Гк рф ст 209 ч 1: ГК РФ Статья 209. Содержание права собственности / КонсультантПлюс

Содержание

Статья 209 ГК РФ с комментариями — Содержание права собственности

1. Собственнику принадлежат права владения, пользования и распоряжения своим имуществом.

2. Собственник вправе по своему усмотрению совершать в отношении принадлежащего ему имущества любые действия, не противоречащие закону и иным правовым актам и не нарушающие права и охраняемые законом интересы других лиц, в том числе отчуждать свое имущество в собственность другим лицам, передавать им, оставаясь собственником, права владения, пользования и распоряжения имуществом, отдавать имущество в залог и обременять его другими способами, распоряжаться им иным образом.

3. Владение, пользование и распоряжение землей и другими природными ресурсами в той мере, в какой их оборот допускается законом (статья 129), осуществляются их собственником свободно, если это не наносит ущерба окружающей среде и не нарушает прав и законных интересов других лиц.

4. Собственник может передать свое имущество в доверительное управление другому лицу (доверительному управляющему).

Передача имущества в доверительное управление не влечет перехода права собственности к доверительному управляющему, который обязан осуществлять управление имуществом в интересах собственника или указанного им третьего лица.

Комментарий к статье 209 Гражданского Кодекса РФ

1. В п. 1 комментируемой статьи дана общая характеристика правомочиям собственника. Право собственности составляет важнейший институт подотрасли вещного права и системообразующее ядро отрасли гражданского права в целом.

В субъективном смысле право собственности — это наиболее полная юридически обеспеченная возможность владеть, пользоваться и распоряжаться индивидуально-определенной вещью по своему усмотрению, независимо от других лиц и без ограничения по сроку. Ему присущи как родовые признаки вещного права (о понятии и признаках вещного права см. коммент. к ст. 216 ГК), так и видообразующие признаки, отличающие его от иных вещных прав.

2. Первым (родовым) признаком права собственности является то, что его объектом выступает индивидуально-определенная вещь.

Так, именно из-за отсутствия этого признака интеллектуальная собственность, имеющая в качестве объекта нематериальные результаты интеллектуальной деятельности и средства индивидуализации, может считаться лишь омонимом права собственности, но не его разновидностью. Нормы гл. 13 ГК о праве собственности к интеллектуальной собственности не применяются — ни прямо, ни субсидиарно, что нашло подтверждение в ст. 1227 ГК.

Понятие объекта права собственности не зависит от оборотоспособности этого объекта. В собственности находятся как объекты, не изъятые из оборота и ограниченные в обороте, так и объекты, изъятые из оборота (см. коммент. к ст. 129 ГК).

Вторым (родовым) признаком права собственности является его абсолютность. Удовлетворение интереса собственника зависит лишь от его действий; собственник не нуждается в чьей-либо помощи, чьем-либо посредничестве.

В качестве третьего (родового) признака права собственности, как и любого другого вещного права, следует назвать наличие правомочия пользования, упомянутое в п. 1 комментируемой статьи. Пользование — это юридически обеспеченная возможность извлечения из вещи полезных свойств, плодов и иных доходов в процессе ее эксплуатации.

Нарушение целевого назначения при использовании вещи не является противоправным, если только при этом не нарушаются права и законные интересы третьих лиц, а также основы правопорядка и нравственности. Так, использование земельных участков или жилых помещений в нарушение их целевого назначения может привести к прекращению права собственности на них (см. коммент. к ст. ст. 285, 293 ГК).

3. Четвертый признак права собственности — наличие наряду с правомочием пользования также правомочия владения — является уже не родовым, а видообразующим, так как характерен не для всех вещных прав. Под владением понимается юридически обеспеченная возможность волевого, фактического и непосредственного господства лица над вещью. Владение характеризуется следующими признаками.

Во-первых, оно выражается в непосредственном господстве над вещью, т. е. самостоятельном и открытом осуществлении над нею хозяйственной власти.

Во-вторых, это господство — фактическое, означающее возможность вступления в физический контакт с вещью каждый раз настолько быстро, насколько это зависит от воли владельца и содержания предоставленного ему права. Поэтому арендованный рояль, который по условиям договора продолжает оставаться в доме арендодателя, не может считаться находящимся во владении арендатора.

В-третьих, такое господство должно быть волевым, т.е. прямо направленным на желание владеть. О наличии такой воли свидетельствует как раз использование вещи (готовность начать такое использование в любой момент). Этим, строго говоря, владение (possessio) как правомочие права собственности (п. 1 комментируемой статьи) отличается как от пространственного отношения близости к вещи, так и от держания (detentio), которое предполагает обладание вещью, но не в целях извлечения из нее полезных свойств, соответствующих ее хозяйственному назначению.

Господство в держании — не самоцель, а вынужденное состояние, позволяющее решать задачи, стоящие перед держателем (хранителем, перевозчиком, комиссионером, доверительным управляющим).

4. Гражданский кодекс различает законное и незаконное владение. Законное владение осуществляется на некотором правовом основании (титуле; отсюда второе наименование — «титульное владение»). Иное владение признается незаконным, или беститульным.

В свою очередь, незаконное владение подразделяется на добросовестное и недобросовестное. Добросовестность незаконного владельца проявляется в тех случаях, когда он не знал и не мог знать о незаконности своего владения. В остальных случаях незаконный владелец является недобросовестным.

Классификация незаконного владения на добросовестное и недобросовестное имеет юридическое значение для решения вопроса о приобретении права собственности по приобретательной давности (см. коммент. к ст. 234 ГК), а также для калькуляции расчетов по доходам и расходам между истцом (собственником) и ответчиком (незаконным владельцем) при удовлетворении виндикационного иска (см. коммент. ст. 303 ГК). Вопрос же о добросовестности законного владельца не имеет правового значения.

5. Пятый (видообразующий) признак права собственности состоит в наличии правомочия распоряжения вещью, в общих чертах описанного в п. 2 комментируемой статьи. Распоряжение — это юридически обеспеченная возможность определения судьбы вещи (продажа вещи, сдача ее в залог, передача в уставный капитал хозяйственного общества, объединение имущества для совместной деятельности и т.д.). Понятия распоряжения вещью и ее отчуждения соотносятся как род и вид: не всякое распоряжение связано с отчуждением. Например, передача вещи во временное пользование (в аренду) является распоряжением ею, но не отчуждением. Однако всякое отчуждение есть акт распоряжения вещью.

В судебной практике часто возникает вопрос о действительности договора купли-продажи вещи, если на момент его заключения продавец не являлся ее собственником. Такой договор только на основании этого факта не должен признаваться недействительным. Продавец вправе во исполнение договора купли-продажи приобрести вещь уже после его заключения, а затем произвести ее отчуждение покупателю.

Формами распоряжения вещью также являются ее уничтожение и отказ от права собственности на нее. Об уничтожении (гибели) вещи см. коммент. к ст. 235 ГК.

6. В п. 2 комментируемой статьи раскрыт шестой (видообразующий) признак — осуществление правомочий собственника наиболее полным образом, в своем интересе и по своему усмотрению. Владение, пользование и распоряжение вещью составляют триаду правомочий собственника и определяют содержание права собственности. Однако те же правомочия присущи, например, обязательственному праву доверительного управления или ограниченному вещному праву хозяйственного ведения. Владение и пользование как правомочия вещного права всегда обусловлены наличием своего интереса у субъекта этого права.

Понятие собственного усмотрения можно определить как правомерную деятельность по выбору наиболее оптимального варианта реализации предоставленных правомочий. Показателен тот факт, что согласно ГК 1964 г. правомочия собственника по владению, пользованию и распоряжению имуществом осуществлялись «в пределах, установленных законом» (ст. 92). Следует считать достижением действующего Кодекса смещение акцентов на возможность осуществления собственником правомочий прежде всего по своему усмотрению.

