что собственники квартир несут пропорционально распределенное бремя затрат на содержание общего имущества (статья 39 ТК).

Другой комментарий к ст.290 ГК РФ

1. В отношении перечисленного в п. 1 комментируемой статьи общего имущества в многоквартирном доме установлен режим долевой долевой собственности собственников квартир (о праве долевой долевой собственности см. Комментарий к статьям 244 - 252). В этом пункте подчеркивается, что это имущество может располагаться как внутри квартиры, так и за ее пределами, но оно должно обслуживать более одной квартиры. Особенность этой недвижимости в том, что ее нельзя использовать как жилое помещение.

Расходы на содержание общего имущества распределяются между всеми совладельцами долями, определяемыми соотношением принадлежащих им площадей. Не имеет значения, использовалось ли это свойство на самом деле. Таким образом, жильцы первого или второго этажа могут вообще не пользоваться лифтом, но должны нести расходы по его содержанию.

2. В п. 2 ст. 290 установлено правило, согласно которому соответствующая доля в собственности на общую собственность жилого дома следует за судьбой собственности на квартиру, будучи с ней неразрывно связана.Таким образом, доля в праве на общую собственность не имеет самостоятельного юридического значения. Из этого следует, что доля в праве собственности не может самостоятельно обращаться, т. Е. Быть предметом договоров купли-продажи, обмена, дарения и т. Д. Владелец доли также не вправе требовать ее разделения в натуре ( см. комментарий к статье 252) и, соответственно, право требовать выплаты компенсации, если разделить ее в натуре невозможно. Кроме того, доля в праве общей собственности на такое имущество не влечет за собой преимущественного права покупки (см. Комментарий к статье 250).

В вашем браузере нельзя использовать JavaScript.
Разрешите JavaScript, иначе многие функции сайта будут вам недоступны.

1. Собственники квартир в многоквартирном доме владеют на праве долевой собственности общими помещениями дома, несущими конструкциями дома, механическим, электрическим, санитарно-техническим и другим оборудованием снаружи или внутри квартиры, обслуживает более одной квартиры.
2. Собственник квартиры не вправе отчуждать принадлежащую ему долю в общем имуществе жилого дома, а также совершать иные действия, влекущие передачу этой доли отдельно от права собственности на квартиру

ком.Литовкин В.Н.

1. Под жилым помещением в статье 288, как и в последующих нормах данной главы, мы понимаем помещение, завершенное строительством и введенное в эксплуатацию в соответствии с установленным порядком (см. Комментарий к данной главе), при условии соблюдения кадастровый и технический учет (инвентаризация). Незавершенное строительство жилого дома законом не относится к недвижимости, поэтому нормы главы не распространяются на отношения с такими объектами (при этом согласно статье 455 Кодекса (см. Комментарии к п. 2 статьи 455) и Указ Президента Российской Федерации от 16 мая 1997 г.485 «О гарантиях собственникам объектов недвижимости при приобретении в собственность земельных участков под этими объектами» - см. Комментарий к главе 17 - объекты незавершенного строительства включены в гражданский оборот как объекты недвижимости).
GC в соответствии с Законом о приватизации жилищного фонда индивидуально определенные жилые помещения признаются недвижимыми объектами имущественных прав правообладателей. В нежилых домах, а также в недостроенных жилых домах право собственности на часть здания (недостроенный жилой дом) еще идеально выражено (арифметически) - 1/2, 1/3, 1/4 и т. Д.закон в характере конкретного объекта части здания (дома) как объекта вещного права. Это отличие жилой площади от нежилой (недостроенного жилого дома) имеет принципиальное значение в правоприменительной практике.
2. Жилые помещения и имущественные права на них подлежат государственной регистрации (см. Комментарии к ст. ,,), а также налагаются обременения (ограничения) на них и сделки с названными объектами. Правоустанавливающими документами на жилое помещение могут быть акты государственных органов и акты органов самоуправления, судебные решения, договоры и другие сделки.Таким образом, кондоминиум как единый комплекс недвижимого имущества, а также права на недвижимое имущество в кондоминиуме и сделки с ним подлежат государственной регистрации с предоставлением паспорта собственности на жилище, составленного бюро технической инвентаризации на основании физических измерений и информации от компетентных органов. Датой государственной регистрации возникновения, ограничения (обременения), перехода или прекращения прав является день внесения соответствующих записей в Единый государственный реестр прав на недвижимое имущество и сделок с ним.
Лицо, не оформившее право на жилой дом, квартиру, комнату соответственно в органах государственной регистрации, не признается правообладателем. Но не лишен возможности оформить госрегистрацию недвижимости. Нотариально засвидетельствованная сделка не заменяет государственную регистрацию. Право собственности на названные объекты возникает с момента государственной регистрации.
3. К имущественным правам на эти объекты недвижимости относятся также оформленные надлежащим образом право хозяйственного ведения и право оперативного управления, осуществляемые государственными и муниципальными юридическими лицами (комментарий ст., А также). Нахождение жилища только на балансе субъекта вещных прав не является достаточным основанием в судебной и арбитражной практике для признания его правообладателем (Ведомости Высшего Арбитражного Суда РФ, 1996, № 10 , стр.42).
В общей совместной собственности супругов не имеет значения, на имя какого из супругов зарегистрировано жилище (ст. 34 Семейного кодекса ). Семья представляет собой стабильное сообщество людей, разделяющих жилплощадь на различных юридических основаниях.Общая собственность членов семьи на жилище остается многосубъектной. Семья не образует нового коллективного, независимого, единого субъекта права на занимаемое жилое пространство (см. Комментарии к главе 16). Остальные члены семьи, не являющиеся совладельцами жилища, наделены только правом пользования (см. Комментарии к статье 292). Если семья станет еще одним независимым субъектом прав и обязанностей, то каждый из ее членов соответственно утратит правосубъектность или получит права в той мере, в какой это решит семья.
Право пользования занимаемым жилым помещением для членов семьи возникает не по соглашению с собственником, а исключительно на основании доверительных семейных связей с собственником (совладельцами) жилища. Это полностью самостоятельная, хотя и производная, основа для возникновения реальных, а не обязательственных прав, отношений, связанных с объектом собственности - собственник (совладельцы) и все другие лица обязаны воздерживаться от действий, нарушающих их права. использовать жилую площадь (см. прим.к пункту 3 статьи 393). Хотя это право не названо в пункте 1 статьи 216 среди других имущественных прав наряду с правом собственности, именно его характер формирует его имущественный характер. Перечень прав собственности, содержащийся в статье 216, не является исчерпывающим, исчерпывающим.
4. Владение, пользование и распоряжение - традиционная для собственника (субъекта вещных прав) триада полномочий - осуществляется им в равной степени в отношении любого из вышеперечисленных объектов собственности (вещных прав), независимо от того, в какой форме собственность, которой принадлежит жилище.Собственник не теряет объема полномочий даже в случае его объединения с другими собственниками других помещений в многоквартирном доме в товарищество собственников жилья (см. Комментарии к статье 291). Члены этого товарищества продолжают осуществлять полномочия собственников помещений, находящихся в частной, государственной, муниципальной или иных формах собственности в соответствии с нормами гражданского права. Товарищество собственников жилья в своем уставе вправе разумно ограничивать только цели использования нежилых помещений в кондоминиуме, принадлежащих его участникам, и только если это связано с защитой прав и интересов других участников товарищества. (Статья 42, см. Комментарий.к статье 246).
Закон РФ от 24 декабря 1992 г. «Об основах федеральной жилищной политики» (ст. 6), уточняя правовые возможности собственника, указывает, в частности, на возможность в этом случае перехода от одной формы собственности другому лицу, сдавать в аренду, сдавать в аренду, закладывать (см. также комментарии к главе 17), продавать, видоизменять, перестраивать или сносить, выполнять другие действия, если это не нарушает нормы права, жилищные, другие права и свободы других граждан, общественные интересы (см. комментарий к статье 209).
Принудительная конфискация имущества у любого собственника не допускается, за исключением случаев, предусмотренных статьей 235 (см. Комментарий к статье). Конституция (статья 35), закрепляя гарантии защиты частной собственности законом и возможность лишения собственности только по решению суда, распространяет их как на сферу гражданско-правовых отношений, так и на отношения между государством и человеком в в сфере публичного права (см. Постановление Конституционного Суда РФ от 20 мая 1997 г. - СЗ РФ, 1997 г., №21, статья 2542). В этой главе статьи 293 (см. Комментарии) устанавливается особый случай принудительного избавления от неумелого содержания жилища.
Товарищество собственников жилья, не нарушая прав каждого из них, вправе владеть своими помещениями в зданиях (кондоминиуме), а в случаях, когда это не связано с нарушением прав и интересов участников товарищества, охраняемые законом, предоставлять в пользование или ограниченное пользование (сервитут) объекты общей собственности любому лицу или лицам; застраивать, перестраивать, с сносом или без сноса, объекты общей собственности; получать или приобретать в собственность земельные участки для жилья, строительства хозяйственных и иных построек, осуществлять строительство на прилегающих и выделенных земельных участках; совершать действия и заключать сделки, отвечающие целям и задачам товарищества (статья 29 Закона о товариществах собственников жилья ).Товарищество отвечает по своим обязательствам всем принадлежащим ему имуществом и не отвечает по обязательствам своих участников.
5. В административной деятельности субъектов таких имущественных прав, как право хозяйственного ведения и оперативного управления, есть особенности в отношении всех объектов недвижимости, в том числе жилищного фонда, находящегося на балансе государственных и муниципальных юридических лиц ( см. комментарии к пункту 2 статьи 295, пункту 1 статьи 297, пункту 1 статьи 298).
Также следует иметь в виду особенности распоряжения ведомственным жилым фондом, переданным в хозяйственное ведение или оперативное управление правопреемникам государственных и муниципальных предприятий, которые в результате их приватизации перешли в иную форму. права собственности, что предусмотрено Законом о приватизации жилья (статья 18), или находится в юрисдикции органов местного самоуправления.
Норма закона, предусматривавшая передачу жилых домов в хозяйственное ведение или оперативное управление негосударственным структурам, вступила в противоречие с Гражданским кодексом (см. Комментарий к ст.,,), поскольку такого рода права собственности негосударственным структурам не принадлежат (если дома переданы им). Передача домов во временное владение до момента полного разграничения федеральной и муниципальной собственности возможна только на договорных условиях. См. Также Указ Президента РФ от 10 января 1993 г. «Об использовании объектов социально-культурного и коммунального назначения приватизируемых предприятий» - ЦА РФ, 1993 г., № 3, ст. 168.
6.Единый порядок местной администрации по занятию жилых помещений в жилых домах всех государственных форм собственности (государственной, муниципальной), а также общественной, введенный Жилищным кодексом (статья 47) и подтвержденный Законом об основах Жилищной политики (статья 13) с целью контроля за осуществлением административной деятельности субъекта собственности и иных имущественных прав вступили в противоречие с принципами, установленными статьей 1 Гражданского кодекса: неприкосновенность собственности, свобода договора и недопустимость произвольного вмешательства кого-либо в частные дела в контексте раздела государственной собственности на федеральную, собственность субъектов Российской Федерации и муниципальную собственность и роспуска публичной собственности.Отказ органа местного самоуправления в выдаче приказа о заселении пустующего жилого помещения по договору социального найма в домах федеральной государственной собственности или в домах, находящихся в государственной собственности субъекта Российской Федерации, является нарушением воли собственника ( уполномоченное им лицо) на заключение с гражданином договора социальной аренды жилого помещения социального назначения по усмотрению сторон.
В соответствии с Вводным законом (статья 4) нормы ранее принятого законодательства действуют постольку, поскольку они не противоречат Гражданскому кодексу, до тех пор, пока это законодательство не будет приведено в соответствие с Гражданским кодексом.Следовательно, нормы жилищного законодательства, противоречащие Гражданскому кодексу, не должны применяться в практике органов местного самоуправления при заселении свободных жилых помещений в федеральную государственную собственность, государственную собственность субъектов Российской Федерации, а также при эксплуатации единой государственной собственности. заказ возможен только в пределах муниципального жилищного фонда.
Таким образом, должны быть введены приказы о заселении свободных жилых помещений в домах указанных государственных форм собственности, самостоятельно изданные собственником (его уполномоченным представителем) этих домов.
7. Каждая вещь имеет свой характер, свое предназначение, что объективно определяет естественный, объективный предел осуществления полномочий ее владельцем.
Назначение жилища, кроме того, зафиксировано в законе (Гражданский кодекс и ЖК), а индивидуально определенное жилище находится в данных бюро технической инвентаризации. Владелец не имеет права произвольно изменять или отменять его. Это социально важно для общества. Назначение жилища в имущественных отношениях, регулируемых статьей 288, оказалось не идентичным его назначению в отношениях по найму, регулируемых также в Гражданском кодексе (статья 673).В отношении собственности жилище его собственника функционально предназначено для проживания, в арендных отношениях жилище его арендатора является местом постоянного проживания. И в том, и в другом отношении дом должен отвечать тем же целям. И те, и другие отношения происходят одновременно в одной собственности. Однако в имущественных отношениях требования к жилью снизились, а в наемных - возросли.
ЖК (ст. 7) вступил в противоречие с ГК РФ, вполне обоснованно устанавливая единые повышенные требования к жилью - оно должно соответствовать требованиям постоянного проживания.Высокий уровень требований в свое время был связан с введением конституционного права на жилище в 1977 году.
Несоответствие между частями первого и второго Гражданского кодекса сформировалось в результате их принятия в разное время. Очевидно, что жилище должно быть одинаково конструктивно в тех и других отношениях, независимо от того, как его собственник или пользователь на самом деле использует.
8. Жилое помещение - место проживания (в основном) или место пребывания (в меньшей степени).В российском законодательстве проводится различие между функциональным назначением того и другого. И Конституция (статья 27), и Закон Российской Федерации от 25 июня 1993 г. «О праве граждан Российской Федерации на свободу передвижения, выбор места пребывания и проживания в пределах Российской Федерации».
Согласно Гражданскому кодексу (статья 20) местом жительства считается место постоянного или преимущественного проживания гражданина. Живет как собственник, по договору аренды (субаренды) или на иных основаниях.Местом проживания считается место временного проживания гражданина - гостиница, санаторий, дом отдыха, пансионат, кемпинг и другое подобное учреждение, а также жилое помещение, не являющееся местом проживания гражданина. Регистрация лиц по месту пребывания в жилых помещениях, не являющихся местом их проживания, осуществляется, как правило, на срок до 6 месяцев.
Проживание совместимо с профессиональной деятельностью на дому для людей творческих профессий (писателей, художников, музыкантов и т. Д.) без изменения функционального назначения корпуса. Жилое пространство не обязательно должно быть многофункциональным.
В сельской местности жилые здания признаются вместе с промышленными и другими хозяйственными зданиями и сооружениями в соответствии с целевым назначением земли и хозяйственной деятельностью.
Но место жительства собственника и членов его семьи, либо тех, кому жилище было передано для проживания по договору, несовместимо с размещением в нем коммерческих и некоммерческих организаций (например, АО, штаб-квартира партии, и т.п.). Не допускается использование в целях, далеких от жилых, и пустующих жилых помещений, приобретенных специально для этих целей (молитвенный дом и т. Д.). И в ГК, и в ЖК это расценивается как грубое нарушение закона. Если есть намерение использовать жилье для таких целей, его необходимо предварительно оборудовать и переоборудовать в свою противоположность - нежилое помещение. Порядок и условия такого перевода устанавливаются в ЖК (статьи 8, 9).
Фактическое использование жилого помещения по назначению не допускается, равно как и перевод площади, пригодной для постоянного проживания, в нежилую зону.
Перевод жилого помещения в нежилое допускается:
1) если жилье непригодно для постоянного проживания, и такие дефекты невозможно устранить технически и санитарно, либо их устранение нецелесообразно с экономической точки зрения;
2) если жилище находится в аварийном состоянии или находится под воздействием факторов, особо опасных для жизни и здоровья людей;
3) если жилое здание подлежит сносу или переводу на другой земельный участок на период до фактического сноса или перевода, начиная с момента освобождения жилого дома от проживающих в нем граждан.
9. Использование нежилых помещений, расположенных в жилых домах, предназначенных для коммерческих, производственных, офисных, бытовых нужд непроизводственного характера, не должно нарушать Правила пользования жилыми помещениями и содержания жилого дома и прилегающих к нему домов. Территория (СП РСФСР, 1986, №2, ст. 10), причиняет вред жителям и эксплуатации дома и земли. Гражданский кодекс вслед за ЖК (статья 7) запрещал размещение в жилых домах промышленного производства.
Жилище может быть многофункциональным, если оно отнесено Законом о жилищной политике к специализированным (жилые комнаты или квартиры в специальных жилых домах для одиноких пожилых людей, в пансионатах для инвалидов, ветеранов), где оказываются социальные и медицинские услуги для жителей. постоянно организованный. Но специализированный жилищный фонд (общежития, дома мобильного жилого фонда) вынесен за пределы основного жилого фонда. Поэтому специализированные жилые помещения в нем могут в некоторых случаях иметь пониженные санитарно-технические и другие потребительские характеристики и стандарты.
В основном жилом фонде квартира, гостиная не могут быть многофункциональными. Помещение признается жилым, если оно конструктивно, функционально предназначено и пригодно для постоянного проживания граждан с точки зрения санитарного, технического и иного потребительского состояния. Жилые помещения должны отвечать требованиям здорового и безопасного проживания, соответствовать санитарным нормам и требованиям к площади, дневному освещению, безопасности, водоснабжению, канализации, постоянному отоплению, вентиляции и другим условиям, обеспечивающим нормальный, здоровый образ жизни людей.
В каждом поселке городского или сельского типа достигнут определенный средний уровень инженерного благоустройства жилого фонда (электроэнергия, вода, тепло, газоснабжение, водоотведение, вывоз бытовых отходов и т. Д.). Жилище, не соответствующее потребительским нормам и требованиям или не оборудованное всеми видами инженерных изысканий, достигнутых в данном населенном пункте в среднем, признается непригодным для постоянного проживания в установленном порядке и подлежит переводу в нежилое, если это невозможно. быть восстановлены как жилые или другие меры (см. пункт 8).Отсутствие тех или иных инженерных усовершенствований, достигаемых в данном населенном пункте, в среднем переводит занимаемые помещения в число некачественных.
10. Квартира как объект собственности (статья 289) состоит из одной или нескольких жилых комнат, функционально связанных общими частями квартиры и связью с общими частями жилого дома, улицы, двора, прилегающего участка. Его планировка и параметры фиксируются в поэтажном плане и в экспликации квартиры на поэтажный план жилого дома, имеющей юридическое значение.
Потребительские свойства жилища, зафиксированные в его техническом паспорте, определяются его функциональным назначением. Жилищное право содержит санитарно-технические нормы и требования социального характера к эксплуатации жилищного фонда, соблюдение которых обеспечивает сохранение потребительских свойств жилища, повышение уровня технического благоустройства. Также этому способствует соблюдение правил пользования жилым помещением и прилегающим земельным участком.Утрата потребительских свойств и качеств жилья приводит к утрате жилыми помещениями своего назначения или их неполноценности.
Для включения в жилищный фонд жилых ячеек, отвечающих высоким требованиям к жилью, установлен определенный порядок приема в эксплуатацию вновь построенных жилых домов, исключающий прием домов с дефектами и дефектами. То же касается домов после реконструкции или капитального ремонта.
11. Объектами общей собственности в многоквартирном доме являются общестроительное инженерное оборудование, расположенное за пределами квартир, несущие и ненесущие конструкции общего дома жилого дома, помещения общего пользования.
В тексте статьи 290 прилегающий земельный участок не именуется общей собственностью собственников квартир в многоквартирном доме. Это, а также пешеходные, транспортные дороги, бассейны, водоемы, многолетние зеленые насаждения, элементы ландшафтного дизайна и другие вспомогательные объекты (гаражи и т.), объединенный общим земельным участком и элементами инфраструктуры, получил название Закона о товариществах собственников жилья (ст. 5.7). Эти объекты, в том числе дом, определены настоящим Законом как кондоминиум (см. Комментарии к главе 17 и статье 291). Прилегающий земельный участок и иное общее имущество могут быть обременены правом ограниченного пользования (сервитутом) другими лицами (п. 5 ст. 8 Закона о товариществах собственников жилья).
В квартире также есть инженерное оборудование, обслуживающее несколько квартир (газ, водопровод, канализация), которое по закону отнесено к общей собственности жилого дома.В коммунальной квартире, где объектом собственности является обособленная (непроходимая, непроходная) жилая комната, под общими помещениями понимается общая собственность всех субъектов собственности на жилые комнаты данной квартиры. Инженерное оборудование, обслуживающее несколько коммунальных квартир, является общей собственностью их владельцев. Имущественные отношения в коммунальной квартире специально не регулируются правилами данной главы. Нормы ст. 290 на квартиру как объект собственности и на общую собственность собственников квартир в многоквартирном доме могут применяться к этим отношениям по аналогии с законом.
Общее имущество как в многоквартирном доме, так и в коммунальной квартире находится в общей долевой собственности собственников квартир в многоквартирном доме (статья 291) и собственников жилых комнат в коммунальной квартире соответственно. Доля нового собственника в праве долевой собственности на такое имущество равна доле предыдущего.
В соответствии с Законом о товариществах домовладельцев в кондоминиуме доля каждого собственника квартиры в собственности общего имущества пропорциональна доле принадлежащих ему помещений и измеряется в кв.м. В товариществе может быть установлен иной принцип определения доли, но для этого необходимо решение общего собрания собственников помещений (домовладельцев), принятое в установленном законом порядке (см.