7. В то же время право собственности небеспредельно. Коллизия между индивидуальными интересами собственника и публичным порядком неизбежна в тех случаях, когда владение, пользование (а в некоторых случаях — даже непользование: например, земельным участком сельскохозяйственного назначения в течение трех лет — гл. VII ЗК) и распоряжение вещью приводят к нарушению прав и законных интересов третьих лиц. Право частной собственности не принадлежит к таким правам, которые в соответствии со ст. 56 Конституции не подлежат ограничению ни при каких условиях (Постановление КС от 17 декабря 1996 г. N 20-П «По делу о проверке конституционности пунктов 2 и 3 части первой статьи 11 Закона Российской Федерации от 24 июня 1993 года «О федеральных органах налоговой полиции» (СЗ РФ.

1997. N 1. Ст. 197)).

Основные мотивы установления ограничений права собственности сегодня — это понимание ограниченности природных ресурсов (в том числе земли), дефицита жилья, уменьшение последствий использования источников повышенной опасности, соблюдение противопожарных, санитарных и прочих правил безопасности, недопустимость нарушения прав и законных интересов других лиц, устранения конкуренции или создания серьезной угрозы нравственности в обществе.

8. Из п. 2 комментируемой статьи вытекает, что ограничение права собственности возможно путем принятия закона или иного правового акта. В то же время по общему правилу п. 2 ст. 1 ГК ограничения гражданских прав могут вводиться только федеральным законом. Учитывая высшую юридическую силу п. 3 ст. 55 Конституции, право собственности может быть ограничено только федеральным законом (см. также п. 1 Постановления ВАС N 8).

Правда, право собственности может быть ограничено указанными актами в порядке, предусмотренном федеральным законом. Так, ограничения права собственности на транспортные средства (например, Перечень неисправностей и условий, при которых запрещается эксплуатация транспортных средств) установлены Правилами дорожного движения РФ (утв. Постановлением Совета Министров — Правительства РФ от 23 октября 1993 г. N 1090). Однако данные ограничения санкционированы ФЗ от 10 декабря 1995 г. N 196-ФЗ «О безопасности дорожного движения» (СЗ РФ. 1995. N 50. Ст. 4873).

В то же время ограничения права собственности, даже устанавливаемые федеральными законами, имеют пределы. Право собственности может быть ограничено не произвольно, а только в той мере, в какой это необходимо в целях защиты основ конституционного строя, нравственности, здоровья, прав и законных интересов других лиц, обеспечения обороны страны и безопасности государства (ст. ст. 34, 36, п. 3 ст. 55, ст. 56 Конституции, п. 2 ст. 1 ГК).

9. Право собственности не может быть ограничено договором собственника с каким-либо лицом. Интерес лица, которому собственник должен передать имущество, обеспечивается не ограничением права собственности, а обязательствами, возникающими для собственника (например, обязательством не препятствовать использованию вещи в соответствии с условиями договора). Единственной возможностью «наказать» его за отступление от договора будет привлечение к ответственности, предусмотренной договором либо при наличии оснований — законом.

10. Следует понимать, каким образом влияет возникновение ограниченного вещного права на объем права собственности. В таком случае право собственности как бы сжимается, так как правомочия владения и пользования по определению переходят к субъекту ограниченного вещного права. Право собственности само становится, по сути, ограниченным вещным правом, пока переданные вещно-правовые правомочия не вернутся к собственнику. Если к субъекту ограниченного вещного права переходит и правомочие распоряжения, то право собственности вообще приобретает характер так называемого голого права (ius nudus). В то же время собственник вещи по определению не может быть субъектом ограниченного вещного права на нее.

10. Седьмой (видообразующий) признак права собственности состоит в том, что оно является бессрочным, так как не ограничено по закону или договору каким-либо сроком.

11. В литературе можно встретить разные подходы к определению права собственности, главными из которых являются следующие два, противоположные друг другу.

Так, в определение права собственности некоторые авторы предлагают включить большее число правомочий, нежели это предусмотрено традиционной для нашего законодательства триадой владения, пользования и распоряжения. Однако при более детальном анализе оказывается, что другие перечисляемые «сверхвозможности» собственника являются лишь оттенками трех традиционных правомочий и вполне укладываются в данное выше определение права собственности.

Иногда, наоборот, указывается на бесполезность и даже вредность включения триады правомочий в определение права собственности, так как она противоречит полноте этого права. Однако никакого противоречия в данном случае нет. Во-первых, триада сформулирована столь удачно, что вбирает в себя любые возможные варианты действий собственника, причем на необходимом уровне абстрактности. Во-вторых, в определение права собственности в комментируемой статье заложены не только триада, но и указание на собственное усмотрение.

12. В п. 3 комментируемой статьи в общем виде содержится правовое регулирование отношений собственности на землю и иные природные ресурсы. При применении этого пункта следует учитывать нормы специального законодательства: гл. 17 ГК, ЛК, ЗК, Водного кодекса, Закона об обороте земель сельскохозяйственного назначения, Закона об охране окружающей среды, Закона об экологической экспертизе и т.д. (см. также коммент. к ст. 129 ГК).

13. Как уже было сказано выше, собственный интерес не встречается в обязательственных правах. Так, доверительный управляющий согласно п. 1 ст. 1012 ГК осуществляет указанные правомочия сугубо в интересах собственника или указанного им третьего лица (выгодоприобретателя). Чтобы подчеркнуть разницу между правом собственности и доверительным управлением, законодатель специально в п. 4 комментируемой статьи указал, что передача имущества в доверительное управление не влечет перехода права собственности к доверительному управляющему.

Статья 209 ГК РФ 2016-2019.

Содержание права собственности . ЮрИнспекция ГРАЖДАНСКИЙ КОДЕКС Статья 230. Безнадзорные животные 1. Лицо, задержавшее безнадзорный или пригульный скот или других безнадзорных домашних животных, обязано возвратить их собственнику, а если собственник животных или место его пребывания неизвестны, не позднее трех дней с момента задержания заявить об обнаруженных животных в полицию или в орган местного самоуправления, которые принимают меры к розыску собственника. 2. На время розыска собственника животных они могут быть оставлены лицом, задержавшим их, у себя на содержании и в пользовании либо сданы на содержание и в пользование другому лицу, имеющему необходимые для этого условия. По просьбе лица, задержавшего безнадзорных животных, подыскание лица, имеющего необходимые условия для их содержания, и передачу ему животных осуществляют полиция или орган местного самоуправления. 3. Лицо, задержавшее безнадзорных животных, и лицо, которому они переданы на содержание и в пользование, обязаны их надлежаще содержать и при наличии вины отвечают за гибель и порчу животных в пределах их стоимости. Статья 231. Приобретение права собственности на безнадзорных животных 1. Если в течение шести месяцев с момента заявления о задержании безнадзорных домашних животных их собственник не будет обнаружен или сам не заявит о своем праве на них, лицо, у которого животные находились на содержании и в пользовании, приобретает право собственности на них. При отказе этого лица от приобретения в собственность содержавшихся у него животных они поступают в муниципальную собственность и используются в порядке, определяемом органом местного самоуправления. 2. В случае явки прежнего собственника животных после перехода их в собственность другого лица прежний собственник вправе при наличии обстоятельств, свидетельствующих о сохранении к нему привязанности со стороны этих животных или о жестоком либо ином ненадлежащем обращении с ними нового собственника, потребовать их возврата на условиях, определяемых по соглашению с новым собственником, а при недостижении соглашения — судом.

Статья 209 гк рф с изменениями.

Гражданский кодекс Российской Федерации (ГК РФ). Право собственности на природные ресурсы

1. Собственнику принадлежат права владения, пользования и распоряжения своим имуществом.

2. Собственник вправе по своему усмотрению совершать в отношении принадлежащего ему имущества любые действия, не противоречащие закону и иным правовым актам и не нарушающие права и охраняемые законом интересы других лиц, в том числе отчуждать свое имущество в собственность другим лицам, передавать им, оставаясь собственником, права владения, пользования и распоряжения имуществом, отдавать имущество в залог и обременять его другими способами, распоряжаться им иным образом.

3. Владение, пользование и распоряжение землей и другими природными ресурсами в той мере, в какой их оборот допускается законом (), осуществляются их собственником свободно, если это не наносит ущерба окружающей среде и не нарушает прав и законных интересов других лиц.

4. Собственник может передать свое имущество в доверительное управление другому лицу (доверительному управляющему). Передача имущества в доверительное управление не влечет перехода права собственности к доверительному управляющему, который обязан осуществлять управление имуществом в интересах собственника или указанного им третьего лица.

Комментарий к статье 209 Гражданского Кодекса РФ

1. В п. 1 комментируемой статьи дана общая характеристика правомочиям собственника. Право собственности составляет важнейший институт подотрасли вещного права и системообразующее ядро отрасли гражданского права в целом.

В субъективном смысле право собственности — это наиболее полная юридически обеспеченная возможность владеть, пользоваться и распоряжаться индивидуально-определенной вещью по своему усмотрению, независимо от других лиц и без ограничения по сроку. Ему присущи как родовые признаки вещного права (о понятии и признаках вещного права см. коммент. к ст. 216 ГК), так и видообразующие признаки, отличающие его от иных вещных прав.

2. Первым (родовым) признаком права собственности является то, что его объектом выступает индивидуально-определенная вещь. Так, именно из-за отсутствия этого признака интеллектуальная собственность, имеющая в качестве объекта нематериальные результаты интеллектуальной деятельности и средства индивидуализации, может считаться лишь омонимом права собственности, но не его разновидностью. Нормы гл. 13 ГК о праве собственности к интеллектуальной собственности не применяются — ни прямо, ни субсидиарно, что нашло подтверждение в ст. 1227 ГК.

Понятие объекта права собственности не зависит от оборотоспособности этого объекта. В собственности находятся как объекты, не изъятые из оборота и ограниченные в обороте, так и объекты, изъятые из оборота (см. коммент. к ст. 129 ГК).

Вторым (родовым) признаком права собственности является его абсолютность. Удовлетворение интереса собственника зависит лишь от его действий; собственник не нуждается в чьей-либо помощи, чьем-либо посредничестве.

В качестве третьего (родового) признака права собственности, как и любого другого вещного права, следует назвать наличие правомочия пользования, упомянутое в п. 1 комментируемой статьи. Пользование — это юридически обеспеченная возможность извлечения из вещи полезных свойств, плодов и иных доходов в процессе ее эксплуатации.

Нарушение целевого назначения при использовании вещи не является противоправным, если только при этом не нарушаются права и законные интересы третьих лиц, а также основы правопорядка и нравственности. Так, использование земельных участков или жилых помещений в нарушение их целевого назначения может привести к прекращению права собственности на них (см. коммент. к ст. ст. 285, 293 ГК).

3. Четвертый признак права собственности — наличие наряду с правомочием пользования также правомочия владения — является уже не родовым, а видообразующим, так как характерен не для всех вещных прав. Под владением понимается юридически обеспеченная возможность волевого, фактического и непосредственного господства лица над вещью. Владение характеризуется следующими признаками.

Во-первых, оно выражается в непосредственном господстве над вещью, т. е. самостоятельном и открытом осуществлении над нею хозяйственной власти.

Во-вторых, это господство — фактическое, означающее возможность вступления в физический контакт с вещью каждый раз настолько быстро, насколько это зависит от воли владельца и содержания предоставленного ему права. Поэтому арендованный рояль, который по условиям договора продолжает оставаться в доме арендодателя, не может считаться находящимся во владении арендатора.

В-третьих, такое господство должно быть волевым, т.е. прямо направленным на желание владеть. О наличии такой воли свидетельствует как раз использование вещи (готовность начать такое использование в любой момент). Этим, строго говоря, владение (possessio) как правомочие права собственности (п. 1 комментируемой статьи) отличается как от пространственного отношения близости к вещи, так и от держания (detentio), которое предполагает обладание вещью, но не в целях извлечения из нее полезных свойств, соответствующих ее хозяйственному назначению. Господство в держании — не самоцель, а вынужденное состояние, позволяющее решать задачи, стоящие перед держателем (хранителем, перевозчиком, комиссионером, доверительным управляющим).

4. Гражданский кодекс различает законное и незаконное владение. Законное владение осуществляется на некотором правовом основании (титуле; отсюда второе наименование — «титульное владение»). Иное владение признается незаконным, или беститульным.

В свою очередь, незаконное владение подразделяется на добросовестное и недобросовестное. Добросовестность незаконного владельца проявляется в тех случаях, когда он не знал и не мог знать о незаконности своего владения. В остальных случаях незаконный владелец является недобросовестным.

Классификация незаконного владения на добросовестное и недобросовестное имеет юридическое значение для решения вопроса о приобретении права собственности по приобретательной давности (см. коммент. к ст. 234 ГК), а также для калькуляции расчетов по доходам и расходам между истцом (собственником) и ответчиком (незаконным владельцем) при удовлетворении виндикационного иска (см. коммент. ст. 303 ГК). Вопрос же о добросовестности законного владельца не имеет правового значения.

5. Пятый (видообразующий) признак права собственности состоит в наличии правомочия распоряжения вещью, в общих чертах описанного в п. 2 комментируемой статьи. Распоряжение — это юридически обеспеченная возможность определения судьбы вещи (продажа вещи, сдача ее в залог, передача в уставный капитал хозяйственного общества, объединение имущества для совместной деятельности и т.д.). Понятия распоряжения вещью и ее отчуждения соотносятся как род и вид: не всякое распоряжение связано с отчуждением. Например, передача вещи во временное пользование (в аренду) является распоряжением ею, но не отчуждением. Однако всякое отчуждение есть акт распоряжения вещью.

В судебной практике часто возникает вопрос о действительности договора купли-продажи вещи, если на момент его заключения продавец не являлся ее собственником. Такой договор только на основании этого факта не должен признаваться недействительным. Продавец вправе во исполнение договора купли-продажи приобрести вещь уже после его заключения, а затем произвести ее отчуждение покупателю.

Формами распоряжения вещью также являются ее уничтожение и отказ от права собственности на нее. Об уничтожении (гибели) вещи см. коммент. к ст. 235 ГК.

6. В п. 2 комментируемой статьи раскрыт шестой (видообразующий) признак — осуществление правомочий собственника наиболее полным образом, в своем интересе и по своему усмотрению. Владение, пользование и распоряжение вещью составляют триаду правомочий собственника и определяют содержание права собственности. Однако те же правомочия присущи, например, обязательственному праву доверительного управления или ограниченному вещному праву хозяйственного ведения. Владение и пользование как правомочия вещного права всегда обусловлены наличием своего интереса у субъекта этого права.

Понятие собственного усмотрения можно определить как правомерную деятельность по выбору наиболее оптимального варианта реализации предоставленных правомочий. Показателен тот факт, что согласно ГК 1964 г. правомочия собственника по владению, пользованию и распоряжению имуществом осуществлялись «в пределах, установленных законом» (ст. 92). Следует считать достижением действующего Кодекса смещение акцентов на возможность осуществления собственником правомочий прежде всего по своему усмотрению.

7. В то же время право собственности небеспредельно. Коллизия между индивидуальными интересами собственника и публичным порядком неизбежна в тех случаях, когда владение, пользование (а в некоторых случаях — даже непользование: например, земельным участком сельскохозяйственного назначения в течение трех лет — гл. VII ЗК) и распоряжение вещью приводят к нарушению прав и законных интересов третьих лиц. Право частной собственности не принадлежит к таким правам, которые в соответствии со ст. 56 Конституции не подлежат ограничению ни при каких условиях (Постановление КС от 17 декабря 1996 г. N 20-П «По делу о проверке конституционности пунктов 2 и 3 части первой статьи 11 Закона Российской Федерации от 24 июня 1993 года «О федеральных органах налоговой полиции» (СЗ РФ. 1997. N 1. Ст. 197)).

Основные мотивы установления ограничений права собственности сегодня — это понимание ограниченности природных ресурсов (в том числе земли), дефицита жилья, уменьшение последствий использования источников повышенной опасности, соблюдение противопожарных, санитарных и прочих правил безопасности, недопустимость нарушения прав и законных интересов других лиц, устранения конкуренции или создания серьезной угрозы нравственности в обществе.

8. Из п. 2 комментируемой статьи вытекает, что ограничение права собственности возможно путем принятия закона или иного правового акта. В то же время по общему правилу п. 2 ст. 1 ГК ограничения гражданских прав могут вводиться только федеральным законом. Учитывая высшую юридическую силу п. 3 ст. 55 Конституции, право собственности может быть ограничено только федеральным законом (см. также п. 1 Постановления ВАС N 8).