1. Собственники квартир в многоквартирном доме владеют на правах долевой собственности общими помещениями дома, несущими конструкциями дома, механическим, электрическим, санитарно-техническим и другим оборудованием снаружи или внутри квартиры. , обслуживающая более одной квартиры.№

2. Собственник квартиры не вправе отчуждать принадлежащую ему долю в общем имуществе жилого дома, а также совершать иные действия, влекущие за собой передачу этой доли отдельно от права собственности на квартиру.

Комментарий к Ст. 290 ГК РФ

1. Формулировка п. 1 ст. 290 неверна в той же степени, что и формулировка ст. 289 Гражданского кодекса (см. Комментарии). Фактически п.1 ст.290 не отражает реального положения дел, а лишь указывает на возможную принадлежность общего имущества в многоквартирном доме собственникам отдельных квартир, что может быть воплощено в реальности при наличии определенных обстоятельств.

Иными словами, только при создании кондоминиума норма о долевой собственности собственников квартир в многоквартирном доме, закрепленная в п. 1 ст. 290, теряет декларативный смысл и наполняется реальным содержанием.Собственникам квартир становится понятно, о каком общем имуществе идет речь, каков состав этого имущества и как определяется их доля в собственности на это имущество.

До создания кондоминиума все имущество жилого дома, предназначенное для обслуживания общих потребностей владельцев и арендаторов отдельных квартир, остается в собственности государства или муниципалитета.

2. Согласно п. 1 ст. 290 К общему имуществу квартирных собственников в многоквартирном доме относятся: а) общие помещения дома; б) несущие конструкции дома; в) механическое, электрическое, сантехническое и другое оборудование дома, предназначенное для обслуживания более одной квартиры.Указанный исчерпывающий перечень элементов общей собственности жилого дома является неполным и неточным.

Согласно СНиП от 2 августа 2001 г. элементы жилого дома достаточно четко делятся на четыре группы: 1) помещения; 2) строительство; 3) космос; 4) оборудование. При этом под помещениями (жилыми и нежилыми) понимаются внутренние части здания, отделенные друг от друга сплошными стенами или перегородками и предназначенные для самостоятельного использования.К общим помещениям относятся, в частности, лестнично-лифтовый узел, лифтовый холл, световой карман. К конструкциям (несущим и ненесущим) относятся фундаменты, стены, перекрытия, перегородки, крыши, световые люки, заборы и т. Д. Помещения бывают тамбурные, чердак и вентиляционные шахты. Наконец, водопроводные и канализационные трубы, электропроводка, телефонные кабели и т. Д. Признаются оборудованием.

Таким образом, к общему имуществу жилого дома, помимо названного в п. 1 ст. К 290 элементам относятся также пространства - тамбур, чердаки и шахты, а также все конструкции (не только несущие).Этот вывод, подтвержденный п. 1 ст. 36 ЖК, имеет прямое практическое значение при решении вопросов, связанных с использованием пространств в жилом доме, например, устройство чердаков в чердачных помещениях.

Кроме того, сравнивая формулировку п. 1 ст. 290 с редакцией п. 1 ст. 36 ЖК выявлено, что ГК не включает «земельный участок, на котором расположен этот дом, с элементами благоустройства и благоустройства и другие объекты, предназначенные для обслуживания, эксплуатации и благоустройства этого дома, расположенного на указанном земельном участке». общее имущество дома.Объясняется это, видимо, тем, что для включения данного земельного участка в кондоминиум необходимо его формирование, описание, определение границ и т. Д., На что косвенно указывает п. 1 ст. 36 ЖК, касающееся земельного и градостроительного законодательства.

Данное обстоятельство служит дополнительным аргументом в пользу того, что кондоминиум не возникает автоматически, а выступает как особый объект права в установленном законом порядке.

3.Пункт 2 комментируемой статьи устанавливает правило, согласно которому доля в общей собственности жилого дома не может быть отчуждена отдельно от собственности на квартиру. Этот запрет является существенным исключением из правил об общей собственности (глава 16 Гражданского кодекса), которые обычно применяются к общей собственности жилого дома (разумеется, при условии его регистрации в качестве кондоминиума). Его наличие оправдано, так как общее имущество жилого дома имеет строго целевое назначение.

Из п. 2 ст. 290 следует, что доля в праве общей собственности на общую собственность жилого дома следует за судьбой права собственности на квартиру (а также за судьбой права собственности на нежилое помещение в доме).

В литературе и судебной практике данное положение иногда объясняют тем, что общее имущество в доме принадлежит главным вещам - жилым и нежилым помещениям - и поэтому всегда разделяет их судьбу (ст. 135 ГК РФ).

Это объяснение является поверхностным и не может быть распознано иначе, как недоразумение. Жилой дом - это единый имущественный комплекс, состоящий из множества элементов, физически и функционально связанных между собой. Отдельные помещения, как жилые, так и нежилые, не могут существовать без общего имущества, которое их обслуживает, а иногда и существуют. Это значит, что они не соответствуют главному признаку главного - возможности использоваться по прямому назначению самостоятельно, без своей принадлежности.Кроме того, правило ст. 135 ГК РФ диспозитивна, а положение п. 2 ст. 290 строго обязательно.

Таким образом, отдельные помещения в жилом доме и общее имущество дома не соотносятся между собой как главное и принадлежность, а вместе составляют единое сложное дело (ст. 134 ГК РФ).

Судебная практика по статье 290 Гражданского кодекса Российской Федерации

Определение Верховного Суда РФ от 12.01.2017 N 310-ES16-18710 по делу N A48-5333 / 2014

Оценив представленные в материалах дела доказательства по правилам статьи 71 Арбитражного процессуального кодекса Российской Федерации, установив, что возник спор между стороны возникли в отношении нежилых помещений, в которых находится приточно-вентиляционное оборудование, и эти помещения являются частью имущества, принадлежащего ответчику, и являются общей собственностью, так как по своему назначению и техническим характеристикам относятся к обслуживающему более чем одному помещение в здании, суд пришел к выводу, что спорное имущество принадлежит всем совладельцам дома в силу закона и, руководствуясь статьями Гражданского кодекса Российской Федерации, удовлетворил исковые требования общества.


Определение Верховного Суда РФ от 09.01.2017 N 301-ES16-17812 по делу N A29-3933 / 2016

После исследования и оценки представленных доказательств по правилам статьи 71 Арбитражного процессуального кодекса Российской Федерации. Российской Федерации, руководствуясь статьями ,,,,,, Гражданского кодекса Российской Федерации, статьями 39, 158 Жилищного кодекса Российской Федерации, а также с учетом обстоятельств, установленных решением Арбитражного суда Российской Федерации. Республика Коми, вступившее в законную силу с 28 июля 2014 г.А29-4171 / 2014, суд удовлетворил заявленные требования на законных основаниях, установив, что в течение спорного периода помещения использовались Компанией на основании договора, по условиям которого арендатор понес расходы по содержанию и содержанию. Ремонт общего имущества МКД в котором помещение пропорционально его площади.


Определение Верховного Суда РФ от 16 января 2017 г. N 310-ES16-18370 по делу N A68-9144 / 2015

После исследования, оценки представленных доказательств по правилам статьи 71 Арбитражного процессуального кодекса Российской Федерации, руководствуясь статьями ,,, Гражданского кодекса Российской Федерации, статьями 36, 40 Жилищного кодекса Российской Федерации и принимая во внимание пояснения, изложенные в пункте 2 Постановления Пленума Российской Федерации. Высший Арбитражный Суд РФ 23.07.2009 N «О некоторых вопросах практики рассмотрения споров о правах собственников помещений на общую собственность дома», суд, оценив условия заключенного договора № 50/1 и установив, что указанный договор заключен на по содержанию помещения, принадлежащего Предпринимателю на праве собственности, а также по содержанию общего имущества здания, принадлежащего всем его владельцам, то есть поддержание его в надлежащем состоянии, пришли к выводу, что оснований для удовлетворения требований не было, поскольку Предприниматель не получил согласия всех собственников здания на переоборудование помещения.


Определение Верховного Суда Российской Федерации от 17 января 2017 г. N 301-ES16-18763 по делу N A17-4219 / 2015

При принятии оспариваемых ответчиком судебных актов суды руководствовались положениями ст. пункт 1 статьи Гражданского кодекса Российской Федерации, правовые нормы, регулирующие подобные отношения, в частности статьи, и Гражданский кодекс Российской Федерации, часть 1 статьи 36, статьи 44 - 48 Жилищного кодекса Российской Федерации , а также разъяснения, изложенные в пункте 37 Постановления Пленума Верховного Суда Российской Федерации от 29.07.2012 г.6 Пленума Высшего Арбитражного Суда Российской Федерации № 8 от 01.07.1996 «О некоторых вопросах, связанных с применением части первой Гражданского кодекса Российской Федерации», п. 2 Постановления Пленума Постановления Верховного Суда РФ Арбитражного Суда РФ от 23.07.2009 N «О некоторых вопросах практики рассмотрения споров о правах собственников помещений на общую собственность здания».


Определение Верховного Суда Российской Федерации от 20 января 2017 г. N 305-ES16-20055 по делу N A40-142132 / 2015

Оценивая доказательства, представленные в главе 7 Арбитражного процессуального кодекса Российской Федерации, суды первой и апелляционной инстанций, руководствуясь положениями статей, Гражданского кодекса Российской Федерации, статьи 36 Жилищного кодекса Российской Федерации, исходили из того, что в деле следует, что спорное жилое помещение изначально являлось холл подъезда No.12, предназначенная для входа жителей на территорию двора многоквартирного дома. При этом суд установил, что ООО «НИНА» не имело законных оснований для помещения Л2 площадью 4,8 квадратных метра.


Определение Верховного Суда РФ от 30.01.2017 N 302-ES16-17675 по делу N A58-1083 / 2014

Суды, исходя из оценки представленных в материалах дела доказательств по правилам Статья 71 Арбитражного процессуального кодекса Российской Федерации, руководствуясь статьями ,,,,, Гражданского кодекса Российской Федерации, статьями 36, 39, 155, 158 Жилищного кодекса Российской Федерации, сохранение общего имущества административное здание, в котором находится нежилое помещение, принадлежащее кооперативу, при отсутствии договора в спорном периоде, после проверки расчета долга, мы обоснованно пришли к правильному выводу, что основания в данном случае были удовлетворить требование истца о взыскании с ответчика неосновательного обогащения 393 129 рублей 75 копеек.


Определение Верховного Суда РФ от 01.02.2017 N 308-ES16-20103 по делу N A63-11295 / 2015

Суды первой и апелляционной инстанций, рассмотрев представленные по делу доказательства по правилам статьи 71 Арбитражного процессуального кодекса Российской Федерации, руководствуясь статьями ,,,,,,,, Гражданского кодекса Российской Федерации (далее - Гражданский кодекс Российской Федерации), статьями 36, 158 Жилищного кодекса. Российской Федерации, статьи 1 и 16 Федерального закона № 30.12.2004 N 214-ФЗ «Об участии в долевом строительстве многоквартирных домов и иного недвижимого имущества и о внесении изменений в некоторые законодательные акты Российской Федерации», пояснения, данные в п. 1 Постановления Пленума ВАС РФ. Российская Федерация 23.07.2009 N «О некоторых вопросах практики рассмотрения споров о правах собственников помещений на общую собственность здания», п. 41 постановления Пленума Верховного Суда РФ от 23.06.2015 N «О применении судами отдельных положений раздела I части первой Гражданского кодекса Российской Федерации» пришел к выводу о наступлении на стороне ответчика необоснованного пожаротушения за счет средств истца. в размере, указанном в иске.


Определение Верховного Суда Российской Федерации от 09.01.2017 N 303-ES16-17770 по делу N A51-24204 / 2015

Заявитель считает, что суды при принятии оспариваемых актов нарушили положения статей, Гражданский кодекс Российской Федерации (далее - Гражданский кодекс) и статьи 36, 158, 162 Жилищного кодекса Российской Федерации (далее - Жилищный кодекс).

В соответствии с частью 1 статьи 291.1, частью 7 статьи 291.6 и статьей 291.11 Арбитражного процессуального кодекса Российской Федерации (далее - Арбитражный процессуальный кодекс Российской Федерации) кассационная жалоба подается в кассационном порядке. рассмотрение в судебном заседании Судебной коллегией Верховного Суда Российской Федерации, если изложенные в нем доводы подтверждают наличие существенных нарушений норм материального права и (или) норм процессуального права, повлиявших на исход дела, без устранения которого невозможно восстановить и защитить нарушенные права и законные интересы заявителя в сфере предпринимательской и иной экономической деятельности.№

«Об утверждении Правил содержания общего имущества в многоквартирном доме и Правил изменения размера платы за содержание и ремонт жилых помещений в случае оказания услуг и работ по управлению, содержанию». и ремонт общего имущества в многоквартирном доме ненадлежащего качества и (или) с перерывами, превышающими установленную продолжительность », - пояснения, приведенные в пунктах 36, 52 постановления Пленума Верховного Суда Российской Федерации и Пленума Постановления Высшего Арбитражного Суда РФ от 29.04.2010 N / 22 «О некоторых вопросах, возникающих в судебной практике при разрешении споров, связанных с защитой имущественных и иных имущественных прав», пришел к выводу о законности иск Товарищества.


Определение Верховного Суда РФ от 06.02.2017 N 310-ES15-12415 по делу N A48-3443 / 2013

Суды первой и апелляционной инстанций, исследовав и оценив представленные в материалах дела доказательства в их совокупность по правилам статьи 71 Арбитражного процессуального кодекса Российской Федерации, включая техническую документацию спорного нежилого помещения, выписку из Единого государственного реестра прав на недвижимое имущество и сделок с ним, руководствуясь Гражданского кодекса Российской Федерации, статьи 36 Жилищного кодекса Российской Федерации, пояснения, данные в пунктах 1, 2, 3, 4 постановления Пленума Высшего Арбитражного Суда Российской Федерации от 23 .07.2009 N «О некоторых вопросах практики рассмотрения споров о правах собственников помещений на общую собственность здания» С учетом обстоятельств, установленных при рассмотрении дела № А48-4114 / 2010, мы пришли к выводу, что часть м. спорного помещения площадью 1362,9 кв.м. м является общей собственностью (общими площадями) всех собственников помещений в названном нежилом здании, а значит, находится в их долевой собственности, а доля истца, определяемая пропорционально площади принадлежащих ему помещений , составляет 13/1000 в праве обыкновенной долевой собственности.


Определение Верховного Суда Российской Федерации от 06.02.2017 N 302-ES16-20575 по делу N A33-25609 / 2015

При разрешении заявленных требований суды руководствовались положениями статей, п.1 п. Статья Гражданского кодекса Российской Федерации, пункт 1 статьи 36, часть 8 статьи 156, пункты 1, 4 статьи 158 Жилищного кодекса Российской Федерации, пункты 16, 33 Правил содержания общего пользования. имущество в многоквартирном доме, утвержденное постановлением Правительства РФ от 13.08.2006 N, и исходил из того, что ответчик как собственник нежилого помещения в многоквартирном доме обязан нести расходы по содержанию общего имущества дома. Проверив правильность расчета истца и установив отсутствие доказательств его введения, суды исковые требования удовлетворили в полном объеме.

1. Собственники квартир в многоквартирном доме владеют на правах долевой собственности общими помещениями дома, несущими конструкциями дома, механическим, электрическим, санитарно-техническим и другим оборудованием снаружи или внутри дома. квартира, обслуживающая более одной квартиры.2. Собственник квартиры не вправе отчуждать принадлежащую ему долю в общем имуществе жилого дома, а также совершать иные действия, влекущие за собой передачу этой доли отдельно от права собственности на квартиру.

Юридическая консультация по ст. 290 ГК РФ

    Артем Сергушин

    Здравствуйте! В 2015г. Муниципальное образование на базе жилого массива передало, без уведомления собственников многоквартирного дома, прилегающую территорию.Все было бы хорошо. Но участок передали с разрушенной детской, спортивной площадкой, обрушился асфальт возле дома. Вопрос в том, стоило ли муниципалитету все отремонтировать перед передачей и передать участок в надлежащем виде собственникам? Законно ли собственникам навязывать капитальный ремонт детской, спортивной площадки, асфальтировать проезды возле дома, когда все это пришло в негодность за время управления муниципалитетом?

    Антонова Оксана

    Здравствуйте.В новом МКД из-за неудачной планировки три квартиры на трех этажах решили установить запирающиеся перегородки, используя часть участка для своих личных нужд. По проекту площадка имеет форму прямоугольного кольца с лифтом в центре. После установки перегородок вокруг лифта уже нельзя ходить по кругу. В каждом случае присоединения часть участка захватывала одна квартира, которая фактически присоединяла эту площадь к своей квартире, не документируя это.Скажите, на какие пункты ГК РФ и Жилищного кодекса РФ нужно опираться, чтобы заставить оккупантов снести перегородки в суде? Могут ли оккупанты узаконить свои перегородки на общем собрании собственников? Сколько голосов «за» и от какого количества голосов собственников это потребуется?

    Даниил Криворотько

    Является ли газовая труба общей собственностью МЖД (обвязка на стене дома), если построена за счет части собственников и могу ли я подключить к этой трубе свою квартиру.

    Тумаркин Геннадий

    Одноэтажный 6-квартирный дом (казарменного типа). Крыша - коммунальная собственность? Дом нигде не прописан.

    Волкова Зоя

    что является общим имуществом жилого дома целлюлоза

    • ГК РФ Статья 290 Собственникам квартир в многоквартирном доме принадлежат на праве долевой собственности общие помещения дома, несущие конструкции дома, механические, электрические, сантехнические и другое оборудование снаружи и...

    Филиппова Марина

    Об устройстве отдельного входа в квартиру. Почему при голосовании за отдельный вход в жилую квартиру вместо окна на 1 этаже администрация требует согласия 100% собственников В статьях 44-48 ЖК, на которые они ссылаются, я не стал найди что-нибудь вразумительное. Подскажите где это написано.

    • Ответ юриста:

      Статья 36. Уменьшение размера общего имущества в многоквартирном доме возможно только с согласия всех собственников помещений в этом доме путем его реконструкции.Статья 40. Изменение границ помещений в многоквартирном доме 1. Собственник помещения в многоквартирном доме, приобретая в собственность помещение, прилегающее к принадлежащему ему на праве собственности помещению в многоквартирном доме, имеет право объединить эти помещения в одно помещение в порядке, установленном главой 4 настоящего Кодекса. Границы между смежными помещениями могут быть изменены или эти помещения могут быть разделены на два и более помещения без согласия собственников других помещений, если такое изменение или разделение не влечет изменения границ других помещений, границ и размер общего имущества в многоквартирном доме или изменение доли в долевой собственности на общее имущество в этом доме.2. Если реконструкция, реорганизация и (или) перепланировка помещений невозможны без присоединения к ним части общего имущества в многоквартирном доме, на такую ​​реконструкцию, реорганизацию и реорганизацию необходимо получить согласие всех собственников помещений в многоквартирном доме. (или) перепланировка помещения.

    Елена Романова

    Какое имущество относится к общей собственности (частям общего пользования) жилого дома?

    • Собственники помещений в многоквартирном доме владеют на правах долевой собственности общим имуществом в многоквартирном доме, а именно: 1) помещениями в этом доме, не входящими в состав квартир и предназначенными для обслуживания...

    Яна Тарасова

    Скажите, можно ли выкупить имущество, прилегающее к моей квартире? В этом помещении есть жестяные вентиляционные каналы (2-3 шт.). Имеет отдельную дверь. Никаких изменений не буду вносить, только замену деревянной двери на железную. Судя по ст. 36 ЖК РФ требует согласия всех владельцев. Есть ли способ обойти это. Дом новый (госкомиссия еще не принята) и сделать это просто нереально.