Правда, право собственности может быть ограничено указанными актами в порядке, предусмотренном федеральным законом. Так, ограничения права собственности на транспортные средства (например, Перечень неисправностей и условий, при которых запрещается эксплуатация транспортных средств) установлены Правилами дорожного движения РФ (утв. Постановлением Совета Министров — Правительства РФ от 23 октября 1993 г. N 1090). Однако данные ограничения санкционированы ФЗ от 10 декабря 1995 г. N 196-ФЗ «О безопасности дорожного движения» (СЗ РФ. 1995. N 50. Ст. 4873).

В то же время ограничения права собственности, даже устанавливаемые федеральными законами, имеют пределы. Право собственности может быть ограничено не произвольно, а только в той мере, в какой это необходимо в целях защиты основ конституционного строя, нравственности, здоровья, прав и законных интересов других лиц, обеспечения обороны страны и безопасности государства (ст. ст. 34, 36, п. 3 ст. 55, ст. 56 Конституции, п. 2 ст. 1 ГК).

9. Право собственности не может быть ограничено договором собственника с каким-либо лицом. Интерес лица, которому собственник должен передать имущество, обеспечивается не ограничением права собственности, а обязательствами, возникающими для собственника (например, обязательством не препятствовать использованию вещи в соответствии с условиями договора). Единственной возможностью «наказать» его за отступление от договора будет привлечение к ответственности, предусмотренной договором либо при наличии оснований — законом.

10. Следует понимать, каким образом влияет возникновение ограниченного вещного права на объем права собственности. В таком случае право собственности как бы сжимается, так как правомочия владения и пользования по определению переходят к субъекту ограниченного вещного права. Право собственности само становится, по сути, ограниченным вещным правом, пока переданные вещно-правовые правомочия не вернутся к собственнику. Если к субъекту ограниченного вещного права переходит и правомочие распоряжения, то право собственности вообще приобретает характер так называемого голого права (ius nudus). В то же время собственник вещи по определению не может быть субъектом ограниченного вещного права на нее.

10. Седьмой (видообразующий) признак права собственности состоит в том, что оно является бессрочным, так как не ограничено по закону или договору каким-либо сроком.

11. В литературе можно встретить разные подходы к определению права собственности, главными из которых являются следующие два, противоположные друг другу.

Так, в определение права собственности некоторые авторы предлагают включить большее число правомочий, нежели это предусмотрено традиционной для нашего законодательства триадой владения, пользования и распоряжения. Однако при более детальном анализе оказывается, что другие перечисляемые «сверхвозможности» собственника являются лишь оттенками трех традиционных правомочий и вполне укладываются в данное выше определение права собственности.

Иногда, наоборот, указывается на бесполезность и даже вредность включения триады правомочий в определение права собственности, так как она противоречит полноте этого права. Однако никакого противоречия в данном случае нет. Во-первых, триада сформулирована столь удачно, что вбирает в себя любые возможные варианты действий собственника, причем на необходимом уровне абстрактности. Во-вторых, в определение права собственности в комментируемой статье заложены не только триада, но и указание на собственное усмотрение.

12. В п. 3 комментируемой статьи в общем виде содержится правовое регулирование отношений собственности на землю и иные природные ресурсы. При применении этого пункта следует учитывать нормы специального законодательства: гл. 17 ГК, ЛК, ЗК, Водного кодекса, Закона об обороте земель сельскохозяйственного назначения, Закона об охране окружающей среды, Закона об экологической экспертизе и т.д. (см. также коммент. к ст. 129 ГК).

13. Как уже было сказано выше, собственный интерес не встречается в обязательственных правах. Так, доверительный управляющий согласно п. 1 ст. 1012 ГК осуществляет указанные правомочия сугубо в интересах собственника или указанного им третьего лица (выгодоприобретателя). Чтобы подчеркнуть разницу между правом собственности и доверительным управлением, законодатель специально в п. 4 комментируемой статьи указал, что передача имущества в доверительное управление не влечет перехода права собственности к доверительному управляющему.

Статья 209. Содержание права собственности

1. Собственнику принадлежат права владения, пользования и распоряжения своим имуществом.

2. Собственник вправе по своему усмотрению совершать в отношении принадлежащего ему имущества любые действия, не противоречащие закону и иным правовым актам и не нарушающие права и охраняемые законом интересы других лиц, в том числе отчуждать свое имущество в собственность другим лицам, передавать им, оставаясь собственником, права владения, пользования и распоряжения имуществом, отдавать имущество в залог и обременять его другими способами, распоряжаться им иным образом.

3. Владение, пользование и распоряжение землей и другими природными ресурсами в той мере, в какой их оборот допускается законом (), осуществляются их собственником свободно, если это не наносит ущерба окружающей среде и не нарушает прав и законных интересов других лиц.

4. Собственник может передать свое имущество в доверительное управление другому лицу (доверительному управляющему). Передача имущества в доверительное управление не влечет перехода права собственности к доверительному управляющему, который обязан осуществлять управление имуществом в интересах собственника или указанного им третьего лица.

Статья 210. Бремя содержания имущества

Собственник несет бремя содержания принадлежащего ему имущества, если иное не предусмотрено законом или договором.

Статья 211. Риск случайной гибели имущества

Риск случайной гибели или случайного повреждения имущества несет его собственник, если иное не предусмотрено законом или договором.

Статья 212. Субъекты права собственности

1. В Российской Федерации признаются частная, государственная, муниципальная и иные формы собственности.

2. Имущество может находиться в собственности граждан и юридических лиц, а также Российской Федерации, субъектов Российской Федерации, муниципальных образований.

3. Особенности приобретения и прекращения права собственности на имущество, владения, пользования и распоряжения им в зависимости от того, находится имущество в собственности гражданина или юридического лица, в собственности Российской Федерации, субъекта Российской Федерации или муниципального образования, могут устанавливаться лишь законом.

Законом определяются виды имущества, которые могут находиться только в государственной или муниципальной собственности.

4. Права всех собственников защищаются равным образом.

Статья 213. Право собственности граждан и юридических лиц

1. В собственности граждан и юридических лиц может находиться любое имущество, за исключением отдельных видов имущества, которое в соответствии с законом не может принадлежать гражданам или юридическим лицам.

2. Количество и стоимость имущества, находящегося в собственности граждан и юридических лиц, не ограничиваются, за исключением случаев, когда такие ограничения установлены законом в целях, предусмотренных пунктом 2 статьи 1 настоящего Кодекса.

3. Коммерческие и некоммерческие организации, кроме государственных и муниципальных предприятий, а также учреждений, являются собственниками имущества, переданного им в качестве вкладов (взносов) их учредителями (участниками, членами), а также имущества, приобретенного этими юридическими лицами по иным основаниям. (в ред. Федерального закона от 03.11.2006 N 175-ФЗ)

4. Общественные и религиозные организации (объединения), благотворительные и иные фонды являются собственниками приобретенного ими имущества и могут использовать его лишь для достижения целей, предусмотренных их учредительными документами. Учредители (участники, члены) этих организаций утрачивают право на имущество, переданное ими в собственность соответствующей организации. В случае ликвидации такой организации ее имущество, оставшееся после удовлетворения требований кредиторов, используется в целях, указанных в ее учредительных документах.

Статья 214. Право государственной собственности

1. Государственной собственностью в Российской Федерации является имущество, принадлежащее на праве собственности Российской Федерации (федеральная собственность), и имущество, принадлежащее на праве собственности субъектам Российской Федерации — республикам, краям, областям, городам федерального значения, автономной области, автономным округам (собственность субъекта Российской Федерации).

2. Земля и другие природные ресурсы, не находящиеся в собственности граждан, юридических лиц либо муниципальных образований, являются государственной собственностью.

3. От имени Российской Федерации и субъектов Российской Федерации права собственника осуществляют органы и лица, указанные в статье 125 настоящего Кодекса.

4. Имущество, находящееся в государственной собственности, закрепляется за государственными предприятиями и учреждениями во владение, пользование и распоряжение в соответствии с настоящим Кодексом (статьи 294 , ).

Средства соответствующего бюджета и иное государственное имущество, не закрепленное за государственными предприятиями и учреждениями, составляют государственную казну Российской Федерации, казну республики в составе Российской Федерации, казну края, области, города федерального значения, автономной области, автономного округа.

5. Отнесение государственного имущества к федеральной собственности и к собственности субъектов Российской Федерации осуществляется в порядке, установленном законом.

Статья 215. Право муниципальной собственности

1. Имущество, принадлежащее на праве собственности городским и сельским поселениям, а также другим муниципальным образованиям, является муниципальной собственностью.

2. От имени муниципального образования права собственника осуществляют органы местного самоуправления и лица, указанные в статье 125 настоящего Кодекса.

3. Имущество, находящееся в муниципальной собственности, закрепляется за муниципальными предприятиями и учреждениями во владение, пользование и распоряжение в соответствии с настоящим Кодексом (статьи 294, 296).

Средства местного бюджета и иное муниципальное имущество, не закрепленное за муниципальными предприятиями и учреждениями, составляют муниципальную казну соответствующего городского, сельского поселения или другого муниципального образования.статьей 305 настоящего Кодекса.

Статья 217. Приватизация государственного и муниципального имущества

Имущество, находящееся в государственной или муниципальной собственности, может быть передано его собственником в собственность граждан и юридических лиц в порядке, предусмотренном законами о приватизации государственного и муниципального имущества.

При приватизации государственного и муниципального имущества предусмотренные настоящим Кодексом положения, регулирующие порядок приобретения и прекращения права собственности, применяются, если законами о приватизации не предусмотрено иное.

1. Собственнику принадлежат права владения, пользования и распоряжения своим имуществом.

2. Собственник вправе по своему усмотрению совершать в отношении принадлежащего ему имущества любые действия, не противоречащие закону и иным правовым актам и не нарушающие права и охраняемые законом интересы других лиц, в том числе отчуждать свое имущество в собственность другим лицам, передавать им, оставаясь собственником, права владения, пользования и распоряжения имуществом, отдавать имущество в залог и обременять его другими способами, распоряжаться им иным образом.

3. Владение, пользование и распоряжение землей и другими природными ресурсами в той мере, в какой их оборот допускается законом (статья 129), осуществляются их собственником свободно, если это не наносит ущерба окружающей среде и не нарушает прав и законных интересов других лиц.

4. Собственник может передать свое имущество в доверительное управление другому лицу (доверительному управляющему). Передача имущества в доверительное управление не влечет перехода права собственности к доверительному управляющему, который обязан осуществлять управление имуществом в интересах собственника или указанного им третьего лица.

Комментарий к статье 209

Право собственности наряду с другими вещными правами характеризуется как исключительное и абсолютное, при этом по своему содержанию оно является наиболее полным. Содержание субъективного права собственности в отечественной цивилистике принято раскрывать через триаду правомочий: владение, пользование и распоряжение.

Правомочие владения представляет собой юридически обеспеченную возможность фактического контроля над имуществом.

Правомочие пользования осуществляется путем извлечения собственником в своих интересах из имущества его полезных свойств. По общему правилу собственнику принадлежат продукция, плоды и доходы, полученные в результате эксплуатации имущества.

Распоряжение является правомочием, реализация которого направлена на определение юридической судьбы имущества. Как правило, оно осуществляется путем совершения гражданско-правовых сделок, но может выражаться и в совершении односторонних, не порождающих обязательства третьих лиц, действий, например, таких как уничтожение имущества.

Состав юридически значимых актов поведения субъекта права собственности конкретизирован в части 2 статьи 209 ГК РФ, содержащей примерный перечень возможных способов пользования и распоряжения. В их числе отчуждение в порядке купли-продажи, передача прав владения и пользования (по договору аренды главным образом), завещание и т.д. В этом же контексте следует рассматривать предусмотренное частью 4 статьи 209 право собственника передавать свое имущество в доверительное управление.

При этом главным императивным требованием к реализации любого из правомочий является недопустимость нарушения прав третьих лиц. В отношении же таких объектов права собственности как земля и природные ресурсы установлено требование обеспечивать при их использовании сохранность окружающей среды. Кроме того, допускается возможность законодательного ограничения возможности свободного распоряжения данными видами имущества путем ограничения их в обороте.

Новая редакция Ст. 209 ГК РФ

1. Собственнику принадлежат права владения, пользования и распоряжения своим имуществом.

2. Собственник вправе по своему усмотрению совершать в отношении принадлежащего ему имущества любые действия, не противоречащие закону и иным правовым актам и не нарушающие права и охраняемые законом интересы других лиц, в том числе отчуждать свое имущество в собственность другим лицам, передавать им, оставаясь собственником, права владения, пользования и распоряжения имуществом, отдавать имущество в залог и обременять его другими способами, распоряжаться им иным образом.

3. Владение, пользование и распоряжение землей и другими природными ресурсами в той мере, в какой их оборот допускается законом (статья 129), осуществляются их собственником свободно, если это не наносит ущерба окружающей среде и не нарушает прав и законных интересов других лиц.

4. Собственник может передать свое имущество в доверительное управление другому лицу (доверительному управляющему). Передача имущества в доверительное управление не влечет перехода права собственности к доверительному управляющему, который обязан осуществлять управление имуществом в интересах собственника или указанного им третьего лица.

Комментарий к Ст. 209 ГК РФ

1. Понятие. Право собственности в объективном смысле — это совокупность юридических норм, закрепляющих принадлежность имущества определенным лицам, определяющих объем правомочий по владению, пользованию и распоряжению этим имуществом, а также гарантирующих охрану и защиту прав и интересов собственников.

Право собственности в субъективном смысле (субъективное право собственности) — это установленная законом мера дозволенного поведения управомоченного лица (собственника) по владению, пользованию и распоряжению принадлежащим ему имуществом своей властью и в своем интересе.

2. Правомочия собственника. Владение — основанная на законе возможность иметь вещь в своем обладании. Собственник, а также лица, которым он передал право владения своим имуществом, являются законными (титульными) владельцами.

Пользование — извлечение из имущества полезных свойств, выгоды, получение доходов.

Распоряжение — возможность совершать в отношении имущества любые действия (в том числе отчуждать в собственность третьих лиц, передавать в залог, сдавать в аренду и т.п.) вплоть до уничтожения вещи.

Собственник может передать другим лицам правомочия по владению, пользованию (чаще всего) или распоряжению (в исключительных случаях) своим имуществом.

Совокупность трех полномочий, принадлежащих собственнику, образует традиционное содержание права собственности по российскому праву.

3. Собственность и траст. В п. 4 комментируемой статьи нашла отражение дискуссия начала 1990-х гг. о возможности введения в отечественное право доверительного управления (траста) — англо-саксонского института, имеющего характер вещных прав. Законодатель подчеркивает, что в России доверительное управление является исключительно институтом обязательственного права.

Другой комментарий к Ст. 209 Гражданского кодекса Российской Федерации

1. Раздел II ГК посвящен праву собственности и другим вещным правам. Вещным правам присущи определенные общие признаки, которые и позволяют выделить их в отдельную категорию прав. Суть вещных прав состоит в возможности обладателя такого права воздействовать на вещь, получать от нее пользу по собственному усмотрению и по своей воле, помимо всяких иных лиц. Можно сказать, что вещное право предоставляет лицу власть непосредственно над вещью. В теории иногда конструируют довольно сложную схему, дополняющую эту власть также обязанностью неопределенного круга третьих лиц воздерживаться от нарушения вещного права. Делается это для того, чтобы избежать представления о вещном праве как о фактическом отношении к вещи, что противоречит его общественной природе. Однако эта конструкция представляется излишней. Во-первых, любое право нельзя нарушать третьим лицам. Следовательно, этот запрет сам по себе не в состоянии отразить суть того или иного права и не может быть отличительным признаком той или иной категории прав. Во-вторых, власть в отношении вещи, составляющая суть вещного права, — это не связь с вещью, а социально обусловленное отношение, ведь и сама вещь, и способ воздействия на нее определяются не физическими (технологическими) параметрами, а социальными, экономическими, юридическими. Иными словами, вещное право не просто власть над вещью, но юридическая власть.