    • Ответ юриста:

      Все подсобные помещения в многоквартирном доме находятся в общей долевой собственности собственников квартир. В соответствии с ч. 2 ст. 290 ГК РФ собственник квартиры не вправе отчуждать свою долю в праве долевой собственности отдельно от права собственности на квартиру

    Григорий Чечнев

    Можно ли в городе приватизировать двор, на котором стоит многоквартирный дом

    • Запрещено.Это общая собственность владельцев квартир в этом доме. Ну к чему такие глупые вопросы ??? Да, ты можешь.

    Антон Глушак

    • Ответ юриста:

      Статья 37. Определение долей в праве долевой собственности на общее имущество в многоквартирном доме 1. Доля в праве долевой собственности на общее имущество в многоквартирном доме собственника помещения в этом доме пропорциональна размер общей площади указанного помещения.2. Доля в праве долевой собственности на общее имущество в многоквартирном доме собственника помещения в этом доме определяется судьбой собственности на указанное помещение. 3. При переходе права собственности на помещение в многоквартирном доме доля в совместной собственности в общем имуществе в этом доме нового собственника такого помещения равна доле в долевой собственности на указанное общее имущество. предыдущий владелец такого помещения. 4. Собственник помещения в многоквартирном доме не вправе: 1) осуществлять выделение в натуре своей доли в праве долевой собственности на общее имущество многоквартирного дома; 2) отчуждать свою долю в праве общей собственности на общее имущество в многоквартирном доме, а также совершать иные действия, влекущие передачу этой доли отдельно от права собственности на указанное помещение.

    Геннадий Первозванский

    В многоквартирных домах пристройку считали общедомовой собственностью всех собственников квартир !. Изменился ли этот закон, если да, то когда?

    • Ответ юриста:

      в любом случае все, что находится за пределами квартиры, на которую прописано право собственности, является общей собственностью. Если получить согласие общего собрания собственников, то можно оформить недвижимость, для перепланировки или реконструкции еще требуется согласование с контролирующими органами

    Горячкин Александр

    Кто являлся собственником общего имущества в многоквартирном доме на момент введения Жилищного кодекса - 01.03.2005 г.

    Евгений Мельник

    Пересчитывают ли отсутствующему арендатору за содержание общего имущества в многоквартирном доме?

    • Не допускается.В связи с отсутствием владельцев ремонт не будет приостановлен. ▬▬▬▬▬▬▬▬▬ஜ ۩۞۩ ஜ▬▬▬▬▬▬▬▬▬▬▬ ✔ Советую попробовать Kiwi Multiplier Kiwi50 .рф (убрать пробел)! Депозит от 10 рублей + прибыль 50% за 24 часа! ✔ Реферальная программа! ✔ Защита от DDOS ...

    Сорокина Дарья

    Является ли общая собственность многоквартирного дома долевой собственностью?

    • Ответ юриста:

      Статья 36. Право собственности на общее имущество собственников помещений в многоквартирном доме 1.Собственники помещений в многоквартирном доме владеют на праве долевой собственности помещениями в этом доме, которые не являются частью квартир и предназначены для обслуживания более одного помещения в этом доме, в том числе межквартирных домов. лестничные клетки, подъезды, лифты, лифтовые и другие шахты, коридоры, технические этажи, чердаки, подвалы с инженерными коммуникациями, другое оборудование, обслуживающее более одного помещения в этом доме (технические подвалы), а также ограждающие крыши несущие и ненесущие- несущие конструкции этого дома, механическое, электрическое, сантехническое и другое оборудование, расположенное в этом доме за пределами или внутри помещений и обслуживающее более одной комнаты, земельный участок, на котором расположен этот дом, с элементами благоустройства и благоустройства и другое, предназначенное для содержание, эксплуатация и благоустройство этого дома, объектов, расположенных на указанном земельном участке (далее - общее имущество в многоквартирном доме).Границы и размер земельного участка, на котором расположен многоквартирный дом, определяются в соответствии с требованиями земельного законодательства и законодательства о градостроительстве.

    Мария Попова

    являются ли батареи общим достоянием многоквартирного дома?

    Георгий Давыденко

    могут ли жильцы многоквартирного дома разбивать парковочные места?. люди из соседних подъездов ходят и собирают подписи, чтобы занять несколько парковочных мест.80% жителей - люди старше 60 лет, им все равно и они согласны, можно ли как-то с этим бороться и сколько подписей нужно, чтобы они могли согласовывать свои действия с государством?

    • Прилегающая территория является общей собственностью собственников дома и не может быть передана в натуре. Попытки обезопасить парковочные места ставят мины на случай будущих конфликтов. Здесь будет действовать право сильных, а также культивирование «бытовой дедовщины».

    Дмитрий Смурыгин

    Общее имущество собственников в многоквартирном доме.Добрый день. Не могли бы вы помочь мне в следующей ситуации? Если многоквартирный дом, как и участок, на котором он построен, является собственностью определенной компании, скажем X, то большая часть квартир приобретается индивидуальными собственниками, которые не являются частью компании X. Общая собственность владельцев в этот многоквартирный дом будет, согласно ст. 36 ЖК РФ, т.е. включая электронную почту. tech. инсталляции, лифты, зеленые насаждения, а также земля под домом?

    Королева Лидия

    Не могу найти право общей совместной собственности на общее имущество собственников квартир в многоквартирном доме и т. Д.Жилищный кодекс есть везде. И работать по гражданскому праву. помощь. заранее ATP

    Станислав Швалов

    общего имущества собственников квартир в многоквартирном доме ???

    • Ответ юриста:

      Генерал, генерал. Вот что об этом говорит ТК РФ (не знаю, отмечать ли это полностью) http://www.consultant.ru/popular/housing/55_7.html#p417 Статья 36. Право собственности на общее имущество граждан. собственники помещений в многоквартирном доме 1 Собственники помещений в многоквартирном доме владеют на правах долевой собственности помещениями в этом доме, которые не являются частью квартир и предназначены для обслуживания более одного помещения в этом доме, в том числе межквартирные лестницы, подъезды, лифты, лифтовые и другие шахты, коридоры, технические этажи, чердаки, подвалы, в которых есть инженерные коммуникации, другое оборудование, обслуживающее более одной комнаты в этом доме (технические подвалы), а также крыши, ограждающие несущие и ненесущие конструкции этого дома, механическое, электрическое, сантехническое и другое оборудование, находящиеся в этом доме вне или внутри помещения и обслуживающие более одной комнаты, земельный участок, на котором расположен этот дом, с Эле благоустройство и благоустройство и другие объекты, предназначенные для содержания, эксплуатации и благоустройства этого дома, расположенного на указанном земельном участке (далее - общая собственность в многоквартирном доме).Границы и размер земельного участка, на котором расположен многоквартирный дом, определяются в соответствии с требованиями земельного законодательства и законодательства о градостроительстве. 2. Собственники помещений в многоквартирном доме владеют, пользуются и в пределах, установленных настоящим Кодексом и гражданским законодательством, распоряжаются общим имуществом многоквартирного дома. 3. Уменьшение размеров общего имущества в многоквартирном доме возможно только с согласия всех собственников помещений в этом доме путем его реконструкции.4. По решению собственников помещений в многоквартирном доме, принятому на общем собрании таких собственников, объекты общего имущества многоквартирного дома могут быть переданы в пользование другим лицам, если это не нарушает права и законные интересы. граждан и юридических лиц. 5. Земельный участок, на котором расположен многоквартирный дом, может быть обременен правом ограниченного пользования другими лицами. Не допускается запрещение установления обременений на земельный участок, если необходимо обеспечить доступ других лиц к объектам, существовавшим до дня вступления в силу настоящего Кодекса.Новое обременение земельного участка с правом ограниченного пользования устанавливается соглашением между лицом, требующим такого обременения земельного участка, и собственниками помещений в многоквартирном доме. Споры об установлении обременения земельного участка правом ограниченного пользования или об условиях такого обременения разрешаются в судебном порядке. 6. В случае разрушения, в том числе гибели в результате несчастного случая, сноса многоквартирного дома, собственники помещений в многоквартирном доме сохраняют свою долю в праве долевой долевой собственности на земельный участок, на котором расположен этот дом, с элементами благоустройство и благоустройство и другое, предназначенное для обслуживания, эксплуатации и благоустройства этого дома, объектов, расположенных на указанном земельном участке, в соответствии с долей в праве долевой долевой собственности на общее имущество в многоквартирном доме на момент разрушения, в том числе смерть от несчастного случая, снос такого дома.Эти собственники владеют, пользуются и распоряжаются предусмотренным в этой части имуществом в соответствии с гражданским законодательством.

    Вера Миронова

    Стоит ли платить за отопление в подвале, если у меня там даже батарей нет, а только трубы, идущие в квартиры. надо ли платить за отопление в подвале, если у меня там даже батарей нет, а только трубы, идущие в квартиры

    Гореликов Максим

    Замена отопления в приватизированной квартире.Добрый день. Я хочу заменить отопление в приватизированной квартире, должны ли ЖКХ оплачивать мои расходы, и если да, то сколько?

    • Ответ юриста:

      1. Собственники помещений в многоквартирном доме владеют на правах долевой собственности помещениями в этом доме, не входящими в состав квартир, и ПРЕЗЕНТАЦИЯ ПРАВИТЕЛЬСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ № 491 от 13 августа, 2006 г. 5. В общую собственность входят внутренние инженерные системы холодного, горячего водоснабжения и газоснабжения, состоящие из стояков, ответвлений от стояков к первому разъединителю, находящемуся на ответвлениях от стояков, указанные отключающие устройства, коллектив (общий дом) приборы учета холодной и горячей воды, первую запорно-регулирующую арматуру на выводах внутриквартирной электропроводки от стояков, а также расположенное в этих сетях механическое, электрическое, сантехническое и другое оборудование.6. В состав общего имущества входит система внутреннего отопления, состоящая из стояков, ТЭНов, регулирующей и запорной арматуры, коллективных (общедомовых) счетчиков тепловой энергии, а также другого оборудования, расположенного в этих сетях. МИНИСТЕРСТВО РЕГИОНАЛЬНОГО РАЗВИТИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ПИСЬМО от 4 сентября 2007 г. N 16273-СК / 07 Минрегионразвития Российской Федерации рассмотрело обращение о составе общего имущества и сообщает об этом. В соответствии с п.6 Правил содержания общего имущества, утвержденных Постановлением Правительства Российской Федерации от 13 августа 2006 г. N 491, в составе общего имущества имеется система внутреннего отопления, состоящая из стояков, ТЭНов. , регулирующая и запорная арматура, коллективные (домовые) приборы учета тепловой энергии, а также другое оборудование, расположенное в этих сетях.Исходя из вышеизложенного, расположенные внутри квартир нагревательные элементы (радиаторы) являются частью общей собственности многоквартирного дома. Директор Департамента жилищно-коммунального хозяйства КРАЙНЕВ С.А. Полезно ознакомиться с Постановлением Верховного суда от 22.09.2009 № ГКПИ09-725. Этим Постановлением, оставленным без изменения Кассационной коллегией ВС РФ от 24 ноября 2009 г., радиаторы отопления с отключающими устройствами, обслуживающие более одного помещения, относятся к собственности собственников.Право собственности на общее имущество собственников помещений в многоквартирном доме 1. Собственники помещений многоквартирного дома владеют на праве долевой собственности помещениями в этом доме, которые не являются частью квартир и предназначены для обслуживания. более одного помещения в этом здании, в том числе межквартирные лестницы, лестницы, лифты, лифтовые и другие шахты, коридоры, технические этажи, чердаки, подвалы, которые имеют инженерные сети, другое оборудование, обслуживающее более одной комнаты в этом доме (технические подвалы) , а также кровли, ограждающие несущие и ненесущие конструкции этого дома, механическое, электрическое, сантехническое и другое оборудование, находящееся в этом доме вне или внутри помещений и обслуживающее более одного помещения, земельный участок на котором Данный дом расположен, с элементами благоустройства и благоустройства и других предназначенных для обслуживания, эксплуатации и благоустройства объектов данного дома, расположенных на указанном земельном участке (далее именуется общей собственностью в многоквартирном доме).Границы и размер земельного участка, на котором расположен многоквартирный дом, определяются в соответствии с требованиями земельного законодательства и законодательства о градостроительстве. , изъятые из общей собственности и определены как собственность собственников.

    Илья Панкин

    Включены ли отопительные батареи в общую собственность собственников многоквартирного дома? А где это можно увидеть?

    • Ответ юриста:

      ЖК РФ Глава 6.Общая собственность собственников помещений в многоквартирном доме. Общее собрание таких собственников Статья 36. Право собственности на общее имущество собственников помещений в многоквартирном доме, в том числе межквартирные лестницы, подъезды, лифты, лифтовые и другие шахты, коридоры, технические этажи, чердаки, подвалы, в которых в этом доме есть инженерные коммуникации, другое оборудование, обслуживающее более одного помещения (технические подвалы), а также крыши, ограждающие несущие и ненесущие конструкции этого дома, механическое, электрическое, сантехническое и другое оборудование, расположенное в этом доме снаружи или внутри помещения и обслуживающего более одного помещения, земельный участок, на котором расположен этот дом, с элементами благоустройства и благоустройства и другие, предназначенные для обслуживания, эксплуатации и благоустройства этого дома, объектов, расположенных на указанном земельном участке (далее - общее имущество в многоквартирном доме).Границы и размер земельного участка, на котором расположен многоквартирный дом, определяются в соответствии с требованиями земельного законодательства и законодательства о градостроительстве. Непонятно, о каком расположении батарей отопления идет речь. не являются общей собственностью. Если батареи находятся в подъезде, то они в общем достоянии.

    Андрей Филипповский

    Как узнать, что гараж перед домом установлен незаконно.Можно ли оформить под себя эту землю, отняв у нее предыдущую. владелец?

    • Что, приснилась Октябрьская революция 7))))) Земля под многоквартирным домом является общей собственностью всех собственников, выделение участков законом не предусмотрено, если гараж установлен незаконно, то ваши действия вообще будет беззаконие.

    Максим Мокашин

    На основании какой статьи ЖКРФ я не вправе распоряжаться своим имуществом без согласия ТСЖ.. Я владелец приватизированной квартиры, расположенной на первом этаже многоквартирного дома. Хочу перевести ее из жилого в нежилое.

    • Ответ юриста:

      Если вы собственник без ограничений, то напротив, вы имеете право распоряжаться по своему усмотрению, если это не нарушает права других собственников ТСЖ. Ограничения устанавливаются федеральными законами. Права и обязанности собственника жилого помещения 1.Собственник жилого помещения осуществляет права владения, пользования и распоряжения жилым помещением, принадлежащим ему на праве собственности, в соответствии с его назначением и пределами его использования, которые установлены настоящим Кодексом. 2. Собственник жилого помещения вправе обеспечить владение и (или) пользование принадлежащим ему жилым помещением на основании договора аренды, договора безвозмездного пользования или иного правового основания, поскольку а также юридическому лицу на основании договора аренды или иного правового основания с учетом требований, установленных гражданским законодательством, настоящим Кодексом.3. Собственник жилого помещения несет бремя содержания этого помещения, а если это помещение является квартирой, то общее имущество собственников помещений в соответствующем многоквартирном доме, а также собственник помещения в коммунальной квартире. несет бремя содержания общего имущества собственников комнат в такой квартире, если иное не предусмотрено федеральным законом или договором. 4. Собственник жилого помещения обязан поддерживать это помещение в надлежащем состоянии, не допуская бесхозяйственности с ним, соблюдать права и законные интересы соседей, правила пользования жилым помещением, а также правила содержания общего имущества. собственников помещений в многоквартирном доме.Содержание имущественных прав 1. Собственник имеет право владеть, пользоваться и распоряжаться своим имуществом. 2. Собственник вправе по своему усмотрению совершать в отношении принадлежащего ему имущества любые действия, не противоречащие закону и иным правовым актам и не нарушающие права и интересы других охраняемых законом лиц, в том числе отчуждать свое имущество в собственность других лиц, передавать им, оставаясь собственником, право владеть, пользоваться и распоряжаться имуществом, закладывать имущество и обременять его иным образом, иначе распоряжаться им.3. Владение, использование и распоряжение землей и другими природными ресурсами в той мере, в какой их оборот разрешен законом (статья 129), осуществляется их владельцем свободно, если это не наносит вред окружающей среде и не нарушает права и законные интересы других лиц. 4. Собственник может передать свое имущество в доверительное управление другому лицу (доверительному управляющему). Передача имущества в доверительное управление не влечет перехода права собственности к доверительному управляющему, который обязан управлять имуществом в интересах указанного им собственника или третьего лица.Глава 3. ЖК РФ ПЕРЕДАЧА ЖИЛЫХ ПОМЕЩЕНИЙ В НЕЖИЛЫЕ ПОМЕЩЕНИЯ И НЕЖИЛЫХ ПОМЕЩЕНИЙ В ЖИЛЫЕ ПОМЕЩЕНИЯ

    Евгения Комарова

    рушащийся балкон в купленной квартире. Сверху обваливается балкон в квартире, у меня есть предписание УК о невозможности пользоваться балконом. УК ссылается на закон и говорит, что балконная плита - собственность хозяина квартиры, кот стоит надо мной и он сам должен ее отремонтировать и укрепить.Это так?

    • Ответ юриста:

      Арт. 36 ЖК РФ общее имущество в многоквартирном доме балкон не принадлежит Вам или соседу по праву частной собственности ... Балкон является частью квартиры и не может быть отнесен к общей собственности. Навес (перекрытие) над балконом является его конструктивным элементом, он не является кровлей многоквартирного дома и не предназначен для обслуживания других жилых помещений в этом доме. ..Изобразительное искусство. 210 ГК РФ: собственник несет бремя содержания своего имущества.Возможно, так ...

    Клавдия Тарасова

    Является следующим (внутренним) общим имуществом собственников многоквартирного дома. 1. Общедомовый прибор учета тепловой энергии - будет произведен по его состоянию. проверка 2. Уличное освещение (несколько фонарей) - мелкий ремонт Вопрос. 1. Является ли указанное общее имущество собственниками многоквартирного дома? 2. Применяется ли общее правило расходов на содержание общего имущества к указанному имуществу пропорционально долям в праве общей собственности в многоквартирном доме.Прошу дать ответы с пояснением. Спасибо.

    • Ответ юриста:

      Тут нужно посмотреть, где эти светильники расположены, на чьем земельном участке, если на участке дома, то да, это общая собственность, обычный бытовой прибор - как будто на вашем земельном участке, а то нет. не будет обычным домом. Таким образом, по плану вам нужно посмотреть на все свои фонари, покрыть расходы на ремонт, распределить между членами либо жилищного кооператива, либо ТСЖ (в зависимости от того, какой у вас ОБТК) поровну, раздать их на членские взносы. или расходы на ремонт и все, без проблем.

    Дарья Кузнецова

    как решить вопрос с общим имуществом многоквартирного дома? если часть квартир приватизирована, а часть нет, кому это принадлежит, как решается этот вопрос, но особенно интересует подвал этого дома - в котором есть торговая площадь, магазин, который раньше был сданы в аренду горкомом по управлению городским имуществом, и сейчас часть квартир приватизирована, а часть нет, кто имеет право сдавать такое имущество в аренду, действительно ли нужно согласие всех жителей квартир приватизированных и негосударственных? приватизирован ???? (((

    Рослый Федор

    Обязательно ли собственникам многоквартирного дома регистрировать право долевой собственности в регистрационном центре? какова правовая основа?

    • если вы являетесь собственником квартиры в многоквартирном доме и оформили свое право, то какой тип прописки вам нужен, общие части уже ваши в доле, другое дело земельный участок под вашим домом , а тут нужно посмотреть "А оно тебе надо?"

    Громова Алина

    Как согласовать установку спутниковой антенны? (1 на фасад; 2 на крышу жилого дома)

    • Это согласие большинства владельцев и требуется.Фасад - тоже общая собственность. скорее всего так или иначе ... крыша принадлежит общему имуществу, которое обслуживается УК ... доступ на крышу только с разрешения УК, но разрешения не дает ...

    Евгений Адриянов

    Скажите, где проходит четкая граница между собственностью собственника и общей собственностью?

    • Перечень общего имущества многоквартирного дома указан в Жилищном кодексе РФ (межэтажные подъезды, коридоры, крыши, подвалы, лифты, распределительные щиты, земельный участок с жилым домом, общие бытовые сети (электрические сети). , горячий ...

    Максим Демидовский

    Можно ли принудить ЖЭК сделать текущий ремонт коридора в неприватизированной квартире? Деньги выплачиваются ежемесячно за текущий ремонт общего имущества многоквартирного дома.

    Раиса Беляева

    - вход в дом считается общим местом

  • Валентин Майнулов

    Если в многоквартирном доме сгорит частная собственность, что светит хозяину квартиры, где жить?