Носитель вещного права может осуществлять это право независимо от других лиц. Важнейшим вещным правом является право собственника. Вещными правами лиц, не являющихся собственниками, являются права, производные и зависимые от права собственности, возникающие по воле собственника или по указанию закона и осуществляемые в пределах, установленных договором с собственником или законом (см. ст. 216 ГК РФ).

2. Вещное право, принадлежащее субъекту (субъективное вещное право), характеризуется рядом признаков.

Прежде всего, оно является правом абсолютным. Это означает, что оно противостоит всем прочим лицам, направлено против всех, исключает в отношении вещи всех иных лиц. Частное проявление абсолютности вещного права — то, что одно и то же право на вещь не может принадлежать более чем одному лицу: все другие лица исключены из этого права. В том случае, когда вещное право на одну вещь имеют несколько лиц (например, право общей собственности), они выступают в отношении этой вещи как одно лицо.

От абсолютных вещных прав отличаются права обязательственные. Обязательственное право, заключающееся в праве требования к определенному лицу, всегда относительно, осуществляется только в отношении этого обязанного лица.

Относительный характер обязательственного права предопределяет способ его реализации — путем заявления требования к должнику. Отличается и . Цессия предполагает участие сторон обязательства — кредитора и должника. Например, право арендатора, являющееся обязательственным, несмотря на повышенную защиту арендатора в виде права следования (см. п. 3), может быть передано иному лицу только в порядке цессии, тогда как вещные права передаются иным образом (ст. 223 ГК РФ).

Обязательственное право не характеризуется исключительностью: обязанное лицо может иметь такие же или аналогичные обязанности и по отношению к иным лицам, вследствие чего возникают такие институты, как конкурс кредиторов, когда несколько лиц имеют к должнику однородные требования. Поскольку обязательственные права связывают только две стороны — кредитора и должника, стороны вправе по своему усмотрению определить свои взаимоотношения. Поэтому обязательственные права могут бесконечно различаться по своему содержанию. Вещные права, действующие против всех, по тем же самым причинам не могут быть различными.

Вещные права устанавливаются законом (ст. 216 ГК и др.).

3. Субъект вещного права не может сам себе изменить характер (тип) права, а может лишь отказаться от права в одностороннем порядке.

Вещное право обладает таким качеством, как право следования. Это качество является одним из самых важных и характерных свойств вещного права. Суть его состоит в том, что у кого бы ни оказалась вещь, право на нее сохраняет субъект этого права, пока он не выразил волю на его отчуждение. Даже если вещь переходит к очередному обладателю в результате сделки, вещное право на нее продолжает следовать за нею.

Однако в тех случаях, когда нормальный порядок оборота вещи нарушается и вещь приобретается в порядке первоначального, а не производного приобретения (см. комментарий к ст. 218), утрачиваются и имеющиеся на вещь вещные права.

4. Объектом вещных прав является индивидуально-определенная вещь. Это свойство вещи, как и другие ее свойства — делимость, потребляемость и проч., определяется не столько физическими качествами вещи, сколько воззрениями оборота, т.е. параметрами экономическими и юридическими.

Одна и та же вещь может обладать и не обладать признаками индивидуально-определенной, в зависимости от конкретной юридической ситуации. Например, 100 т нефти не являются индивидуально-определенной вещью и не могут быть объектом вещного права. Но если 100 т нефти помещены в известное хранилище, то вещное право на них уже может возникнуть.

В качестве примера индивидуально-определенной вещи обычно приводятся произведения искусства (картины, скульптуры и т.д.). Однако и в этом случае юридическая квалификация вещи зависит от конкретной ситуации. Например, если дизайнер обязался по договору о создании интерьера разместить в нем 10 картин, выполненных в абстрактной манере, то речь идет о вещах родовых, даже если указан автор или авторы, выбранные сторонами (кроме случая, когда указанный автор имеет всего не более 10 картин).

Характер объекта права вытекает из сущности самого права и из способа его защиты, который также предрешен характером права. Понятно, что субъект вещного права не может распространить свою власть на вещь, которая не определена индивидуально, т.е. не отграничена так или иначе от иных вещей того же рода. Не может он отстранять от вещи и иных лиц, если неясно, что же это за вещь. А если вещь утрачена, ее истребование посредством вещных средств защиты (см. комментарий к ст. ст. 301 — 305) невозможно, так как нельзя определить, где она находится, имеется ли она вообще.

5. Вещное право действует, пока имеется индивидуально-определенная вещь, которая является объектом права, обязательственное право действует, пока имеется должник или его правопреемник. Как уничтожение вещи или утрата ею индивидуальности прекращают вещное право, так и гибель должника при отсутствии правопреемников прекращает право обязательственное (личное). Квалифицированный способ прекращения личного обязательства — банкротство, имеющее те же последствия, что и гибель должника; в то же время банкротство не затрагивает вещных прав на имущество должника.

6. В судебной практике вопрос об объекте вещного права приобретает особое значение, когда обсуждается способ защиты права. Например, неоднократно подчеркивалось, что заявление требований о праве на некоторое количество, выраженное в квадратных метрах площади, тоннах и т. д., не может квалифицироваться как вещное требование, поскольку невозможно определить индивидуально-определенную вещь, на которую претендует истец.

Чаще всего подобные коллизии возникали на почве споров об исполнении договоров о долевом участии в строительстве. Если участник строительства, ссылаясь на имеющееся у него право на долю в общей собственности, предъявляет требование о выделении ему площади в строящемся доме, указывая свои требования в размере этой площади, т.е. в квадратных метрах, то такое требование не может быть удовлетворено, поскольку отсутствует объект вещного права. Таким объектом может быть только строение или его часть. Поэтому заявленные вещные требования в квадратных метрах отклоняются судами.

Договоры долевого участия, когда они имеют природу договоров простого товарищества (совместной деятельности), приводят к возникновению общей собственности. В этом случае иск участника о признании за ним права может выражаться лишь как иск с указанием доли в виде дроби в конкретном строении. Индивидуализация объекта права достигается здесь путем указания на конкретное строение. Но и в таком случае недопустимо заявление требования, выраженного в виде размера площади или суммы инвестиций. Даже если известна общая площадь всего строения, истец должен обозначить свое право путем указания доли, рассчитанной как дробь. Суд не вправе проводить такие расчеты и таким способом конкретизировать заявленное требование.

7. Определенной спецификой обладает такой объект права, как ценные бумаги в бездокументарной форме. Если ценные бумаги (но, конечно, не закрепленные в них права) в документарной форме являются объектом вещных прав, то относительно ценных бумаг в бездокументарной форме этого сказать нельзя. По своей сути они являются выражением обязательственных прав. В то же время обороту этих прав приданы некоторые свойства оборота вещей, в частности, добросовестным приобретателям ценных бумаг даже в случае недействительности сделок в отношении этих бумаг суды предоставляют защиту (ст. 302 ГК РФ). Обладатели прав на бездокументарные ценные бумаги именуются владельцами, хотя владение как физическая власть над вещью ими не осуществляется. Напротив, сама категория владения вещью противопоставляется праву на вещь именно по тому признаку, что в первом случае речь идет о фактическом господстве над вещью, а во втором — о юридическом. Владелец ценной бумаги, имеющий именно право на бумагу, т.е. обладающий юридической властью, не отвечает общему понятию владельца. Поэтому следует прийти к выводу, что применительно к бездокументарным ценным бумагам термин «владение» приобретает специфическое значение, исключающее автоматическое применение к нему норм ГК о владении (ст. ст. 305, 234 и др.). То же самое можно сказать и о номинальном держателе бездокументарной ценной бумаги. В отличие от известного классическому праву понятия держания — несамостоятельного владения вещью для другого лица, здесь остается лишь свойство выполнения действий в чужом интересе. При этом специфика оборота ценных бумаг сказывается в отстранении фигуры обладателя права от распоряжения бумагами, пока не прекращено номинальное держание.