  • Миклашков Иван

    Кому принадлежит земельный участок под многоквартирным домом? Дом является собственностью жителей...

    Папуша Михаил

    Скажите, где четкое различие между собственностью собственника и общим имуществом в многоквартирном доме?

    • у вас на руках свидетельство о праве собственности и кадастровый план, паспорт БТИ - в нем указана схема вашего имущества, если в вашей квартире есть трубы воды, отопления, газа, электропроводка не только для Ваша квартира ...

Ты думаешь, что ты русский? Родились в СССР и думаете, что вы русский, украинец, белорус? Нет.Это неправда.

На самом деле вы русский, украинец или белорус. Но вы думаете, что вы еврей.

Игра? Неверное слово. Правильное слово - «импринтинг».

Новорожденный ассоциирует себя с теми чертами лица, которые он наблюдает сразу после рождения. Этот естественный механизм присущ большинству зрячих живых существ.

Первые несколько дней новорожденные в СССР видели свою мать минимум на кормление, и большую часть времени они видели лица персонала больницы.По странному совпадению они были (и остаются) в основном евреями. Прием дикий по своей сути и эффективности.

Все детство вы задавались вопросом, почему живете в окружении инородцев. Редкие евреи на вашем пути могли сделать с вами что угодно, потому что вы были привлечены к ним, а другие отталкивались. И даже сейчас могут.

Не исправить - импринтинг разовый и пожизненный. Это сложно понять, инстинкт сформировался, когда вы были еще очень далеки от умения формулировать.С того момента не сохранилось ни слов, ни подробностей. В глубине моей памяти остались только черты лица. Те черты, которые вы считаете своими.

3 комментария

Определим систему как объект, существование которого не подлежит сомнению.

Наблюдатель системы - это объект, который не является частью наблюдаемой системы, то есть он определяет ее существование, в том числе через факторы, не зависящие от системы.

С точки зрения системы, наблюдатель является источником хаоса - как управляющих воздействий, так и последствий наблюдательных измерений, которые не имеют причинно-следственной связи с системой.

Внутренний наблюдатель - это потенциально достижимый для системы объект, в отношении которого возможна инверсия каналов наблюдения и управления.

Внешний наблюдатель - это даже потенциально недостижимый для системы объект, расположенный за горизонтом событий системы (пространственным и временным).

Гипотеза № 1. Всевидящее око

Предположим, что наша Вселенная представляет собой систему и у нее есть внешний наблюдатель. Тогда наблюдательные измерения могут происходить, например, с помощью «гравитационного излучения», проникающего во Вселенную со всех сторон извне.Сечение захвата «гравитационного излучения» пропорционально массе объекта, и проекция «тени» от этого захвата на другой объект воспринимается как сила притяжения. Он будет пропорционален произведению масс объектов и обратно пропорционален расстоянию между ними, определяющему плотность «тени».

Захват «гравитационного излучения» объектом увеличивает его хаос и воспринимается нами как течение времени.Непрозрачный для «гравитационного излучения» объект, сечение захвата которого больше геометрического размера, выглядит как черная дыра внутри Вселенной.

Гипотеза № 2. Внутренний наблюдатель

Возможно, наша Вселенная наблюдает за собой. Например, с помощью пар квантовых запутанных частиц, разнесенных в пространстве в качестве эталонов. Тогда пространство между ними насыщается с вероятностью существования процесса, породившего эти частицы, достигая максимальной плотности на пересечении траекторий этих частиц.Наличие этих частиц также означает отсутствие достаточно большого сечения захвата на траекториях объектов, способных поглотить эти частицы. Остальные предположения остаются такими же, как и для первой гипотезы, за исключением:

Время

Внешнее наблюдение объекта, приближающегося к горизонту событий черной дыры, если «внешний наблюдатель» является определяющим фактором времени во Вселенной, замедлится ровно вдвое - тень черной дыры заблокирует ровно половину возможных траекторий движения. «Гравитационное излучение».Если «внутренний наблюдатель» является определяющим фактором, то тень будет блокировать всю траекторию взаимодействия, и течение времени для объекта, падающего в черную дыру, полностью остановится для обзора со стороны.

Также не исключена возможность комбинирования этих гипотез в той или иной пропорции.


% PDF-1.6 % 4338 0 объект > эндобдж xref 4338 172 0000000016 00000 н. 0000007650 00000 н. 0000007858 00000 п. 0000007988 00000 н. 0000008576 00000 н. 0000009375 00000 п. 0000009860 00000 н. 0000010305 00000 п. 0000010371 00000 п. 0000010628 00000 п. 0000011285 00000 п. 0000011540 00000 п. 0000012113 00000 п. 0000012226 00000 п. 0000012483 00000 п. 0000012980 00000 п. 0000013095 00000 п. 0000014916 00000 п. 0000016498 00000 п. 0000018146 00000 п. 0000019775 00000 п. 0000021407 00000 п. 0000022996 00000 п. 0000024565 00000 п. 0000026234 00000 п. 0000048110 00000 п. 0000064266 00000 п. 0000080078 00000 п. 0000080107 00000 п. 0000081342 00000 п. 0000089806 00000 п. 00000 00000 п. 00000 00000 п. 00000 00000 п. 00000

00000 н. 00000

00000 п. 00000 00000 п. 0000594550 00000 н. 0000620896 00000 н. 0000702191 00000 п. 0000740549 00000 н. 0000743684 00000 н. 0000743759 00000 н. 0000743839 00000 н. 0000743992 00000 н. 0000744120 00000 н. 0000744165 00000 н. 0000744303 00000 н. 0000744399 00000 н. 0000744444 00000 н. 0000744540 00000 н. 0000744585 00000 п. 0000744752 00000 н. 0000744871 00000 н. 0000744916 00000 н. 0000745046 00000 н. 0000745198 00000 н. 0000745344 00000 п. 0000745389 00000 п. 0000745550 00000 н. 0000745702 00000 н. 0000745821 00000 н. 0000745865 00000 н. 0000745990 00000 н. 0000746126 00000 н. 0000746209 00000 н. 0000746253 00000 п. 0000746342 00000 п. 0000746386 00000 п. 0000746430 00000 н. 0000746516 00000 н. 0000746561 00000 н. 0000746637 00000 н. 0000746781 00000 н. 0000746867 00000 н. 0000746912 00000 н. 0000747014 00000 н. 0000747149 00000 н. 0000747235 00000 н. 0000747279 00000 н. 0000747381 00000 п. 0000747426 00000 н. 0000747568 00000 н. 0000747613 00000 н. 0000747703 00000 н. 0000747748 00000 н. 0000747792 00000 н. 0000747837 00000 н. 0000747927 00000 н. 0000747972 00000 н. 0000748017 00000 п. 0000748062 00000 н. 0000748107 00000 н. 0000748193 00000 н. 0000748237 00000 н. 0000748313 00000 н. 0000748357 00000 н. 0000748401 00000 н. 0000748513 00000 н. 0000748558 00000 н. 0000748657 00000 н. 0000748821 00000 н. 0000748947 00000 н. 0000748992 00000 н. 0000749119 00000 п. 0000749164 00000 н. 0000749254 00000 н. 0000749299 00000 н. 0000749393 00000 н. 0000749438 00000 п. 0000749554 00000 н. 0000749599 00000 н. 0000749644 00000 н. 0000749689 00000 н. 0000749811 00000 н. 0000749856 00000 н. 0000749974 00000 н. 0000750019 00000 н. 0000750064 00000 н. 0000750165 00000 н. 0000750210 00000 н. 0000750289 00000 н. 0000750334 00000 н. 0000750446 00000 н. 0000750491 00000 н. 0000750594 00000 н. 0000750639 00000 п. 0000750755 00000 н. 0000750800 00000 н. 0000750914 00000 н. 0000750959 00000 н. 0000751109 00000 н. 0000751154 00000 н. 0000751303 00000 н. 0000751348 00000 н. 0000751447 00000 н. 0000751492 00000 н. 0000751599 00000 н. 0000751644 00000 н. 0000751689 00000 н. 0000751781 00000 н. 0000751826 00000 н. 0000751949 00000 н. 0000752103 00000 н. 0000752200 00000 н. 0000752245 00000 н. 0000752339 00000 н. 0000752384 00000 н. 0000752486 00000 н. 0000752531 00000 н. 0000752640 00000 н. 0000752685 00000 н. 0000752792 00000 н. 0000752837 00000 н. 0000752882 00000 н. 0000752927 00000 н. 0000753056 00000 н. 0000753101 00000 п. 0000753146 00000 н. 0000753232 00000 н. 0000753277 00000 н. 0000753373 00000 н. 0000753418 00000 п. 0000753463 00000 н. 0000753508 00000 н. 0000753695 00000 н. 0000753740 00000 н. 0000753972 00000 н. 0000754017 00000 н. 0000754062 00000 н. 0000007404 00000 н. bjBH

5019A-FTN4 | 1U | SuperServers | Продукция

Основные характеристики
• Устройство сетевой безопасности
• Сервер пограничных вычислений
• Сервер виртуализации

1.Процессор Intel® Atom® C3758,
с одним сокетом FCBGA 1310;
8-ядерный, TDP 25 Вт 2. 1x 3,5 "или 4x 2,5" внутренних отсека для дисков 3. 1 PCI-E 3.0 x4, 1 M.2 (M-ключ для
SSD, 2242/2280, PCI-E 3.0 x2 или SATA3) 4. До 256 ГБ ECC RDIMM DDR4
2400 МГц или 64 ГБ ECC / non-ECC
UDIMM в 4 слотах DIMM 5. 4 LAN 1GbE, 1 выделенная LAN IPMI 6. 2 USB 2.0, 1 VGA, 1 SuperDOM, TPM 7. 2 4-контактных вентилятора с ШИМ 40x28 мм, опционально
1x 4-контактный вентилятор 40x28 мм 8. Источник питания переменного и постоянного тока мощностью 200 Вт с низким уровнем шума.

Артикулы продукта
SYS-5019A-FTN4
  • SuperServer 5019A-FTN4 ( Черный )
Процессор / кэш
ЦП
  • Процессор Intel® Atom® C3758
  • FCBGA 1310 поддерживается
  • Поддержка TDP процессора 25 Вт
Системная память
Объем памяти
  • 4 разъема DDR4 DIMM
  • Поддерживает до 256 ГБ DDR4 ECC RDIMM
  • Поддерживает до 64 ГБ DDR4 ECC / non-ECC UDIMM
Тип памяти
  • 2400/2133/1866/1600 МГц ECC DDR4 SDRAM
Размеры DIMM
  • 64 ГБ, 32 ГБ, 16 ГБ, 8 ГБ, 4 ГБ
Напряжение памяти
Обнаружение ошибок
  • Исправляет однобитовые ошибки
  • Обнаруживает двухбитовые ошибки
    (с использованием памяти ECC)
Бортовые устройства
SATA
  • Контроллер SoC на 4 порта SATA3 (6 Гбит / с)
Сетевые контроллеры
  • Quad Gigabit Ethernet LAN через Intel® C3000 SoC
  • Очереди устройств виртуальной машины сокращают накладные расходы ввода-вывода
  • Поддерживает 10BASE-T, 100BASE-TX и 1000BASE-T, выход RJ45
  • 1 Realtek RTL8201N PHY (выделенный IPMI)
IPMI
  • Поддержка интеллектуального интерфейса управления платформой v.2,0
  • IPMI 2.0 с виртуальным носителем через LAN и поддержкой KVM-over-LAN
Графика
  • BMC интегрированный ASPEED AST2400
Ввод / вывод
SATA
LAN
  • 4 порта RJ45 Gigabit Ethernet LAN
  • 1 выделенный порт RJ45 LAN IPMI
USB
Последовательный порт
ДОМ
  • 1 разъем питания SATA DOM (диск на модуле)
VGA
Другое
Размеры и вес
Высота
Ширина
Глубина
Вес
  • Вес нетто: 8 фунтов (3.62 кг)
  • Масса брутто: 12 фунтов (5,44 кг)
Доступных цветов
Передняя панель
Кнопки
  • Кнопка включения / выключения
  • Кнопка сброса системы
Светодиоды
  • Индикатор питания
  • Индикатор активности жесткого диска
  • Индикаторы сетевой активности
  • Светодиодный индикатор системной информации
  • Информационный светодиод (темп., статус)
Слоты расширения
PCI-E
  • 1 слот PCI-E 3.0 x4
  • 1 M.2 PCI-E 3.0 x2, ключ M 2242/2280
Отсеки для дисков
Жесткий диск
  • 1x 3,5-дюймовые или 4x 2,5-дюймовые внутренние отсеки для жестких дисков (опционально) *
Системное охлаждение
Вентиляторы
  • 2x 40x28 мм 4-контактных вентилятора с ШИМ, опционально 1x 40x28 мм 4-контактный вентилятор с ШИМ
Источник питания
Источник питания переменного и постоянного тока мощностью 200 Вт с PFC
Напряжение переменного тока
  • 100 - 240 В, 50-60 Гц, 2.6 ампер макс
+ 5В
+ 5В в режиме ожидания
+ 12В
-12В
+ 3,3 В
Сертификация
Золотой сертификат
Системная BIOS
Тип BIOS
Функции BIOS
  • Plug and Play (PnP)
  • DMI 2.3
  • ACPI 5.0
  • Поддержка USB-клавиатуры
  • SMBIOS 2.7.1
  • UEFI
Операционная среда / соответствие
RoHS
Экологические характеристики.
  • Рабочая температура:
    от 0 ° C до 40 ° C (от 32 ° F до 104 ° F)
  • Температура хранения:
    от -40 ° C до 70 ° C (от -40 ° F до 158 ° F)
  • Относительная влажность при эксплуатации:
    от 8% до 90% (без конденсации)
  • Относительная влажность в нерабочем состоянии:
    от 5% до 95% (без конденсации)
См. Список деталей
Список деталей - (позиции в комплекте)

Номер детали
Кол-во
Описание
Материнская плата / Шасси MBD-A2SDi-8C-HLN4F
CSE-505-203B
1
1
Super A2SDi-8C-HLN4F Материнская плата
Шасси 1U
Кабель 1 CBL-0082L 1 Y-разъем, большой 4-контактный разъем для двух RA SATA-удлинитель 15 см, 18AWG
Кабель 2 CBL-0473L 2 SATA, INT, КРУГЛЫЙ, ST-ST, 21 см, 30AWG
ВЕНТИЛЯТОР 1 ВЕНТИЛЯТОР-0065L4 2 4-КОНТАКТНЫЙ ВЕНТИЛЯТОР ШИМ, 13K об / мин, 4028 мм для SC813MF, SC113M
Лоток (и) привода МСР-220-00051-0Н 2 Одноместный 2.5
Заднего стекла МСР-240-00091-0Н 2 Универсальный кронштейн для переходной платы 1U для стандартного шасси, HF, RoHS / REACH, PBF
Запчасти МСР-260-00085-0Б 1 Экран ввода-вывода 1U для A1SRM-LN7F на SC510 с прокладкой EMI, RoHS / REACH
Держатель вентилятора МСР-320-81302-0Б 3 Дополнительная кассета вентиляторов для одного вентилятора 40x28 мм в SC813T / SC813LT-single PWS (только кассета вентиляторов)
Запчасти МСР-340-00001-01 1 Пустой вентилятор 40x28 мм
Карта подъемника RSC-RR1U-E8 1 RSC-RR1U-E8
Источник питания PWS-203-1H 1 1U 200 Вт с несколькими выходами 80Plus Gold PWS
Список дополнительных деталей
Номер детали Кол-во Описание
Кронштейн жесткого диска МСР-220-00044-0Н Двойной 2.Кронштейн фиксированного жесткого диска 5 дюймов для SC502, 503, 510, 512, 515U
Комплект для монтажа в стойку МСР-290-50404-0Н Комплект для монтажа в стойку для CSE-504-203B
SuperDOM Supermicro SATA DOM Solutions [Подробнее]
Скрыть список деталей

* 1x 3,5 дюйма или 2x 2.5 "SATA3 с переходной платой

Фоторецепторные сенсорные реснички и цилиопатии: фокус на CEP290, RPGR и их взаимодействующие белки | Реснички

  • 1.

    Джейн Р., Пан Дж., Дрисколл Дж. А., Виснер Дж. В., Хуанг Т., Гунстен С.П., Ю Й, Броди С.Л.: Временная взаимосвязь между первичным и подвижным цилиогенезом в эпителиальных клетках дыхательных путей. Am J Respir Cell Mol Biol. 2010, 43: 731-739. 10.1165 / rcmb.2009-0328OC.

    PubMed Central CAS PubMed Google ученый

  • 2.

    Сорокин С.П. Реконструкции образования центриолей и цилиогенеза в легких млекопитающих. J Cell Sci. 1968, 3: 207-230.

    CAS PubMed Google ученый

  • 3.

    Berbari NF, O'Connor AK, Haycraft CJ, Yoder BK: первичная ресничка как комплексный сигнальный центр. Curr Biol. 2009, 19: R526-R535. 10.1016 / j.cub.2009.05.025.

    PubMed Central CAS PubMed Google ученый

  • 4.

    Taschner M, Bhogaraju S, Lorentzen E: Архитектура и функция белков комплекса IFT в цилиогенезе. Дифференциация. 2012, 83: S12-S22. 10.1016 / j.diff.2011.11.001.

    PubMed Central CAS PubMed Google ученый

  • 5.

    Wallingford JB, Mitchell B: Как ни странно это может показаться: многочисленные связи между передачей сигналов Wnt, полярностью планарных клеток и ресничками. Genes Dev. 2011, 25: 201-213. 10.1101 / gad.2008011.

    PubMed Central CAS PubMed Google ученый

  • 6.

    Lee JE, Gleeson JG: Системно-биологический подход к пониманию цилиопатических расстройств. Genome Med. 2011, 3: 59-10.1186 / gm275.

    PubMed Central PubMed Google ученый

  • 7.

    Ishikawa H, Marshall WF: Цилиогенез: построение антенны клетки. Nat Rev Mol Cell Biol. 2011, 12: 222-234. 10.1038 / nrm3085.

    CAS PubMed Google ученый

  • 8.

    Сильверман М.А., Леру М.Р.: Внутрилагеллярный транспорт и генерация динамических, структурно и функционально разнообразных ресничек. Trends Cell Biol. 2009, 19: 306-316. 10.1016 / j.tcb.2009.04.002.

    CAS PubMed Google ученый

  • 9.

    Сантос Н., Райтер Дж. Ф .: Создание и устранение: регуляция цилиогенеза позвоночных. Dev Dyn. 2008, 237: 1972–1981. 10.1002 / dvdy.21540.

    PubMed Central PubMed Google ученый

  • 10.

    Pedersen LB, Rosenbaum JL: Роль внутрифлагеллярного транспорта (IFT) в сборке, резорбции и передаче сигналов в ресничках. Curr Top Dev Biol. 2008, 85: 23-61.

    CAS PubMed Google ученый

  • 11.

    Гердес JM, Катсанис N: Функция ресничек и модуляция сигнала Wnt. Curr Top Dev Biol. 2008, 85: 175-195.

    CAS PubMed Google ученый

  • 12.

    Eggenschwiler JT, Anderson KV: Реснички и передача сигналов в процессе развития.Annu Rev Cell Dev Biol. 2007, 23: 345-373. 10.1146 / annurev.cellbio.23.0.123249.

    PubMed Central CAS PubMed Google ученый

  • 13.

    Доу Х.Р., Фарр Х., Галл К. Морфогенез и миграция центриолей / базального тельца во время цилиогенеза в клетках животных. J Cell Sci. 2007, 120 (Pt 1): 7-15.

    CAS PubMed Google ученый

  • 14.

    Рой С: Подвижная ресничка в развитии и болезни: новые открытия.BioEssays. 2009, 31 (7): 694-699. 10.1002 / bies.2001.

    CAS PubMed Google ученый

  • 15.

    Хои Д.А., Даунс М.Э., Джейкобс К.Р.: Механика первичной реснички: сложная структура со сложной функцией. J Biomech. 2012, 45: 17-26. 10.1016 / j.jbiomech.2011.08.008.

    PubMed Central PubMed Google ученый

  • 16.

    Ван дер Хайден К., Егорова А.Д., Пельманн Р.Э., Вентцель Дж. Дж., Хирк Б.П.: Роль первичных ресничек как детекторов потока в сердечно-сосудистой системе.Int Rev Cell Mol Biol. 2011, 290: 87-119.

    CAS PubMed Google ученый

  • 17.

    Sattar S, Gleeson JG: Цилиопатии в развитии нейронов: клинический подход к исследованию синдрома Жубера и расстройств, связанных с синдромом Жубера. Dev Med Child Neurol. 2011, 53: 793-798. 10.1111 / j.1469-8749.2011.04021.x.

    PubMed Central PubMed Google ученый

  • 18.

    Louvi A, Grove EA: Реснички в ЦНС: тихая органелла занимает центральное место. Нейрон. 2011, 69: 1046-1060. 10.1016 / j.neuron.2011.03.002.

    PubMed Central CAS PubMed Google ученый

  • 19.

    Kartagener M: Zur pathogenese der bronchiektasien: bronchiektasien bei situs viscerum inversus. Бейтр Клин Туберк. 1933, 83: 489-501. 10.1007 / BF02141468.

    Google ученый

  • 20.

    Vague J, Farnarier G, G S: [синдром Лоуренса – Муна – Барде – Бидла]. Rev Otoneuroophtalmol. 1950, 22: 60-63.

    CAS PubMed Google ученый

  • 21.

    Joubert M, Eisenring JJ, Andermann F: Семейная дисгенезия червя: синдром гипервентиляции, аномальных движений глаз и задержки. Неврология. 1968, 18: 302-303.

    CAS PubMed Google ученый

  • 22.

    Eley L, Yates LM, Goodship JA: Реснички и болезнь. Curr Opin Genet Dev. 2005, 15: 308-314. 10.1016 / j.gde.2005.04.008.

    CAS PubMed Google ученый

  • 23.

    Бадано Дж. Л., Катсанис Н.: Жизнь без центриолей: реснички в центре внимания. Клетка. 2006, 125: 1228-1230. 10.1016 / j.cell.2006.06.013.

    CAS PubMed Google ученый

  • 24.

    Афзелиус Б.А.: Генетические и ультраструктурные аспекты синдрома неподвижных ресничек.Am J Hum Genet. 1981, 33: 852-864.

    PubMed Central CAS PubMed Google ученый

  • 25.

    Билс П.Л., Эльчиоглу Н., Вульф А.С., Паркер Д., Флинтер Ф.А.: Новые критерии улучшенной диагностики синдрома Барде – Бидла: результаты опроса населения. J Med Genet. 1999, 36: 437-446.

    PubMed Central CAS PubMed Google ученый

  • 26.

    Waters AM, Beales PL: Синдром Барде – Бидла.GeneReviews. Отредактировано: Pagon RA, Bird TD, Dolan CR, Stephens K. 2003, Вашингтонский университет, 14 июля [обновлено 29 сентября 2011 г.]

    Google ученый

  • 27.

    Parisi MA: Клинические и молекулярные особенности синдрома Жубера и связанных с ним расстройств. Am J Med Genet C Semin Med Genet. 2009, 151C: 326-340. 10.1002 / ajmg.c.30229.

    PubMed Central CAS PubMed Google ученый

  • 28.

    Otto EA, Tory K, Attanasio M, Zhou W, Chaki M, Paruchuri Y, Wise EL, Wolf MT, Utsch B, Becker C, Nurnberg G, Nurnberg P, Nayir A, Saunier S, Antignac C, Hildebrandt F: Hypomorphic мутации в мекелине (MKS3 / TMEM67) вызывают нефронофтиз с фиброзом печени (NPHP11). J Med Genet. 2009, 46: 663-670. 10.1136 / jmg.2009.066613.

    CAS PubMed Google ученый

  • 29.

    Sun X, Pawlyk B, Xu X, Liu X, Булгаков О.В., Adamian M, Sandberg MA, Khani SC, Tan MH, Smith AJ, Ali RR, Li T: генная терапия с промотором, нацеленным на оба стержня. а колбочки спасают дегенерацию сетчатки, вызванную мутациями AIPL1.Gene Ther. 2010, 17: 117-131. 10.1038 / gt.2009.104.

    PubMed Central CAS PubMed Google ученый

  • 30.

    Чанг Б., Ханна Х, Хоуз Н., Джимено Д., Хе С., Лилло С., Парапурам С.К., Ченг Х, Скотт А., Херд Р.Э., Сайер Дж.А., Отто Э.А., Аттанасио М., О'Тул Дж. Ф., Jin G, Shou C, Hildebrandt F, Williams DS, Heckenlively JR, Swaroop A: делеция в рамке считывания нового центросомного / цилиарного белка CEP290 / NPHP6 нарушает его взаимодействие с RPGR и приводит к раннему началу дегенерации сетчатки у мышей rd16.Hum Mol Genet. 2006, 15: 1847-1857. 10.1093 / hmg / ddl107.

    PubMed Central CAS PubMed Google ученый

  • 31.

    Рэйчел Р.А., Мэй-Симера Х.Л., Велери С., Гото Н., Чой Б.А., Мурга-Замаллоа С., Макинтайр Дж. С., Марек Дж., Лопес И., Хакетт А.Н., Брукс М., ден Холландер А.И., Билс П.Л., Ли Т., Якобсон С.Г., Суд Р., Мартенс Дж. Р., Лю П., Фридман Т. Б., Ханна Х., Коенекоп Р.К., Келли М.В., Сваруп А. Комбинация аллелей цилиопатии Cep290 и Mkks у мышей устраняет сенсорные дефекты и восстанавливает цилиогенез.J Clin исследования. 2012, 122: 1233-1245. 10.1172 / JCI60981.

    PubMed Central CAS PubMed Google ученый

  • 32.

    Mockel A, Perdomo Y, Stutzmann F, Letsch J, Marion V, Dollfus H: дистрофия сетчатки при синдроме Барде-Бидля и связанных с ним синдромальных цилиопатиях. Prog Retin Eye Res. 2011, 30: 258-274. 10.1016 / j.preteyeres.2011.03.001.

    CAS PubMed Google ученый

  • 33.

    Ramamurthy V, Cayouette M: Развитие и заболевание ресничек фоторецепторов. Clin Genet. 2009, 76: 137-145. 10.1111 / j.1399-0004.2009.01240.x.

    CAS PubMed Google ученый

  • 34.

    Адамс Н.А., Авадеин А., Тома Х.С.: Цилиопатии сетчатки. Ophthalmic Genet. 2007, 28: 113-125. 10.1080 / 13816810701537424.

    CAS PubMed Google ученый

  • 35.

    Domire JS, Green JA, Lee KG, Johnson AD, Askwith CC, Mykytyn K: дофаминовый рецептор 1 локализуется в ресничках нейронов в динамическом процессе, который требует белков синдрома Барде-Бидла. Cell Mol Life Sci. 2011, 68: 2951-2960. 10.1007 / s00018-010-0603-4.

    PubMed Central CAS PubMed Google ученый

  • 36.

    Green JA, Mykytyn K: Передача нейрональных цилиарных сигналов в гомеостазе и болезни. Cell Mol Life Sci. 2010, 67: 3287-3297.10.1007 / s00018-010-0425-4.

    PubMed Central CAS PubMed Google ученый

  • 37.

    Доэрти Д. Синдром Жубера: понимание развития мозга, биологии ресничек и сложных заболеваний. Semin Pediatr Neurol. 2009, 16: 143-154. 10.1016 / j.spen.2009.06.002.

    PubMed Central PubMed Google ученый

  • 38.

    Whitfield JF: Нейрональная первичная ресничка - внесинаптическое сигнальное устройство.Сотовый сигнал. 2004, 16: 763-767. 10.1016 / j.cellsig.2003.12.002.

    CAS PubMed Google ученый

  • 39.

    Whitfield JF, Chakravarthy BR: Нейрональная первичная ресничка: движущая сила нейрогенеза и формирования памяти в зубчатой ​​извилине гиппокампа ?. Сотовый сигнал. 2009, 21: 1351-1355. 10.1016 / j.cellsig.2009.02.013.

    PubMed Google ученый

  • 40.

    Louie CM, Gleeson JG: Генетические основы синдрома Жубера и связанных с ним нарушений развития мозжечка.Hum Mol Genet. 2005, 14: 235-242. 10.1093 / hmg / ddi264.

    Google ученый

  • 41.

    Миллен К.Дж., Глисон Дж.Г.: Развитие и болезнь мозжечка. Curr Opin Neurobiol. 2008, 18: 12-19. 10.1016 / j.conb.2008.05.010.

    PubMed Central CAS PubMed Google ученый

  • 42.

    Спасский Н., Хан Ю.Г., Агилар А., Штрел Л., Бессе Л., Лаклеф С., Рос М.Р., Гарсия-Вердуго Дж. М., Альварес-Буйлла А. Первичные реснички необходимы для развития мозжечка и Shh-зависимого расширения пул предшественников.Dev Biol. 2008, 317: 246-259. 10.1016 / j.ydbio.2008.02.026.

    PubMed Central CAS PubMed Google ученый

  • 43.

    Шиба Д., Йокояма Т.: Цилиарная переходная зона и нефроцистины. Дифференциация. 2012, 83: S91-S96. 10.1016 / j.diff.2011.11.006. Epub 2011 12 декабря

    CAS PubMed Google ученый

  • 44.

    Winyard P, Jenkins D: Предполагаемая роль ресничек при поликистозе почек.Biochim Biophys Acta. 2011, 1812: 1256-1262. 10.1016 / j.bbadis.2011.04.012.

    CAS PubMed Google ученый

  • 45.

    Takiar V, Caplan MJ: Поликистоз почек: патогенез и возможные методы лечения. Biochim Biophys Acta. 2011, 1812: 1337-1343. 10.1016 / j.bbadis.2010.11.014.

    PubMed Central CAS PubMed Google ученый

  • 46.

    D'Angelo A, Franco B: Первичные реснички в различных тканях - уроки пациентов и животных моделей.Педиатр Нефрол. 2011, 26: 655-662. 10.1007 / s00467-010-1650-7.

    PubMed Google ученый

  • 47.

    Dalagiorgou G, Basdra EK, Papavassiliou AG: Полицистин-1: функционирует как механосенсор. Int J BiochemCell Biol. 2010, 42: 1610-1613. 10.1016 / j.biocel.2010.06.017.

    CAS Google ученый

  • 48.

    Hurd TW, Hildebrandt F: Механизмы нефронофтиза и родственных цилиопатий.Нефрон Опыт Нефрол. 2011, 118: e9-e14. 10.1159 / 000320888.

    PubMed Google ученый

  • 49.

    Hildebrandt F, Attanasio M, Otto E: Nephronophthisis: болезненные механизмы цилиопатии. J Am Soc Nephrol. 2009, 20: 23-35. 10.1681 / ASN.2008050456.

    PubMed Central CAS PubMed Google ученый

  • 50.

    Lancaster MA, Louie CM, Silhavy JL, Sintasath L, Decambre M, Nigam SK, Willert K, Gleeson JG: Нарушение передачи сигналов Wnt-бета-катенина нарушает почечный гомеостаз у взрослых и приводит к цилиопатии кистозных почек.Nat Med. 2009, 15: 1046-1054. 10.1038 / нм.2010.

    PubMed Central CAS PubMed Google ученый

  • 51.

    Гунай-Айгун М: Заболевания печени и почек при цилиопатиях. Am J Med Genet C Semin Med Genet. 2009, 151С: 296-306. 10.1002 / ajmg.c.30225.

    PubMed Central CAS PubMed Google ученый

  • 52.

    Ларуссо Н.Ф., Масюк Т.В.: Роль ресничек в регуляции оттока желчи.Dig Dis. 2011, 29: 6-12. 10.1159 / 000324121.

    PubMed Central PubMed Google ученый

  • 53.

    Масюк Т., Масюк А., ЛаРуссо Н. Холангиоцилиопатии: генетика, молекулярные механизмы и потенциальные методы лечения. Курр Опин Гастроэнтерол. 2009, 25: 265-271. 10.1097 / MOG.0b013e328328f4ff.

    CAS PubMed Google ученый

  • 54.

    Масюк А.И., Масюк Т.В., ЛаРуссо Н.Ф .: Первичные реснички холангиоцитов в здоровье и заболеваниях печени.Dev Dyn. 2008, 237: 2007-2012. 10.1002 / dvdy.21530.

    PubMed Central CAS PubMed Google ученый

  • 55.

    Масюк А.И., Градилон С.А., Баналес Ю.М., Хуанг Б.К., Масюк Т.В., Ли С.О., Сплинтер П.Л., Строп А.Дж., Ларуссо Н.Ф .: Первичные реснички холангиоцитов представляют собой хемосенсорные органеллы, которые обнаруживают билиарные нуклеотиды через пуринергические рецепторы P2Y12. Am J Physiol Gastrointest Liver Physiol. 2008, 295: G725-G734. 10.1152 / ajpgi..2008.

    PubMed Central CAS PubMed Google ученый

  • 56.

    Gradilone SA, Masyuk AI, Splinter PL, Banales JM, Huang BQ, Tietz PS, Masyuk TV, Larusso NF: реснички холангиоцитов экспрессируют TRPV4 и обнаруживают изменения тоничности просвета, вызывающие секрецию бикарбоната. Proc Natl Acad Sci U S. A. 2007, 104: 19138-19143. 10.1073 / pnas.0705964104.

    PubMed Central CAS PubMed Google ученый

  • 57.

    Масюк А.И., Масюк Т.В., Splinter PL, Huang BQ, Stroope AJ, LaRusso NF: Реснички холангиоцитов обнаруживают изменения в потоке люминальной жидкости и передают их во внутриклеточную сигнализацию Ca2 + и cAMP. Гастроэнтерология. 2006, 131: 911-920. 10.1053 / j.gastro.2006.07.003.

    PubMed Central CAS PubMed Google ученый

  • 58.

    Bimonte S, De Angelis A, Quagliata L, Giusti F, Tammaro R, Dallai R, Ascenzi MG, Diez-Roux G, Franco B: Ofd1 требуется для формирования паттерна зачатков конечностей и развития эндохондральных костей.Dev Biol. 2011, 349: 179-191. 10.1016 / j.ydbio.2010.09.020.

    CAS PubMed Google ученый

  • 59.

    Marion V, Stutzmann F, Gerard M, De Melo C, Schaefer E, Claussmann A, Helle S, Delague V, Souied E, Barrey C, Verloes A, Stoetzel C, Dollfus H: секвенирование экзома выявляет мутации в LZTFL1, BBSome и сглаженном регуляторе трафика, в семье с синдромом Bardet-Biedl с situs inversus и инсерционной полидактилией.J Med Genet. 2012, 49: 317-21. 10.1136 / jmedgenet-2012-100737. Epub 2012 17 апреля

    PubMed Google ученый

  • 60.

    Berbari NF, Johnson AD, Lewis JS, Askwith CC, Mykytyn K: Идентификация последовательностей локализации ресничек внутри третьей внутриклеточной петли рецепторов, связанных с G-белком. Mol Biol Cell. 2008, 19: 1540-1547. 10.1091 / mbc.E07-09-0942.

    PubMed Central CAS PubMed Google ученый

  • 61.

    Андерсон К. Т., Кастильо А. Б., Бругманн С. А., Хелмс Дж. А., Якобс С. Р., Стернс Т.: Первичные реснички: клеточные сенсоры для скелета. Анат Рек. 2008, 291: 1074-1078. 10.1002 / ar.20754.

    Google ученый

  • 62.

    Мэлоун А.М., Андерсон СТ, Стернс Т., Джейкобс К.Р.: Первичные реснички в кости. J MusculoskeletNeuronal Interact. 2007, 7: 301-

    CAS Google ученый

  • 63.

    Мэлоун AM, Андерсон CT, Tummala P, Kwon RY, Johnston TR, Stearns T, Jacobs CR: Первичные реснички опосредуют механочувствительность в костных клетках с помощью кальций-независимого механизма.Proc Natl Acad Sci U S. A. 2007, 104: 13325-13330. 10.1073 / pnas.0700636104.

    PubMed Central CAS PubMed Google ученый

  • 64.

    Haycraft CJ, Zhang Q, Song B, Jackson WS, Detloff PJ, Serra R, Yoder BK: Внутрилагаличный транспорт важен для формирования эндохондральной кости. Разработка. 2007, 134: 307-316. 10.1242 / dev.02732.

    CAS PubMed Google ученый

  • 65.

    Лю А., Ван Б., Нисвандер Л.А.: Внутрилагеллярные транспортные белки мыши регулируют как активаторные, так и репрессорные функции факторов транскрипции Gli. Разработка. 2005, 132: 3103-3111. 10.1242 / dev.01894.

    CAS PubMed Google ученый

  • 66.

    Weatherbee SD, Niswander LA, Anderson KV: Модель на мышах для синдрома Меккеля показывает, что Mks1 необходим для цилиогенеза и передачи сигналов Hedgehog. Hum Mol Genet. 2009, 18: 4565-4575.10.1093 / hmg / ddp422.

    PubMed Central CAS PubMed Google ученый

  • 67.

    Каттанео I, Кондорелли Л., Терринони А.Р., Антига Л., Сангалли Ф., Ремуцци А. Напряжение сдвига обращает вспять образование купола в сливающихся почечных канальцевых клетках. Cell Physiol Biochem. 2011, 28: 673-682. 10.1159 / 000335813.

    CAS PubMed Google ученый

  • 68.

    Clement CA, Kristensen SG, Mollgard K, Pazour GJ, Yoder BK, Larsen LA, Christensen ST: первичная ресничка координирует ранний кардиогенез и передачу сигналов hedgehog в дифференцировке кардиомиоцитов.J Cell Sci. 2009, 122 (Pt 17): 3070-3082.

    PubMed Central CAS PubMed Google ученый

  • 69.

    You Y, Huang T, Richer EJ, Schmidt JE, Zabner J, Borok Z, Brody SL: Роль f-box фактора foxj1 в дифференцировке реснитчатых эпителиальных клеток дыхательных путей. Am J Physiol Lung Cell Mol Physiol. 2004, 286: L650-L657.

    CAS PubMed Google ученый

  • 70.

    Patel AC, Brody SL, Stappenbeck TS, Holtzman MJ: Отслеживание происхождения клеток для повторного открытия (снова) перехода от реснитчатых к слизистым клеткам. Amer J Respir Cell Mol Biol. 2011, 44: 261-263.

    CAS Google ученый

  • 71.

    Brody SL, Yan XH, Wuerffel MK, Song SK, Shapiro SD: Цилиогенез и дефекты оси слева-направо у мышей с нулевым фактором вилки HFH-4. Am J Respir Cell Mol Biol. 2000, 23: 45-51.

    CAS PubMed Google ученый

  • 72.

    Horner VL, Caspary T: Нарушение передачи сигналов BMP дорсальной нервной трубки в мутанте ресничек Arl13b hnn происходит из-за аномальной передачи сигналов Shh. Dev Biol. 2011, 355: 43-54. 10.1016 / j.ydbio.2011.04.019.

    PubMed Central CAS PubMed Google ученый

  • 73.

    Murdoch JN, Copp AJ: Взаимосвязь между звуковой передачей сигналов Hedgehog, ресничками и дефектами нервной трубки. Врожденные пороки Res A Clin Mol Teratol. 2010, 88: 633-652. 10.1002 / bdra.20686.

    PubMed Central CAS PubMed Google ученый

  • 74.

    Росс AJ, May-Simera H, Eichers ER, Kai M, Hill J, Jagger DJ, Leitch CC, Chapple JP, Munro PM, Fisher S, Tan PL, Phillips HM, Leroux MR, Henderson DJ, Мердок Дж. Н., Копп А. Дж., Элиот М. М., Лупски Дж. Р., Кемп Д. Т., Дольфус Х., Тада М., Катсанис Н., Фордж А., Билс П. Л.: Нарушение цилиарных белков синдрома Барде-Бидла нарушает полярность плоских клеток у позвоночных. Нат Жене.2005, 37: 1135-1140. 10.1038 / ng1644.

    CAS PubMed Google ученый

  • 75.

    Ян Дж., Лю Х, Чжао Й, Адамян М., Павлик Б., Сан Икс, Макмиллан Д. Р., Либерман М. С., Ли Т. Удаление длинной изоформы вихря разрушает белковый комплекс USh3 и вызывает потерю зрения и слуха. PLoS Genet. 2010, 6: e1000955-10.1371 / journal.pgen.1000955.

    PubMed Central PubMed Google ученый

  • 76.

    Петерс К.Р., Паладе Г.Е., Шнайдер Б.Г., Папермастер Д.С.: Тонкая структура комплекса перицилиарного гребня палочек сетчатки лягушки, выявленная с помощью сканирующей электронной микроскопии сверхвысокого разрешения. J Cell Biol. 1983, 96: 265-276. 10.1083 / jcb.96.1.265.

    CAS PubMed Google ученый

  • 77.

    Ghossoub R, Molla-Herman A, Bastin P, Benmerah A: Ресничный карман: когда-то забытый мембранный домен в основании ресничек. Biol Cell.2011, 103: 131-144. 10.1042 / BC20100128.

    PubMed Google ученый

  • 78.