Например, АО предъявило иск к регистратору, требуя совершения регистрации передаточного распоряжения на передачу бездокументарных акций, сделанного их владельцем, хотя номинальный держатель, на лицевом счете которого находились акции, не давал такого распоряжения. Суд иск удовлетворил. Вышестоящий суд решение отменил, указав, что помимо номинального держателя иные лица, не имеющие данных акций на своем лицевом счете, в том числе владелец акций, не вправе совершать передаточное распоряжение о передаче акций.

Очевидно, что режим права на бездокументарные ценные бумаги не позволяет отнести это право к числу вещных. Кроме того, сами бездокументарные ценные бумаги могут обезличиваться в обороте и утрачивать всякие признаки объекта вещного права. Основной способ индивидуализации вещи, обладающей лишь родовыми признаками (а именно к таким вещам и относятся бездокументарные ценные бумаги, имеющие номинал, данные об эмитенте и эмиссии, присваиваемые сразу некоторой совокупности в принципе одинаковых бумаг), — обособление путем владения (отдельное хранение, помещение меток, упаковка и проч. ). Применительно к ценным бумагам такие способы, кроме как зачисление на лицевой счет владельца, неприменимы. Но как только бумаги поступают в оборот, они обезличиваются, и при некотором минимальном количестве операций, связанных с переходом через несколько лицевых счетов, утрачивают свою индивидуальность. С этого момента применение к ним норм разд. II ГК даже по аналогии становится невозможным.

8. Сложным в теории права остается также вопрос о праве собственника на деньги. Деньги названы ст. 128 ГК в числе вещей. Деньги являются вещами, поскольку речь идет о бумажных, металлических деньгах (монете). В отношении этих вещей, если они индивидуализированы (например, помещены в сейф), возникает право собственности с присущими вещному праву свойствами. В частности, гибель денег влечет утрату права собственности на них. В то же время законом ограничены возможности по истребованию денег из чужого незаконного владения (п. 3 ст. 302 ГК РФ).

Однако в современной экономике развитие отношений по поводу денег привело к возникновению так называемых безналичных денег. Хотя безналичные деньги очевидным образом вытесняют в обороте деньги наличные, их юридическая природа остается спорной. Во всяком случае, право на получение денег, находящихся на расчетном счете в кредитном учреждении, иные аналогичные права на денежные средства подчиняются режиму прав обязательственных, так как осуществление этих прав зависит от должника (кредитного учреждения), в том числе от его кредитоспособности. В то же время безналичные деньги не могут погибнуть физически, подобно вещам.

Хотя деньги, равно как и денежные средства, не могут быть предметом залога (см.: Вестник ВАС РФ. 1996. N 10. С. 69), однако многие юристы полагают, что право на денежные средства, принадлежащее лицу по договору банковского вклада, может быть предметом цессии подобно другим обязательственным правам. Предметом цессии может быть также право требования к кредитному учреждению о выдаче остатка по счету после расторжения договора банковского счета. Все это также позволяет считать, что денежные средства, находящиеся в кредитном учреждении (безналичные деньги), не являются вещами и не принадлежат их обладателю на вещном праве.

9. Особая ценность права собственности, его центральное положение среди имущественных прав предопределены тем, что собственность является главным условием реализации экономических и творческих способностей человека. Не получив свободного, обеспеченного всем правопорядком доступа к вещам, человек лишается возможности обеспечить свое существование, удовлетворить свои потребности. В наибольшей степени раскрытию способностей человека отвечает наиболее свободное, не стесненное чужой волей, внешними условиями отношение к вещам. Именно такое отношение обеспечивается правом собственности.

Право собственности является наиболее свободным правом лица на вещь, наиболее полным вещным правом.

10. Право собственности обладает свойством эластичности. Это означает, что как только отпадают любые ограничения права, установленные собственником в пользу других лиц, получивших право на ту же вещь, право собственности сразу же восстанавливается в полном объеме без всяких дополнительных юридических актов.

В то же время нет оснований говорить о восстановлении права собственности вследствие признания сделки об отчуждении вещи недействительной, дело в том, что фикция, заставляющая считать, что сделки не было, позволяет прийти к выводу, что и право не исчезало. Однако поскольку речь идет о вещи, действие этой фикции ограничивается состоянием самой вещи. К моменту признания сделки недействительной вещь может быть утрачена, уничтожена, переработана. Это следует и из ст. 167 ГК, предусматривающей случай невозможности возврата вещи. Таким образом, признание сделки недействительной само по себе не означает восстановления права на вещь.

От ситуации восстановления права следует отличать возвращение собственником (иным обладателем вещного права, предусматривающего владение) утраченного ранее владения вещью: в этом случае само право никак не ограничивалось в пользу определенных лиц, но утрачивалась возможность его фактического осуществления.

11. Право собственности бессрочно. Ограничение права собственности сроком означало бы тем самым ограничение прав собственника, превращение права собственности в неполное, ограниченное, что вступило бы в противоречие с сущностью этого права.

Что же касается обязательственных прав на вещь, то хотя они и позволяют так или иначе использовать вещь, однако всегда являются зависящими от воли должника и срочными, т.е. всегда ограниченными известным сроком. За его пределами пользование вещью утрачивает санкцию собственника и становится незаконным.

12. С момента установления системы регистрации права собственности и вещных прав на объекты недвижимости приобрело кардинальное значение деление вещей на движимые и недвижимые (см. комментарий к ст. ст. 130, 131).

13. Закон, следуя традиции, сложившейся в отечественном праве с XIX в., устанавливает, что собственнику принадлежат права владения, пользования и распоряжения имуществом.

При этом под владением понимается осуществление физической власти над вещью, например проживание в жилом доме, охрана иного объекта недвижимости и т.п. Пользованием является извлечение из вещи полезных свойств, например чтение книг из личной библиотеки, езда на своем автомобиле. Собственник сам определяет, в чем состоит польза той или иной его вещи, и любое его обращение с вещью, поскольку оно не противоречит закону, рассматривается как использование. Распоряжение — это прежде всего совершение с вещью различных сделок, изменяющих юридическое отношение к вещи собственника и дающих права на вещь иным лицам, в том числе отчуждение вещи, т.е. передача права собственности на нее иному лицу. Распоряжением является и уничтожение вещи, а также иные действия, влекущие утрату вещью ее сущности — потребление (например, горючего), переработка. В результате сделок и иных распорядительных актов собственника меняется юридическая судьба вещи.

14. Указание в Законе на права владения, пользования и распоряжения вещью собственником не может пониматься как исчерпание этими правомочиями всего права собственности, а также как расщепление права собственности на три или иное количество правомочий. Право собственности является единым, цельным правом и не распадается на какое-то конечное число правомочий. В законе говорится именно о праве собственности, а не об отдельных правомочиях собственника.

Это обстоятельство следует иметь в виду при квалификации сделок по поводу вещи. Передавая вещь иным лицам на том или ином праве (аренды, доверительного управления, комиссии и т.д.), собственник при этом не передает им своего права собственности — ни полностью, ни в части. Поэтому хотя арендатор владеет и пользуется полученной по договору вещью, это не может означать, что он получил от собственника правомочия владения и пользования. Права арендатора состоят в определенных правах требования к собственнику (ст. 307 ГК РФ), а собственник при этом сохраняет всю полноту своего права; именно наличие у него права собственности и обеспечивает интерес арендатора в том, чтобы собственник принял определенные имущественные обязательства перед ним. Ведь только обязательства того лица, которое сохраняет полное право на имущество, обеспечивают имущественные интересы того, кто намерен так или иначе пользоваться этим имуществом.

Ошибочное впечатление, что при заключении договоров по поводу вещи собственник якобы передает свои правомочия и тем самым лишается их, может привести к серьезным практическим ошибкам. В частности, нередко можно столкнуться с позицией, согласно которой при передаче вещи на комиссию собственник утрачивает право распоряжения ею, либо с такой, что при аресте вещи с ее одновременным изъятием право собственности вовсе исчезает, так как собственник лишен возможности и владения, и пользования, и распоряжения.

На самом деле в этих случаях право собственности по-прежнему принадлежит собственнику, а его возможности в отношении своего имущества определяются договором, и в этом случае это личные обязательства перед владельцем вещи или законом, который продолжает рассматривать его именно в качестве собственника, предоставляя ему в числе прочего и исковые средства защиты собственности против нарушителей.