    Otto EA, Hurd TW, Airik R, Chaki M, Zhou W, Stoetzel C, Patil SB, Levy S, Ghosh AK, Murga-Zamalloa CA, van Reeuwijk J, Letteboer SJ, Sang L, Giles RH , Лю К., Коэн К.Л., Эстрада-Кускано А., Коллин Р.В., Маклафлин Х.М., Хелд С., Касануки Дж. М., Рамасвами Дж., Конте Дж., Лопес И., Уошберн Дж., Макдональд Дж., Ху Дж., Ямасита Ю., Махер Э. Р., Гуай- Woodford LM и др.: Захват экзома-кандидата идентифицирует мутацию SDCCAG8 как причину ретинально-почечной цилиопатии.Нат Жене. 2010, 42: 840-850. 10,1038 / нг.662.

    PubMed Central CAS PubMed Google ученый

  • 79.

    Омори Y, Chaya T, Katoh K, Kajimura N, Sato S, Muraoka K, Ueno S, Koyasu T, Kondo M, Furukawa T. Отрицательная регуляция длины ресничек с помощью киназы, связанной с цилиарными мужскими половыми клетками ( Mak) необходим для выживания фоторецепторов сетчатки. Proc Natl Acad Sci U S. A. 2010, 107: 22671-22676. 10.1073 / pnas.1009437108.

    PubMed Central CAS PubMed Google ученый

  • 80.

    Hong DH, Yue G, Adamian M, Li T: белок, взаимодействующий с регулятором GTPase (RPGRr) пигментного ретинита, стабильно связан с аксонемой цилиарного рецептора и прикрепляет RPGR к соединительной ресничке. J Biol Chem. 2001, 276 (15): 12091-12099. 10.1074 / jbc.M00

    00.

    CAS PubMed Google ученый

  • 81.

    Pawlyk BS, Smith AJ, Buch PK, Adamian M, Hong DH, Sandberg MA, Ali RR, Li T: Генная заместительная терапия спасает дегенерацию фоторецепторов в мышиной модели врожденного амавроза Лебера без RPGRIP.Инвестируйте Ophthalmol Vis Sci. 2005, 46: 3039-3045. 10.1167 / iovs.05-0371.

    PubMed Google ученый

  • 82.

    Zhao Y, Hong DH, Pawlyk B, Yue G, Adamian M, Grynberg M, Godzik A, Li T: белок, взаимодействующий с регулятором GTPase (RPGR) пигментного ретинита: подчиняет функцию RPGR и участвует в морфогенезе диска . Proc Natl Acad Sci U S. A. 2003, 100: 3965-3970. 10.1073 / pnas.0637349100.

    PubMed Central CAS PubMed Google ученый

  • 83.

    Westfall JE, Hoyt C, Liu Q, Hsiao YC, Pierce EA, Page-McCaw PS, Ferland RJ: дегенерация сетчатки и нарушение формирования внешнего сегмента фоторецептора у мышей с целенаправленной делецией гена синдрома Жубера, Ahi1. J Neurosci. 2010, 30: 8759-8768. 10.1523 / JNEUROSCI.5229-09.2010.

    PubMed Central CAS PubMed Google ученый

  • 84.

    Holopainen JM, Cheng CL, Molday LL, Johal G, Coleman J, Dyka F, Hii ​​T., Ahn J, Molday RS: Взаимодействие и локализация пигментного белка RP2 ретинита и NSF в фоторецепторных клетках сетчатки.Биохимия. 2010, 49: 7439-7447. 10.1021 / bi1005249.

    PubMed Central CAS PubMed Google ученый

  • 85.

    Болдт К., Манс Д.А., Вон Дж., Ван Ривейк Дж., Фогт А., Кинкл Н., Леттебоер С.Дж., Хикс В.Л., Херд Р.Э., Наггерт Дж. К., Тексье Ю., ден Холландер А.И., Коенекоп Р.К., Беннетт Дж., Cremers FP, Gloeckner CJ, Nishina PM, Roepman R, Ueffing M: Нарушение внутрижладжкового транспорта белков в ресничках фоторецепторов вызывает врожденный амавроз Лебера у людей и мышей.J Clin Invest. 2011, 121: 2169-2180. 10.1172 / JCI45627.

    PubMed Central CAS PubMed Google ученый

  • 86.

    Chuang JZ, Zhao Y, Sung CH: SARA-регулируемое везикулярное нацеливание лежит в основе формирования светочувствительной органеллы в палочках млекопитающих. Клетка. 2007, 130 (3): 535-547. 10.1016 / j.cell.2007.06.030.

    CAS PubMed Google ученый

  • 87.

    Kulaga HM, Leitch CC, Eichers ER, Badano JL, Lesemann A, Hoskins BE, Lupski JR, Beales PL, Reed RR, Katsanis N: потеря белков BBS вызывает аносмию у людей и дефекты структуры обонятельных ресничек и работать с мышью.Нат Жене. 2004, 36 (9): 994-998. 10.1038 / ng1418.

    CAS PubMed Google ученый

  • 88.

    Sedmak T, Wolfrum U: Внутрилагеллярные транспортные молекулы в ресничных и нецилиарных клетках сетчатки. J Cell Biol. 2010, 189: 171-186. 10.1083 / jcb.200

    5.

    PubMed Central CAS PubMed Google ученый

  • 89.

    Cideciyan AV, Rachel RA, Aleman TS, Swider M, Schwartz SB, Sumaroka A, Roman AJ, Stone EM, Jacobson SG, Swaroop A: Конические фоторецепторы являются основными мишенями для генной терапии NPHP5 (IQCB1) или слепота по NPHP6 (CEP290): создание мышей-гипоморфа Nphp6, имитирующих цилиопатию сетчатки у человека.Hum Mol Genet. 2011, 20: 1411-1423. 10.1093 / hmg / ddr022.

    PubMed Central CAS PubMed Google ученый

  • 90.

    McEwen DP, Koenekoop RK, Khanna H, Jenkins PM, Lopez I, Swaroop A, Martens JR: Гипоморфные мутации CEP290 / NPHP6 приводят к аносмии, вызванной селективной потерей G-белков в ресничках обонятельных сенсорных нейронов. Proc Natl Acad Sci U S. A. 2007, 104: 15917-15922. 10.1073 / pnas.0704140104.

    PubMed Central CAS PubMed Google ученый

  • 91.

    Murga-Zamalloa CA, Ghosh AK, Patil SB, Reed NA, Chan LS, Davuluri S, Peranen J, Hurd TW, Rachel RA, Khanna H: Накопление белка, ингибирующего киназу Raf-1 (Rkip), связано с Cep290- опосредованная дегенерация фоторецепторов при цилиопатиях. J Biol Chem. 2011, 286: 28276-28286. 10.1074 / jbc.M111.237560.

    PubMed Central CAS PubMed Google ученый

  • 92.

    Hong DH, Pawlyk B, Sokolov M, Strissel KJ, Yang J, Tulloch B, Wright AF, Arshavsky VY, Li T: изоформы RPGR в фоторецепторах, соединяющих реснички и переходную зону подвижных ресничек.Инвестируйте Ophthalmol Vis Sci. 2003, 44: 2413-2421. 10.1167 / iovs.02-1206.

    PubMed Google ученый

  • 93.

    Brunner S, Skosyrski S, Kirschner-Schwabe R, Knobeloch KP, Neidhardt J, Feil S, Glaus E, Luhmann UF, Ruther K, Berger W. генетический фон. Инвестируйте Ophthalmol Vis Sci. 2010, 51: 1106-1115. 10.1167 / iovs.08-2742.

    PubMed Google ученый

  • 94.

    Hong DH, Pawlyk BS, Adamian M, Sandberg MA, Li T: единственный сокращенный вариант RPGR-ORF15 восстанавливает функцию RPGR in vivo. Инвестируйте Ophthalmol Vis Sci. 2005, 46: 435-441. 10.1167 / iovs.04-1065.

    PubMed Google ученый

  • 95.

    Hong DH, Pawlyk BS, Shang J, Sandberg MA, Berson EL, Li T: Модель мышей с дефицитом регулятора GTPase пигментного ретинита (RPGR) для X-связанного пигментного ретинита (RP3). Proc Natl Acad Sci U S A.2000, 97: 3649-3654. 10.1073 / pnas.97.7.3649.

    PubMed Central CAS PubMed Google ученый

  • 96.

    Хош Дж, Лоренц Б., Стигер К.: RPGR: роль в ресничке фоторецепторов, заболевании сетчатки глаза человека и генной терапии. Ophthalmic Genet. 2011, 32: 1-11. 10.3109 / 13816810.2010.535889.

    CAS PubMed Google ученый

  • 97.

    Киршнер Р., Розенберг Т., Шульц-Хайенброк Р., Ленцнер С., Фейл С., Ропман Р., Кремерс Ф. П., Роперс Х. Х., Бергер В. Исследования транскрипции RPGR в тканях мыши и человека выявили специфичную для сетчатки изоформу, которая нарушается у пациента с пигментным Х-сцепленным ретинитом.Hum Mol Genet. 1999, 8: 1571-1578. 10.1093 / hmg / 8.8.1571.

    CAS PubMed Google ученый

  • 98.

    Мавлютов Т.А., Чжао Х., Феррейра П.А.: Видоспецифическая субклеточная локализация изоформ RPGR и RPGRIP: последствия для фенотипической изменчивости врожденных ретинопатий среди видов. Hum Mol Genet. 2002, 11: 1899-1907. 10.1093 / hmg / 11.16.1899.

    CAS PubMed Google ученый

  • 99.

    Murga-Zamalloa C, Swaroop A, Khanna H: Мультибелковые комплексы регулятора GTPase пигментного ретинита (RPGR), цилиарного белка, мутировавшего в X-сцепленном пигментном ретините (XLRP). Adv Exp Med Biol. 2010, 664: 105-114. 10.1007 / 978-1-4419-1399-9_13.

    PubMed Central CAS PubMed Google ученый

  • 100.

    Arts HH, Doherty D, van Beersum SE, Parisi MA, Letteboer SJ, Gorden NT, Peters TA, Marker T, Voesenek K, Kartono A, Ozyurek H, Farin FM, Kroes HY, Wolfrum U, Brunner HG, Cremers FP, Glass IA, Knoers NV, Roepman R: Мутации в гене, кодирующем белок базального тела RPGRIP1L, взаимодействующий с нефроцистином-4, вызывают синдром Жубера.Нат Жене. 2007, 39: 882-888. 10.1038 / ng2069.

    CAS PubMed Google ученый

  • 101.

    Brancati F, Travaglini L, Zablocka D, Boltshauser E, Accorsi P, Montagna G, Silhavy JL, Barrano G, Bertini E, Emma F, Rigoli L, Dallapiccola B, Gleeson JG, Valente EM мутации: RPGRIP1 мутации в основном связаны с церебелло-почечным фенотипом расстройств, связанных с синдромом Жубера. Clin Genet. 2008, 74: 164-170. 10.1111 / j.1399-0004.2008.01047.x.

    PubMed Central CAS PubMed Google ученый

  • 102.

    Delous M, Baala L, Salomon R, Laclef C, Vierkotten J, Tory K, Golzio C, Lacoste T, Besse L, Ozilou C, Moutkine I, Hellman NE, Anselme I, Silbermann F, Vesque C , Gerhardt C, Rattenberry E, Wolf MT, Gubler MC, Martinovic J, Encha-Razavi F, Boddaert N, Gonzales M, Macher MA, Nivet H, Champion G, Bertheleme JP, Niaudet P, McDonald F, Hildebrandt F, et al. : Цилиарный ген RPGRIP1L мутирован при церебелло-окуло-почечном синдроме (синдром Жубера тип B) и синдроме Меккеля.Нат Жене. 2007, 39: 875-881. 10.1038 / ng2039.

    CAS PubMed Google ученый

  • 103.

    Khanna H, Davis EE, Murga-Zamalloa CA, Estrada-Cuzcano A, Lopez I, den Hollander AI, Zonneveld MN, Othman MI, Waseem N, Chakarova CF, Maubaret C, Diaz-Font A, MacDonald Я, Музни Д.М., Уиллер Д.А., Морган М., Льюис Л.Р., Логан CV, Тан П.Л., Бир М.А., Инглхерн К.Ф., Льюис Р.А., Якобсон С.Г., Бергманн С., Билс П.Л., Атти-Битач Т., Джонсон Калифорния, Отто Е.А., Бхаттачарья SS, Hildebrandt F и др.: Общий аллель RPGRIP1L является модификатором дегенерации сетчатки при цилиопатиях.Нат Жене. 2009, 41: 739-745. 10,1038 / нг.366.

    PubMed Central CAS PubMed Google ученый

  • 104.

    Лю Л., Чжан М., Ся З, Сюй П., Чен Л., Сюй Т.: ресничный белок NPHP-8 Caenorhabditis elegans, гомолог человеческого RPGRIP1L, необходим для цилиогенеза и химиочувствительности. Biochem Biophys Res Commun. 2011, 410: 626-631. 10.1016 / j.bbrc.2011.06.041.

    CAS PubMed Google ученый

  • 105.

    Wolf MT, Saunier S, O'Toole JF, Wanner N, Groshong T, Attanasio M, Salomon R, Stallmach T, Sayer JA, Waldherr R, Griebel M, Oh J, Neuhaus TJ, Josefiak U, Antignac C, Otto EA , Хильдебрандт Ф: Мутационный анализ гена RPGRIP1L у пациентов с синдромом Жубера и нефронофтизом. Kidney Int. 2007, 72: 1520-1526. 10.1038 / sj.ki.5002630.

    CAS PubMed Google ученый

  • 106.

    Pazour GJ, Baker SA, Deane JA, Cole DG, Dickert BL, Rosenbaum JL, Witman GB, Besharse JC: Внутрилагеллярный транспортный белок IFT88 необходим для сборки и поддержания фоторецепторов позвоночных.J Cell Biol. 2002, 157: 103-113. 10.1083 / jcb.200107108.

    PubMed Central CAS PubMed Google ученый

  • 107.

    Сукумаран С., Перкинс Б.Д.: Ранние дефекты морфогенеза внешнего сегмента фоторецепторов у рыбок данио, ift57, ift88 и ift172, мутантов, переносящих внутричешуйчатый транспорт. Vision Res. 2009, 49: 479-489. 10.1016 / j.visres.2008.12.009.

    PubMed Central CAS PubMed Google ученый

  • 108.

    Tsujikawa M, Malicki J: Гены внутрифлагеллярного транспорта необходимы для дифференциации и выживания сенсорных нейронов позвоночных. Нейрон. 2004, 42: 703-716. 10.1016 / S0896-6273 (04) 00268-5.

    CAS PubMed Google ученый

  • 109.

    Whitehead JL, Wang SY, Bost-Usinger L, Hoang E, Frazer KA, Burnside B: Локализация фоторецепторов субъединиц KIF3A и KIF3B гетеротримерных микротрубочек моторного кинезина II в сетчатке позвоночных.Exp Eye Res. 1999, 69: 491-503. 10.1006 / exer.1999.0724.

    CAS PubMed Google ученый

  • 110.

    Dafinger C, Liebau MC, Elsayed SM, Hellenbroich Y, Boltshauser E, Korenke GC, Fabretti F, Janecke AR, Ebermann I, Nurnberg G, Nurnberg P, Zentgraf H, Koerber F, Addicks K, Elsobky E , Benzing T, Schermer B, Bolz HJ: Мутации в KIF7 связывают синдром Жубера с передачей сигналов Sonic Hedgehog и динамикой микротрубочек. J Clin Invest.2011, 121: 2662-2667. 10.1172 / JCI43639.

    PubMed Central CAS PubMed Google ученый

  • 111.

    Gerdes JM, Liu Y, Zaghloul NA, Leitch CC, Lawson SS, Kato M, Beachy PA, Beales PL, DeMartino GN, Fisher S, Badano JL, Katsanis N: нарушение базального тела нарушает функцию протеасомы и нарушает внутриклеточный ответ Wnt. Нат Жене. 2007, 39: 1350-1360. 10.1038 / нг.2007.12.

    CAS PubMed Google ученый

  • 112.

    Pretorius PR, Baye LM, Nishimura DY, Searby CC, Bugge K, Yang B, Mullins RF, Stone EM, Sheffield VC, Slusarski DC: Идентификация и функциональный анализ длинной изоформы BBS3 (ARL6), специфичной для зрения. PLoS Genet. 2010, 6: e1000884-10.1371 / journal.pgen.1000884.

    PubMed Central PubMed Google ученый

  • 113.

    Kim JC, Ou YY, Badano JL, Esmail MA, Leitch CC, Fiedrich E, Beales PL, Archibald JM, Katsanis N, Rattner JB, Leroux MR: MKKS / BBS6, дивергентный шаперониноподобный белок, связанный синдром Барде-Бидля, связанный с ожирением, представляет собой новый центросомный компонент, необходимый для цитокинеза.J Cell Sci. 2005, 118 (Pt 5): 1007-1020.

    CAS PubMed Google ученый

  • 114.

    Ансли С.Дж., Бадано Д.Л., Блак О.Е., Хилл Дж., Хоскинс Б.Э., Лейтч С.К., Ким Дж.С., Росс А.Дж., Эйхерс Е.Р., Теслович Т.М., Ма А.К., Джонсен Р.С., Кавендер Дж.С., Льюис Р.А., Леру М.Р. , Beales PL, Katsanis N: Дисфункция основного тела является вероятной причиной плейотропного синдрома Барде – Бидля. Природа. 2003, 425: 628-633. 10.1038 / природа02030.

    CAS PubMed Google ученый

  • 115.

    Lim YS, Chua CE, Tang BL: Rabs и другие малые GTPases в цилиарном транспорте. Biol Cell. 2011, 103: 209-221. 10.1042 / BC20100150.

    CAS PubMed Google ученый

  • 116.

    Лю X, Булгаков О.В., Дарроу К.Н., Павлик Б., Адамян М., Либерман М.С., Ли Т. Ушерин необходим для поддержания фоторецепторов сетчатки и нормального развития волосковых клеток улитки. Proc Natl Acad Sci U S. A. 2007, 104: 4413-4418. 10.1073 / pnas.0610950104.

    PubMed Central CAS PubMed Google ученый

  • 117.

    Ян Дж., Лю X, Юэ Дж., Адамян М., Булгаков О., Ли Т.: Рутлетин, новый белок спиральной спирали, является структурным компонентом корня ресничек. J Cell Biol. 2002, 159: 431-440. 10.1083 / jcb.200207153.

    PubMed Central CAS PubMed Google ученый

  • 118.

    Wright RN, Hong DH, Perkins B: RpgrORF15 соединяется с белковой сетью Usher посредством прямого взаимодействия с множественными изоформами вихря.Инвестируйте Ophthalmol Vis Sci. 2012, 53: 1519-29. 10.1167 / iovs.11-8845. Распечатать 2012 Март

    PubMed Central CAS PubMed Google ученый

  • 119.

    Катсанис Н., Ансли С.Дж., Бадано Д.Л., Эйхерс Э.Р., Льюис Р.А., Хоскинс Б.Э., Скамблер П.Дж., Дэвидсон В.С., Билс П.Л., Лупски-младший: Триаллельное наследование при синдроме Бардета-Бидла, рецессивном менделевском расстройстве. Наука. 2001, 293: 2256-2259. 10.1126 / science.1063525.

    CAS PubMed Google ученый

  • 120.

    Доэрти Д., Паризи М.А., Финн Л.С., Гунай-Айгун М., Аль-Матин М., Бейтс Д., Клерикуцио С., Демир Х., Доршнер М., ван Эссен А.Дж., Гал В.А., Джентиле М., Горден Н.Т., Хикида А., Кнутцен Д. , Ozyurek H, Phelps I, Rosenthal P, Verloes A, Weigand H, Chance PF, Dobyns WB, Glass IA: Мутации в 3 генах (MKS3, CC2D2A и RPGRIP1L) вызывают синдром COACH (синдром Жубера с врожденным фиброзом печени). J Med Genet. 2010, 47: 8-21. 10.1136 / jmg.2009.067249.

    PubMed Central CAS PubMed Google ученый

  • 121.

    Leitch CC, Zaghloul NA, Davis EE, Stoetzel C, Diaz-Font A, Rix S, Alfadhel M, Lewis RA, Eyaid W, Banin E, Dollfus H, Beales PL, Badano JL, Katsanis N: гипоморфные мутации в синдромальной энцефалоцеле гены связаны с синдромом Барде – Бидля. Нат Жене. 2008, 40: 443-448. 10,1038 / нг.97.

    CAS PubMed Google ученый

  • 122.

    Карска-Баста I, Кубицка-Трзаска А., Филемонович-Скочек А., Романовска-Диксон Б., Кобыларц Дж .: Синдром Альстрома - отчет о клиническом случае и обзор литературы.Klin Oczna. 2008, 110: 188-192.

    PubMed Google ученый

  • 123.

    Helou J, Otto EA, Attanasio M, Allen SJ, Parisi MA, Glass I, Utsch B, Hashmi S, Fazzi E, Omran H, O'Toole JF, Sayer JA, Hildebrandt F: анализ мутаций NPHP6 / CEP290 у пациентов с синдромом Жубера и синдромом Сеньора-Локена. Журнал медицинской генетики. 2007, 44 (10): 657-663. 10.1136 / jmg.2007.052027.

    PubMed Central CAS PubMed Google ученый

  • 124.

    Roepman R, Letteboer SJ, Arts HH, van Beersum SE, Lu X, Krieger E, Ferreira PA, Cremers FP: Взаимодействие нефроцистина-4 и RPGRIP1 нарушается из-за нефронофтиза или мутаций, связанных с врожденным амаврозом Лебера. Proc Natl Acad Sci U S. A. 2005, 102: 18520-18525. 10.1073 / pnas.0505774102.

    PubMed Central CAS PubMed Google ученый

  • 125.

    Stone EM, Cideciyan AV, Aleman TS, Scheetz TE, Sumaroka A, Ehlinger MA, Schwartz SB, Fishman GA, Traboulsi EI, Lam BL, Fulton AB, Mullins RF, Sheffield VC, Jacobson SG: Variations in NPHP5 у пациентов с несиндромным врожденным амаврозом Лебера и синдромом Сеньора – Локена.Arch Ophthalmol. 2011, 129: 81-87. 10.1001 / archophthalmol.2010.330.

    PubMed Central CAS PubMed Google ученый

  • 126.

    Casteels I, Demandt E, Legius E: Потеря зрения как признак синдрома Jeune. Eur J Paediatr Neurol. 2000, 4: 243-247. 10.1053 / ejpn.2000.0313.

    CAS PubMed Google ученый

  • 127.

    ден Холландер А.И., Ропман Р., Коенекоп Р.К., Кремерс Ф.П.: Врожденный амавроз Лебера: гены, белки и механизмы заболевания.Prog Retin Eye Res. 2008, 27: 391-419. 10.1016 / j.preteyeres.2008.05.003.

    CAS PubMed Google ученый

  • 128.

    Vervoort R, Lennon A, Bird AC, Tulloch B, Axton R, Miano MG, Meindl A, Meitinger T, Ciccodicola A, Wright AF: Мутационная горячая точка в новом экзоне RPGR в X-сцепленном пигментном ретините . Нат Жене. 2000, 25: 462-466. 10.1038 / 78182.

    CAS PubMed Google ученый

  • 129.

    Брейер Д.К., Яшар Б.М., Филиппова Е., Хирианна С., Лайонс Р.Х., Мирс А.Дж., Асае Б., Акар К., Вервурт Р., Райт А.Ф., Мусарелла М.А., Уилер П., Макдональд I, Яннакконе А., Берч Д., Хоффман Д.Р., Фишман GA, Heckenlively JR, Jacobson SG, Sieving PA, Swaroop A: всесторонний анализ мутаций RP2 и RPGR в североамериканской когорте семей с пигментным Х-сцепленным ретинитом. Am J Hum Genet. 2002, 70: 1545-1554. 10.1086 / 340848.

    PubMed Central CAS PubMed Google ученый

  • 130.

    Jimeno D, Feiner L, Lillo C, Teofilo K, Goldstein LS, Pierce EA, Williams DS: Анализ функции кинезина-2 в фоторецепторных клетках с использованием синхронного Cre-loxP нокаута Kif3a с RHO-Cre. Инвестируйте Ophthalmol Vis Sci. 2006, 47: 5039-5046. 10.1167 / iovs.06-0032.

    PubMed Central PubMed Google ученый

  • 131.

    Marszalek JR, Liu X, Roberts EA, Chui D, Marth JD, Williams DS, Goldstein LS: генетические доказательства избирательного транспорта опсина и аррестина кинезином-II в фоторецепторах млекопитающих.Клетка. 2000, 102: 175-187. 10.1016 / S0092-8674 (00) 00023-4.

    CAS PubMed Google ученый

  • 132.

    Вон Дж., Ши Л. Я., Хикс В., Ван Дж., Херд Р., Наггерт Дж. К., Чанг Б., Нишина П. М.: Ресурсы по модели мыши для исследования зрения. J Ophthalmol. 2011, 3-Epub 2010 31 октября

    Google ученый

  • 133.

    Лю К., Савельев А., Пирс Е.А.: Тяжесть дегенерации сетчатки у мышей, нацеленных на ген Rp1h, зависит от генетического фона.Инвестируйте Ophthalmol Vis Sci. 2009, 50: 1566-1574.

    PubMed Central PubMed Google ученый

  • 134.

    Лю Дж, Хуанг Q, Хигдон Дж, Лю В., Се Т, Ямашита Т., Чеон К., Ченг С., Цзуо Дж .: отчетливые профили экспрессии генов и снижение передачи сигналов JNK при пигментном ретините, вызванном мутациями RP1. Hum Mol Genet. 2005, 14: 2945-2958. 10.1093 / hmg / ddi325.

    CAS PubMed Google ученый

  • 135.

    Гао Дж., Чеон К., Нусиновиц С., Лю К., Бей Д., Аткинс К., Азими А., Дайгер С. П., Фарбер Д. Б., Хекенливли Дж. Р., Пирс Е. А., Салливан Л. С., Цзо Дж .: Прогрессирующая дегенерация фоторецепторов, дисплазия внешнего сегмента и родопсин. неправильная локализация у мышей с направленным разрушением гена пигментного ретинита-1 (Rp1). Proc Natl Acad Sci U S. A. 2002, 99: 5698-5703. 10.1073 / pnas.042122399.

    PubMed Central CAS PubMed Google ученый

  • 136.

    Schwartz SB, Aleman TS, Cideciyan AV, Swaroop A, Jacobson SG, Stone EM: мутация De novo в гене RP1 (Arg677ter), связанная с пигментным ретинитом. Инвестируйте Ophthalmol Vis Sci. 2003, 44: 3593-3597. 10.1167 / iovs.03-0155.

    PubMed Google ученый

  • 137.

    Cideciyan AV, Aleman TS, Jacobson SG, Khanna H, Sumaroka A, Aguirre GK, Schwartz SB, Windsor EA, He S, Chang B, Stone EM, Swaroop A: мутации центросомно-цилиарного гена CEP290 / NPHP6 привести к слепоте с неожиданной экономией фоторецепторов и зрительного мозга: значение для терапии врожденного амавроза Лебера.Hum Mutat. 2007, 28: 1074-1083. 10.1002 / humu.20565.

    CAS PubMed Google ученый

  • 138.

    Луи К.М., Кариди Дж., Лопес В.С., Бранкати Ф., Кишперт А., Ланкастер М.А., Шлоссман А.М., Отто Э.А., Лейтжес М., Грон Х.Дж., Лопес И., Гудисева Х.В., О'Тул Дж. Ф., Валлеспин Э, Ayyagari R, Ayuso C, Cremers FP, den Hollander AI, Koenekoop RK, Dallapiccola B, Ghiggeri GM, Hildebrandt F, Valente EM, Williams DS, Gleeson JG: AHI1 необходим для развития внешнего сегмента фоторецептора и является модификатором дегенерации сетчатки в нефронофтиз.Нат Жене. 2010, 42: 175-180. 10,1038 / нг.519.

    PubMed Central CAS PubMed Google ученый

  • 139.

    Lancaster MA, Gopal DJ, Kim J, Saleem SN, Silhavy JL, Louie CM, Thacker BE, Williams Y, Zaki MS, Gleeson JG: Дефектное Wnt-зависимое слияние средней линии мозжечка в мышиной модели синдрома Жубера . Nat Med. 2011, 17: 726-731. 10,1038 / нм.2380.

    PubMed Central CAS PubMed Google ученый

  • 140.

    Collin GB, Won J, Hicks WL, Cook SA, Nishina PM, Naggert JK: Мекелин необходим для внутрибровного транспорта фоторецепторов и морфогенеза внешнего сегмента. Инвестируйте в Ophthalmol Vis Science. 2012, 53: 967-974. 10.1167 / iovs.11-8766. Печать 2012 фев

    CAS Google ученый

  • 141.

    Bhowmick R, Li M, Sun J, Baker SA, Insinna C, Besharse JC: фоторецепторные комплексы IFT, содержащие шапероны, гуанилилциклазу 1 и родопсин.Движение. 2009, 10: 648-663. 10.1111 / j.1600-0854.2009.00896.x.

    PubMed Central CAS PubMed Google ученый

  • 142.

    Liem KF: He M, Ocbina PJ, Anderson KV: Mouse Kif7 / Costal2 представляет собой ассоциированный с ресничками белок, который регулирует передачу сигналов Sonic hedgehog. Proc Natl Acad Sci U S. A. 2009, 106: 13377-13382.

    PubMed Central CAS PubMed Google ученый

  • 143.

    Chapple JP, Hardcastle AJ, Grayson C, Spackman LA, Willison KR, Cheetham ME: Мутации в N-конце белка RP2 пигментного ретинита, связанного с X, мешают нормальному нацеливанию белка на плазматическую мембрану. Hum Mol Genet. 2000, 9: 1919-1926. 10.1093 / hmg / 9.13.1919.

    CAS PubMed Google ученый

  • 144.

    Evans RJ, Schwarz N, Nagel-Wolfrum K, Wolfrum U, Hardcastle AJ, Cheetham ME: Белок RP2 пигментного ретинита связывает перицентриолярный перенос пузырьков между Гольджи и первичной ресничкой.Hum Mol Genet. 2010, 19: 1358-1367. 10.1093 / hmg / ddq012.

    CAS PubMed Google ученый

  • 145.

    Херд Т., Чжоу В., Дженкинс П., Лю С.Дж., Сваруп А., Ханна Х., Мартенс Дж., Хильдебрандт Ф., Марголис Б. Белок RP2 пигментного ретинита взаимодействует с полицистином 2 и регулирует опосредованное ресничками развитие позвоночных. Hum Mol Genet. 2010, 19: 4330-4344. 10.1093 / hmg / ddq355.

    PubMed Central CAS PubMed Google ученый

  • 146.

    Won J, Gifford E, Smith RS, Yi H, Ferreira PA, Hicks WL, Li T, Naggert JK, Nishina PM: RPGRIP1 необходим для формирования и морфогенеза внешнего сегмента нормального палочковидного фоторецептора. Hum Mol Genet. 2009, 18: 4329-4339. 10.1093 / hmg / ddp385.

    PubMed Central CAS PubMed Google ученый

  • 147.

    Павлик Б.С., Булгаков О.В., Лю X, Сюй X, Адамян М., Сан X, Хани С.К., Берсон Э.Л., Сандберг М.А., Ли Т.: Заместительная генная терапия последовательностью человеческого RPGRIP1 замедляет дегенерацию фоторецепторов у мышей. модель врожденного амавроза Лебера.Hum Gene Ther. 2010, 21: 993-1004. 10.1089 / hum.2009.218.

    PubMed Central CAS PubMed Google ученый

  • 148.

    Garcia-Gonzalo FR, Corbit KC, Sirerol-Piquer MS, Ramaswami G, Otto EA, Noriega TR, Seol AD, Robinson JF, Bennett CL, Josifova DJ, Garcia-Verdugo JM, Katsanis N, Hildebrandt F , Reiter JF: Комплекс переходной зоны регулирует цилиогенез млекопитающих и состав цилиарной мембраны. Нат Жене. 2011, 43: 776-784.10,1038 / нг.891.

    PubMed Central CAS PubMed Google ученый

  • 149.

    Thompson DA, Khan NW, Othman MI, Chang B, Jia L, Grahek G, Wu Z, Hiriyanna S, Nellissery J, Li T, Khanna H, Colosi P, Swaroop A, Heckenlively JR: Rd9 is встречающаяся в природе мышиная модель распространенной формы пигментного ретинита, вызванного мутациями в RPGR-ORF15. PloS One. 2012, 7: e35865-10.1371 / journal.pone.0035865.

    PubMed Central CAS PubMed Google ученый

  • 150.

    Huang WC, Wright AF, Roman AJ, Cideciyan AV, Manson FD, Gewaily DY, Schwartz SB, Sadigh S, Limberis MP, Bell P, Wilson JM, Swaroop A, Jacobson SG: RPGR-ассоциированная дегенерация сетчатки у человека, связанная с Х-хромосомой RP и модель на мышах. Инвестируйте Ophthalmol Vis Sci. 2012, 53: 5594-5608. 10.1167 / iovs.12-10070. Распечатать 2012 сен

    PubMed Central CAS PubMed Google ученый

  • 151.

    Jagger D, Collin G, Kelly J, Towers E, Nevill G, Longo-Guess C, Benson J, Halsey K, Dolan D, Marshall J, Naggert J, Forge A: белок синдрома Альстрома ALMS1 локализуется в базальные тела волосковых клеток улитки и регулирует зависимую от ресничек плоскую клеточную полярность.Hum Mol Genet. 2011, 20: 466-481. 10.1093 / hmg / ddq493.

    PubMed Central CAS PubMed Google ученый

  • 152.

    Хуанг-Доран I, Семпл Р.К.: Нокдаун гена Alms1, ассоциированного с синдромом Альстрома, в 3 преадипоцитах T3-L1 нарушает адипогенез, но не влияет на клеточно-автономное действие инсулина. Int J Ожирение. 2010, 34: 1554-1558. 10.1038 / ijo.2010.92.

    CAS Google ученый

  • 153.

    Арсов Т., Сильва Д.Г., О'Брайан М.К., Сейнсбери А., Ли Н.Дж., Кеннеди С., Манджи С.С., Нелмс К., Лю С., Винуеса К.Г., де Крецер Д.М., Гуднау С.К., Петровский Н.: Толстый австралиец - новый синдром Альстрома мышь, показывающая критическую роль ALMS1 в ожирении, диабете и сперматогенезе. Мол Эндокринол. 2006, 20: 1610-1622.

    CAS PubMed Google ученый

  • 154.

    Коллин Г.Б., Сир Э., Бронсон Р., Маршалл Д.Д., Гиффорд Э.Д., Хикс В., Мюррей С.А., Чжэн К.Ю., Смит Р.С., Нишина П.М., Наггерт Дж.К .: Мыши с нарушением Alms1 повторяют синдром Альстрома у человека.Hum Mol Genet. 2005, 14: 2323-2333. 10.1093 / hmg / ddi235.

    PubMed Central CAS PubMed Google ученый

  • 155.

    Zhang Q, Nishimura D, Seo S, Vogel T, Morgan DA, Searby C, Bugge K, Stone EM, Rahmouni K, Sheffield VC: Модель с нокаутом на мышах с синдромом Барде-Бидла 3 (Bbs3) выявляет общие BBS -ассоциированные фенотипы и уникальные фенотипы Bbs3. Proc Natl Acad Sci U S. A. 2011, 108: 20678-20683. 10.1073 / pnas.1113220108. Epub 2 декабря 2011 г.

    PubMed Central CAS PubMed Google ученый

  • 156.

    Davis RE, Swiderski RE, Rahmouni K, Nishimura DY, Mullins RF, Agassandian K, Philp AR, Searby CC, Andrews MP, Thompson S, Berry CJ, Thedens DR, Yang B, Weiss RM, Cassell MD, Stone EM, Sheffield VC: Нокиновая мышь с синдромом Барде-Бидла 1 Мутация M390R имеет дефекты ресничек, вентрикуломегалию, ретинопатию и ожирение. Proc Natl Acad Sci U S. A. 2007, 104: 19422-19427. 10.1073 / pnas.0708571104.

    PubMed Central CAS PubMed Google ученый

  • 157.

    Nishimura DY, Fath M, Mullins RF, Searby C, Andrews M, Davis R, Andorf JL, Mykytyn K, Swiderski RE, Yang B, Carmi R, Stone EM, Sheffield VC: у Bbs2-нулевых мышей нейросенсорный дефицит, дефект в социальном доминировании и ретинопатии, связанной с неправильной локализацией родопсина. Proc Natl Acad Sci U S. A. 2004, 101: 16588-16593. 10.1073 / pnas.0405496101.

    PubMed Central CAS PubMed Google ученый

  • 158.

    Rahmouni K, Fath MA, Seo S, Thedens DR, Berry CJ, Weiss R, Nishimura DY, Sheffield VC: резистентность к лептину способствует ожирению и гипертонии в моделях синдрома Барде-Бидла на мышах.J Clin Invest. 2008, 118: 1458-1467. 10.1172 / JCI32357.

    PubMed Central CAS PubMed Google ученый

  • 159.

    Abd-El-Barr MM, Sykoudis K, Andrabi S, Eichers ER, Pennesi ME, Tan PL, Wilson JH, Katsanis N, Lupski JR, Wu SM: Нарушение транспорта белка фоторецептора и синаптической передачи у мыши модель синдрома Барде – Бидля. Vis Res. 2007, 47: 3394-3407. 10.1016 / j.visres.2007.09.016.

    PubMed Central CAS PubMed Google ученый

  • 160.

    Mykytyn K, Mullins RF, Andrews M, Chiang AP, Swiderski RE, Yang B, Braun T, Casavant T, Stone EM, Sheffield VC: нулевые мыши с синдромом Барде-Бидла типа 4 (BBS4) причастны Bbs4 к образованию жгутиков, но не глобальная сборка ресничек. Proc Natl Acad Sci U S. A. 2004, 101: 8664-8669. 10.1073 / pnas.0402354101.

    PubMed Central CAS PubMed Google ученый

  • 161.

    Simons DL, Boye SL, Hauswirth WW, Wu SM: Генная терапия предотвращает гибель фоторецепторов и сохраняет функцию сетчатки на мышиной модели с синдромом Барде-Бидла.Proc Natl Acad Sci U S. A. 2011, 108: 6276-6281. 10.1073 / pnas.101

  • 08.

    PubMed Central CAS PubMed Google ученый

  • 162.

    Таденев А.Л., Кулага Х.М., Мэй-Симера Х.Л., Келли М.В., Катсанис Н., Рид Р.Р .: Потеря протеина-8 синдрома Барде-Бидла (BBS8) нарушает обонятельную функцию, локализацию белка и нацеливание на аксоны. Proc Natl Acad Sci U S. A. 2011, 108: 10320-10325. 10.1073 / pnas.1016531108.

    PubMed Central CAS PubMed Google ученый

  • 163.

    Fath MA, Mullins RF, Searby C, Nishimura DY, Wei J, Rahmouni K, Davis RE, Tayeh MK, Andrews M, Yang B, Sigmund CD, Stone EM, Sheffield VC: Mkks-null мыши имеют фенотип, напоминающий Bardet– Синдром Бидля. Hum Mol Genet. 2005, 14: 1109-1118. 10.1093 / hmg / ddi123.

    CAS PubMed Google ученый

  • 164.

    Sato T, Mushiake S, Kato Y, Sato K, Sato M, Takeda N, Ozono K, Miki K, Kubo Y, Tsuji A, Harada R, Harada A: ГТФаза Rab8 регулирует локализацию апикального белка в клетки кишечника.Природа. 2007, 448: 366-369. 10.1038 / природа05929.

    CAS PubMed Google ученый

  • 165.

    Кудряшова E, Wu J, Havton LA, Spencer MJ: Дефицит убиквитинлигазы E3 TRIM32 у мышей приводит к миопатии с нейрогенным компонентом. Hum Mol Genet. 2009, 18: 1353-1367. 10.1093 / hmg / ddp036.

    PubMed Central CAS PubMed Google ученый

  • 166.

    Brancati F, Barrano G, Silhavy JL, Marsh SE, Travaglini L, Bielas SL, Amorini M, Zablocka D, Kayserili H, Al-Gazali L, Bertini E, Boltshauser E, D'Hooghe M, Fazzi E, Fenerci EY, Hennekam RC, Kiss A, Lees MM, Marco E, Phadke SR, Rigoli L, Romano S, Salpietro CD, Sherr EH, Signorini S, Stromme P, Stuart B, Sztriha L, Viskochil DH, Yuksel A и др .: мутации CEP290 часто выявляются при окуло-почечной форме нарушений, связанных с синдромом Жубера. Am J Hum Genet. 2007, 81: 104-113. 10.1086 / 519026.

    PubMed Central CAS PubMed Google ученый

  • 167.

    Валенте Е.М., Силхави Дж. Л., Бранкати Ф., Баррано Дж., Кришнасвами С. Р., Кастори М., Ланкастер М. А., Больтсхаузер Е., Бокконе Л., Аль-Газали Л., Фацци Е., Синьорини С., Луи К. М., Беллачкио Е., Бертини Э., Даллапиккола Б, Глисон Дж. Г.: Мутации в CEP290, который кодирует центросомный белок, вызывают плейотропные формы синдрома Жубера. Нат Жене. 2006, 38: 623-625. 10.1038 / ng1805.