15. Ошибочное представление о том, что право собственности сводится к упомянутым трем правомочиям собственника, приводит и к неверному выводу о существовании вещного права владения, отличного от права собственности. На самом деле такое право закону неизвестно. И дело не только в том, что оно не указано в ст. 216 ГК.

Как уже говорилось, собственнику принадлежит вся полнота прав на вещь. Выделение в этом праве каких-либо отдельных правомочий не имеет никакого смысла, так как и осуществление, и защита права ставятся в зависимость лишь от воли собственника, которая может быть ограничена только законом. Таким образом, предварительное выделение того или иного правомочия в составе права собственности не только лишено практического смысла, но и так или иначе будет приводить к его ограничению, что вступает в противоречие с неограниченностью этого права.

Что касается владения вещью, осуществляемого иными лицами, связанными с собственниками договором по поводу вещи, то такое владение осуществляется в силу личного обязательства, принятого на себя собственником. Очевидно, что такое право на вещь вещным не является.

Наконец, владение, осуществляемое в рамках ограниченного вещного права (см. комментарий к ст. ст. 216, 305), не существует само по себе, а является содержанием соответствующего вещного права и, следовательно, не может считаться отдельным субъективным гражданским правом.

Незаконное владение, т.е. владение без правового основания, которое осуществляется не по воле собственника, не является субъективным правом и в том случае, когда ему предоставляется защита (см. комментарий к ст. 234).

Точно так же не существует вещных прав пользования и распоряжения.

16. В п. 4 ст. 209 подчеркивается, что передача имущества в доверительное управление не влечет перехода права собственности, хотя доверительный управляющий может владеть, пользоваться и распоряжаться вещью. Тем самым вновь подчеркивается, как и в п. 2 ст. 209, что возникающие у другого лица в силу договора о передаче вещи права не тождественны ни праву собственности в целом, ни его частям, если такие части могут быть выделены. При передаче вещи по договору собственник продолжает сохранять всю полноту своего права, пока вещь не отчуждена им. Неполного, расщепленного права собственности ГК не признает. Таким образом, в норме п. 4 ст. 209 ГК подчеркивается несовместимость конструкций расщепленной собственности, в том числе возникающих на почве англо-американского траста, с российским частным правом.

17. Право собственности является наиболее полным вещным правом. Оно осуществляется по усмотрению собственника. Однако, как и любое право, может быть ограничено законом (п. 2 ст. ).

При осуществлении права собственности собственник должен действовать так, чтобы не вступать в противоречие с законом и иными правовыми актами и не нарушать права и охраняемые законом интересы других лиц. Речь идет о соблюдении различных специальных правил — противопожарных, санитарных и т.п. При этом бремя доказывания нарушения прав и законных интересов иных лиц возлагается на потерпевших. Собственник не обязан доказывать правомерность своих действий по осуществлению права собственности.

18. В практике Европейского суда по правам человека в Страсбурге неоднократно поднимался вопрос о праве государства на ограничение права собственности. Эти вопросы возникали в делах об изъятии земельных участков для общественных нужд, применительно к налоговым и таможенным обязанностям собственника. Общим выводом можно считать то, что государство вправе ограничивать право собственности исходя из публичных интересов. Однако при этом должен быть соблюден баланс частных и публичных интересов.

Насколько сложно найти такой баланс, позволяет судить, в частности, дело «James против Великобритании». Истцами оспаривался закон, по которому арендаторы, получившие в XIX в. право аренды и застройки в центральной части Лондона на 99 лет, по истечении срока аренды получили право принудительного выкупа у собственников занимаемой недвижимости по номинальной стоимости. Остроту спору придало то обстоятельство, что некоторые арендаторы, выкупив недвижимость, продавали ее третьим лицам по цене, многократно превышавшей сумму выкупа. Европейский суд по правам человека признал, что, хотя налицо вмешательство государства в право собственности, оно может быть оправдано существенным публичным интересом. В то же время практика итальянских властей, предоставлявших правительственными декретами многолетние отсрочки выселения арендаторов из арендованных жилых помещений, была признана Европейским судом неоправданной, нарушающей баланс публичных и частных интересов и ущемляющей права собственников-арендодателей.

19. Ограничением права собственности не может являться договор собственника с каким-либо лицом. Такой договор не затрагивает право собственности и не ограничивает его. Интерес лица, которому передано имущество, обеспечивается не ограничением права собственности, а принятыми собственником на себя обязательствами, в частности, обязательством предоставить вещь в надлежащем состоянии, не препятствовать ее использованию в соответствии с условиями договора и т.д. Таким образом, именно полнота права собственности обязанного лица (должника) является средством обеспечения интересов владельца (кредитора).

Норма 209 ГК РФ раскрывает суть права собственности. В частности, она устанавливает, что законный хозяин имущества может владеть, пользоваться и распоряжаться им.

Юридические возможности

Норма 209 ГК РФ указывает, что хозяин имущества может по собственному усмотрению осуществлять в отношении материальных ценностей, принадлежащих ему, любые действия, которые не противоречат установленным законным и иным правовым актам. При этом они также не должны нарушать права и интересы других лиц. По ст. 209 ГК РФ собственник может, в числе прочего, отчуждать имущество другим субъектам, предоставлять им возможность распоряжаться и пользоваться материальными ценностями, отдавать их в залог, обременять иными способами.

Пункты 3 и 4

Распоряжение, пользование и владение земельными и прочими природными ресурсами в той степени, в какой их оборот допустим по закону, производятся собственником свободно. При этом действия субъекта не должны причинять вред окружающей среде и нарушать интересы иных лиц. Хозяин материальных ценностей вправе передавать их в доверительное управление. При этом право собственности остается за ним. Доверительный управляющий, в свою очередь, обязан осуществлять надлежащие действия в интересах законного хозяина либо третьего лица, указанного им.

Статья 209 ГК РФ: комментарий

Право собственности играет ключевую роль среди всех юридических возможностей имущественного характера. К ним, в частности, относят сервитуты, хозяйственное ведение, оперативное управление и проч. Вещное право отличается рядом признаков. С одной стороны, они позволяют рассматривать их в качестве единой системы, а с другой — отличать от иных категорий. В первую очередь в качестве объекта выступает вещь. Она является предметом материального мира, который может находиться в обладании человека и служить удовлетворению его нужд.

Существование имущественных прав означает формирование отношения субъекта к вещи, которой он владеет. Когда говорят о собственности, указывают принадлежность объекта: «моё» или «чужое». Интерес обладателя права удовлетворяется через совершение собственных действий. В частности, собственник использует предмет по своему усмотрению. При этом у других лиц возникает обязанность не препятствовать субъекту в реализации его права. Этот признак позволяет четко отделить от обязательственных. В последнем случае интерес удовлетворяется через действия обязанного. считается абсолютным.

Особенности собственности

Категория, которую разъясняет статья 209 ГК РФ, в экономическом смысле представляет собой исторически сложившийся институт. В рамках развивающихся общественных отношений происходит присвоение материальных благ. В объективном смысле право собственности выступает в качестве системы норм. Ими регламентируются указанные выше общественные отношения. В субъективном смысле собственностью является мера допустимого поведения, обеспеченная законом, по распоряжению, пользованию и владению материальными ценностями. На это и указывает статья 209 ГК РФ.

Владение

Приводя к норме 209 ГК РФ комментарий, нельзя не разъяснить структурные элементы права собственности. В качестве первого выступает владение. Оно, как и остальные компоненты, упоминается в части первой. Ст. 209 ГК РФ рассматривает обладателя имущества в широком смысле. Право владения выступает в качестве обеспеченной законом возможности иметь вещь у себя в физическом смысле. Владеет предметом тот, кто его держит в руках, а также тот, в чьем хозяйстве он находится. При этом вещь должна быть доступна для технического, физического и иного воздействия. По норме 209 ГК РФ объектом владения могут выступать и земельные участки, недра, строения и прочие объекты, которые держать в руках в прямом смысле нельзя.

Особенности принадлежности права

По норме 209 ГК РФ владеть объектом может не только непосредственный собственник. Законный хозяин материальных ценностей может передать их на хранение, в аренду, в залог и так далее. Соответственно, у принимающего субъекта возникает