    CAS PubMed Google ученый

  • 168.

    Coppieters F, Lefever S, Leroy BP, De Baere E: CEP290, многоликий ген: обзор мутаций и представление CEP290base. Hum Mutat. 2010, 31: 1097-1108. 10.1002 / humu.21337.

    CAS PubMed Google ученый

  • 169.

    Coppieters F, Casteels I, Meire F, De Jaegere S, Hooghe S, van Regemorter N, Van Esch H, Matuleviciene A, Nunes L, Meersschaut V, Walraedt S, Standaert L, Coucke P, Hoeben H , Kroes HY, Vande Walle J, de Ravel T, Leroy BP, De Baere E: Генетический скрининг LCA в Бельгии: преобладание CEP290 и идентификация потенциальных аллелей модификаторов в AHI1 фенотипов, связанных с CEP290.Hum Mutat. 2010, 31: E1709-E1766. 10.1002 / humu.21336.

    PubMed Central CAS PubMed Google ученый

  • 170.

    Morecroft I, Doyle B, Nilsen M, Kolch W., Mair K, Maclean MR: Мыши, лишенные белка-ингибитора киназы Raf-1, демонстрируют чрезмерно индуцированную гипоксией легочную гипертензию. Br J Pharmacol. 2011, 163: 948-963. 10.1111 / j.1476-5381.2011.01305.x.

    PubMed Central CAS PubMed Google ученый

  • 171.

    Iannaccone A, Wang X, Jablonski MM, Kuo SF, Baldi A, Cosgrove D, Morton CC, Swaroop A: все больше доказательств синдромальных фенотипов, связанных с мутациями RPGR. Am J Ophthalmol. 2004, 137: 785-786. ответ автора 786

    PubMed Google ученый

  • 172.

    Shu X, Black GC, Rice JM, Hart-Holden N, Jones A, O'Grady A, Ramsden S, Wright AF: анализ мутаций RPGR и болезнь: обновление. Hum Mutat. 2007, 28: 322-328. 10.1002 / humu.20461.

    CAS PubMed Google ученый

  • 173.

    Zito I, Downes SM, Patel RJ, Cheetham ME, Ebenezer ND, Jenkins SA, Bhattacharya SS, Webster AR, Holder GE, Bird AC, Bamiou DE, Hardcastle AJ: мутация RPGR, связанная с пигментным ретинитом, нарушена слуховые и респираторные инфекции. J Med Genet. 2003, 40: 609-615. 10.1136 / jmg.40.8.609.

    PubMed Central CAS PubMed Google ученый

  • 174.

    Schmid F, Glaus E, Cremers FP, Kloeckener-Gruissem B, Berger W, Neidhardt J: Мутации и тканеспецифические изменения транскриптов RPGR. Инвестируйте Ophthalmol Vis Sci. 2010, 51: 1628-1635. 10.1167 / iovs.09-4031.

    PubMed Google ученый

  • 175.

    Hong DH, Li T: Сложный паттерн экспрессии RPGR показывает роль богатых пуринами энхансеров экзонного сплайсинга. Инвестируйте Ophthalmol Vis Sci. 2002, 43: 3373-3382.

    PubMed Google ученый

  • 176.

    He S, Parapuram SK, Hurd TW, Behnam B, Margolis B, Swaroop A, Khanna H: Изоформы белка регулятора GTPase пигментного ретинита (RPGR) в сетчатке млекопитающих: понимание Х-сцепленного пигментного ретинита и связанных с ним цилиопатий. Vision Res. 2008, 48: 366-376. 10.1016 / j.visres.2007.08.005.

    PubMed Central CAS PubMed Google ученый

  • 177.

    Meindl A, Dry K, Herrmann K, Manson F, Ciccodicola A, Edgar A, Carvalho MR, Achatz H, Hellebrand H, Lennon A, Migliaccio C, Porter K, Zrenner E, Bird A, Jay M , Lorenz B, Wittwer B, D'Urso M, Meitinger T, Wright A: Ген (RPGR), гомологичный фактору обмена гуаниновых нуклеотидов RCC1, мутирован в X-сцепленном пигментном ретините (RP3).Нат Жене. 1996, 13: 35-42. 10.1038 / ng0596-35.

    CAS PubMed Google ученый

  • 178.

    Yan D, Swain PK, Breuer D, Tucker RM, Wu W., Fujita R, Rehemtulla A, Burke D, Swaroop A: Биохимическая характеристика и субклеточная локализация регулятора GTPase пигментного ретинита мыши (mRpgr). J Biol Chem. 1998, 273: 19656-19663. 10.1074 / jbc.273.31.19656.

    CAS PubMed Google ученый

  • 179.

    Iannaccone A, Breuer DK, Wang XF, Kuo SF, Normando EM, Filippova E, Baldi A, Hiriyanna S, MacDonald CB, Baldi F, Cosgrove D, Morton CC, Swaroop A, Jablonski MM: Клинические и иммуногистохимические доказательства X связал синдром пигментного ретинита с рецидивирующими инфекциями и потерей слуха в связи с мутацией RPGR. J Med Genet. 2003, 40: e118-10.1136 / jmg.40.11.e118.

    PubMed Central CAS PubMed Google ученый

  • 180.

    Sharon D, Sandberg MA, Rabe VW, Stillberger M, Dryja TP, Berson EL: мутации RP2 и RPGR и клинические корреляции у пациентов с пигментным Х-сцепленным ретинитом. Am J Hum Genet. 2003, 73: 1131-1146. 10.1086 / 379379.

    PubMed Central CAS PubMed Google ученый

  • 181.

    Ocbina PJ, Eggenschwiler JT, Moskowitz I, Anderson KV: сложные взаимодействия между генами, контролирующими движение в первичных ресничках. Нат Жене.2011, 43: 547-553. 10,1038 / нг.832.

    PubMed Central CAS PubMed Google ученый

  • 182.

    Friedman TB, Schultz JM, Ahmed ZM, Tsilou ET, Brewer CC: Синдром Ашера: потеря слуха с потерей зрения. Adv Оториноларингол. 2011, 70: 56-65.

    PubMed Google ученый

  • 183.

    Murga-Zamalloa CA, Swaroop A, Khanna H: RPGR-содержащие белковые комплексы при синдромальной и несиндромальной дегенерации сетчатки из-за дисфункции ресничек.Дж. Жене. 2009, 88: 399-407. 10.1007 / s12041-009-0061-7.

    PubMed Central CAS PubMed Google ученый

  • 184.

    Travaglini L, Brancati F, Attie-Bitach T, Audollent S, Bertini E, Kaplan J, Perrault I, Iannicelli M, Mancuso B, Rigoli L, Rozet JM, Swistun D, ​​Tolentino J, Dallapiccola B, Глисон Дж. Г., Валенте Е. М., Занкл А., Левентер Р., Граттан-Смит П., Янеке А., Д'Хуг М., Снайер И., Ван Костер Р., Демерлейр Л., Диас К., Моко С., Морейра А., Ким К. А., Маэгава Г., Петкович Д. и др.: Расширение спектра мутаций CEP290 при цилиопатиях.Am J Med Genet A. 2009, 149A: 2173-2180. 10.1002 / ajmg.a.33025.

    CAS PubMed Google ученый

  • 185.

    Chaki M, Hoefele J, Allen SJ, Ramaswami G, Janssen S, Bergmann C, Heckenlively JR, Otto EA, Hildebrandt F: Генотип-фенотипическая корреляция у 440 пациентов с цилиопатиями, связанными с НПХП. Kidney Int. 2011, 80: 1239-1245. 10.1038 / ки.2011.284.

    PubMed Central CAS PubMed Google ученый

  • 186.

    Zhang Q, Seo S, Bugge K, Stone EM, Sheffield VC: белки BBS генетически взаимодействуют с путем IFT, чтобы влиять на фенотипы, связанные с SHH. Hum Mol Genet. 2012, 21: 1945–1953. 10.1093 / hmg / dds004. Epub 2012 6 января

    PubMed Central CAS PubMed Google ученый

  • 187.

    Badano JL, Kim JC, Hoskins BE, Lewis RA, Ansley SJ, Cutler DJ, Castellan C, Beales PL, Leroux MR, Katsanis N: Гетерозиготные мутации в BBS1, BBS2 и BBS6 имеют потенциальный эпистатический эффект на Пациенты Bardet-Biedl с двумя мутациями во втором локусе BBS.Hum Mol Genet. 2003, 12: 1651-1659. 10.1093 / hmg / ddg188.

    CAS PubMed Google ученый

  • 188.

    Beales PL, Badano JL, Ross AJ, Ansley SJ, Hoskins BE, Kirsten B, Mein CA, Froguel P, Scambler PJ, Lewis RA, Lupski JR, Katsanis N: генетическое взаимодействие мутаций BBS1 с аллелями в другие локусы BBS могут приводить к неменделирующему синдрому Барде – Бидля. Am J Hum Genet. 2003, 72: 1187-1199. 10.1086 / 375178.

    PubMed Central CAS PubMed Google ученый

  • 189.

    Bin J, Madhavan J, Ferrini W, Mok CA, Billingsley G, Heon E: BBS7 и TTC8 (BBS8) мутации играют второстепенную роль в мутационной нагрузке синдрома Барде-Бидла в полиэтнической популяции. Hum Mutat. 2009, 30: E737-E746. 10.1002 / humu.21040.

    PubMed Google ученый

  • 190.

    Katsanis N, Eichers ER, Ansley SJ, Lewis RA, Kayserili H, Hoskins BE, Scambler PJ, Beales PL, Lupski JR: BBS4 вносит незначительный вклад в синдром Барде-Бидла и может также участвовать в триаллельном наследовании .Am J Hum Genet. 2002, 71: 22-29. 10.1086 / 341031.

    PubMed Central CAS PubMed Google ученый

  • 191.

    Такэда С., Нарита К.: Структура и функция ресничек позвоночных, к новой таксономии. Дифференциация. 2011, 83: S4-S11. Epub 2011 25 ноября

    PubMed Google ученый

  • 192.

    Начуры М.В., Локтев А.В., Чжан К., Вестлейк К.Дж., Перанен Дж., Мердес А., Слюсарски Д.К., Шеллер Р.Х., Базан Дж.Ф., Шеффилд В.К., Джексон П.К .: Основной комплекс белков BBS взаимодействует с GTPase Rab8. способствовать биогенезу цилиарной мембраны.Клетка. 2007, 129: 1201-1213. 10.1016 / j.cell.2007.03.053.

    CAS PubMed Google ученый

  • 193.

    Sang L, Miller JJ, Corbit KC, Giles RH, Brauer MJ, Otto EA, Baye LM, Wen X, Scales SJ, Kwong M, Huntzicker EG, Sfakianos MK, Sandoval W, Bazan JF, Kulkarni P , Гарсия-Гонсало FR, Сеол А.Д., О'Тул Дж.Ф., Хелд С., Ройтер Х.М., Лейн В.С., Рафик М.А., Нур А., Ансар М., Деви А.Р., Шеффилд В.К., Слюсарски, округ Колумбия, Винсент Дж.Б., Доэрти Д.А., Хильдебрандт Ф., и др.: Картирование белковой сети NPHP – JBTS – MKS выявляет гены и пути цилиопатии.Клетка. 2011, 145: 513-528. 10.1016 / j.cell.2011.04.019.

    PubMed Central CAS PubMed Google ученый

  • 194.

    van Reeuwijk J, Arts HH, Roepman R: Изучение цилиопатий путем распутывания сетей взаимодействия ресничек. Hum Mol Genet. 2011, 20 (R2): R149-R157. 10.1093 / hmg / ddr354.

    CAS PubMed Google ученый

  • Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Словарь данных

    CPS | Центр операций с данными

    УРОВЕНЬ 1

    A Студенческие услуги

    B Канцелярские и смежные службы

    C Продовольствие и постельное белье

    D Связь, искусство и графика

    E Архитектура, проектирование и смежные услуги

    Финансовые, управленческие и кадровые услуги

    G Техническое обслуживание, изготовление и эксплуатация

    H Здравоохранение и сопутствующие услуги

    I Науки, лаборатории и смежные службы

    J Защитные услуги

    M Менеджмент

    S Академические административные сотрудники

    Z Другое

    Достижения факультета

    Действующие звания факультета

    Преподаватели

    Прочие факультеты

    Помощники учеников

    Исследования

    Библиотекари

    Совместное расширение

    Расширение университета

    Прочие академические кадры

    УРОВЕНЬ 2

    S2 Деканы и ректоры

    S3 Директор

    S4 Координатор-администратор

    S5 Академик-администратор

    Профессор

    Клинический профессор стоматологии - 50% и более

    Супервайзер по физической культуре

    И.о. профессора-сената

    Исполняющий обязанности профессора, не являющийся членом Сената

    21 Преподаватель - с гарантированным трудоустройством

    22 должности преподавателей

    31 Профессор в общежитии

    32 Приглашенный профессор

    33 Адъюнкт-профессор

    34 Клинический профессор

    35 Помощник по обучению

    42 Помощник учителя и эквивалент

    43 Стажер-исследователь

    44 Стажер или резидент

    45 Другие студенческие титулы

    46 младший сотрудник - студент

    47 аспирант

    52 Астроном

    53 Агроном

    54 Профессиональные исследования

    55 Специалист

    56 Прочие исследования

    57 Аспирантура - не студенты

    62 Библиотекарь

    72 Совместное расширение

    82 Расширение университета

    92 Разные названия

    УРОВЕНЬ 3

    A10 Рекреационные услуги

    A15 Служба взаимоотношений со школой

    A20 Жилые услуги

    A25 Услуги по размещению

    A30 Консультации

    A35 Консультации

    B15 Канцелярские / административные, специальные и почтовые службы

    B20 Ключевые операции ввода

    B30 Кладбище

    B40 Обработка текстов

    C10 Управление общественным питанием

    C15 Приготовление и раздача еды - повара и пекари

    C20 Приготовление и раздача продуктов питания - руководители и работники

    C25 Управление постельным бельем

    C30 Подготовка и распределение белья

    D10 Связь

    D15 Искусство и графика - Фотография

    D25 Искусство и графика - Театр

    E10 Архитектура и планирование

    E15 Составление

    E20 Инженерное дело

    F10 Компьютерные операции

    F15 Компьютерное программирование и анализ

    F20 Административный, бюджетный и кадровый анализ

    F30 Управленческие услуги

    F35 Фискальные услуги

    F40 Служба занятости

    F45 Управление материальными средствами

    G15 Услуги физического оборудования - сельское хозяйство и земля

    Услуги физического оборудования G20 - Операции

    G23 Услуги физического оборудования - Техническое обслуживание

    G25 Услуги физического оборудования - Техническое обслуживание

    G33 Кастодиальные услуги (U)

    G35 Кастодиальные услуги

    G40 Технические и эксплуатационные услуги

    G45 Морские перевозки

    G55 Автомобильное и авиационное оборудование - техническое обслуживание

    G65 Автомобильное оборудование - Эксплуатация

    G75 Услуги репрографии и переплета

    G80 Полиграфические услуги

    h20 Санитары - ассистенты и сопровождающие

    h25 Санитары - профессиональные медсестры

    х30 Технологи - Клиническая лаборатория

    h35 Технологи - радиологические, респираторные и смежные области

    х40 Технологи - ЭКГ, ЭЭГ и др.

    х45 Сестринское дело

    х50 Врачи и стоматологи

    h55 Вспомогательные медицинские услуги - прочие

    H50 Фармацевты

    H55 Больница радиационных физиков

    H60 Администраторы и техники медицинской документации

    H65 Социальные службы - клиника

    H70 Социальные услуги - Сообщество

    H75 Психологи

    H80 Терапевтические услуги

    I10 Услуги по уходу за животными - техники

    I15 Услуги по уходу за животными - ветеринары

    I20 Лаборатория и смежные службы

    I25 Науки

    J10 Полиция и пожарная служба

    J15 Парковка и охрана

    M05 Программа для руководителей

    M10 Менеджеры

    M20 Тренеры и специалисты родственных занятий

    S21 Декан

    S24 Исполняющий обязанности декана и исполняющий обязанности ректора

    S26 Начальник отдела

    S27 Провост

    S31 Директор

    S34 И.о. директора

    S44 Исполняющий обязанности академического координатора

    S46 Академический координатор

    S56 Академический администратор

    S61 Заведующий отделением

    S64 И.о. заведующего кафедрой

    Z10 Пособия для студентов, сторонние агентства

    Z20 Неклассифицированный

    Z25 Несекретный (999X)

    010 Профессорско-штатный

    011 Профессор-неработающий

    012 Профессор-отзыв

    016 Почетный профессор

    030 Клинический профессор стоматологии - 50% или более - Срок пребывания

    031 Клинический профессор стоматологии - 50% и более - без работы

    040 Руководитель П.E.-Tenure

    041 Руководитель отдела физических и юридических услуг

    042 Начальник отдела ЧП-Отзыв

    114 Исполняющий обязанности профессора-сената

    124 Исполняющий обязанности профессора, не сенат

    210 Преподаватель-Гарантия занятости

    211 Преподаватель - Потенциальная гарантия занятости - 100% - Сенат

    212 Преподаватель-Безопасность трудоустройства-Отзыв

    216 Почетный преподаватель-Гарант занятости

    220 Преподаватель-непрерывность работы

    221 Преподаватель-потенциальная гарантия занятости

    225 Преподаватель

    311 Профессор по месту жительства

    316 ___________- Почетный сенат

    317 Профессор клинической ____________

    323 Приглашенный профессор

    335 Адъюнкт-профессор

    341 Медицинские науки Клинический профессор

    346 Клинический профессор-волонтер

    357 Помощник по обучению

    426 Ассистент преподавателя и эквивалент

    436 Аспирант-исследователь

    446 Стажер или резидент

    456 Другие звания учащихся

    467 Ассоциированный студент

    477 аспирант

    487 Вышло из употребления

    520 Астроном

    521 Астроном без должности

    522 Отзыв астронома

    523 В гостях у астронома

    524 Действующий астроном

    530 Агроном-землевладелец

    531 Агроном без права владения

    532 Отзыв агронома

    533 Выезд к агроному

    534 Агроном-и.о.

    541 Постоянные профессиональные исследования

    542 Отзыв профессиональных исследований

    543 Профессиональные исследования - посещение

    551 Специалист

    557 Специалист по сельскому хозяйству опытная станция

    566 Прочие исследования

    575 Докторант

    577 Аспирантура Не ​​студент

    581 Проект серии

    583 Посещение серии проектов

    621 Библиотекарь

    623 Приглашенный библиотекарь

    627 младший и младший библиотекарь университета

    723 Приглашенный специалист по расширению кооперативов

    727 Специалист по расширению сотрудничества

    728 Консультант по совместному расширению

    729 Специалист по расширению кооперативов

    824 Исполняющий обязанности специалиста по непрерывному образованию

    825 Дополнительный педагог - университет

    827 Специалист непрерывного образования - Расширение университета

    828 Дополнительное высшее образование Другое

    927 Прочие названия серии

    928 Разные титулы - Отдельные титулы

    999 Дополнительные коды оплаты

    Структура названия класса как ключ к академическим званиям

    Название класса - это трехзначный код.Он содержит три позиции (XYZ), значения которых имеют особое значение.

    Позиция X (Первая позиция): Код академической группы

    Административные титулы "S"

    '0' Факультет постоянного обучения - лестничные звания

    '1' Факультет постоянного обучения - действующие звания

    '2' Преподаватели

    '3' Другой педагогический факультет

    Помощники учеников "4"

    '5' Исследования

    '6' Библиотекари

    Совместное расширение "7"

    '8' Дополнительный университетский номер

    '9' Прочие академические кадры и коды заработной платы

    Должность Y (Вторая должность): членство в академическом сенате

    '0' Non-Senate, включая студенческие звания

    Членство в Сенате "1"

    '2' Non-Senate, включая студенческие звания

    '3' Non-Senate, включая студенческие звания

    '4' Non-Senate, включая студенческие звания

    '5' Non-Senate, включая студенческие звания

    '6' Non-Senate, включая студенческие звания

    '7' Non-Senate, включая студенческие звания

    '8' Non-Senate, включая студенческие звания

    '9' Non-Senate, включая студенческие звания

    Должность Z (Третья позиция): Карьерный статус

    '0' Срок пребывания в должности, государственное предприятие или непрерывность занятости

    '1' без владения, обычные звания

    '2' Отзыв

    '3' Посещение

    '4' Действующий

    '5' Дополнение

    '6' Другое

    '7' Прочее

    '8' Прочее

    '9' Прочее

    .

    Оставить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *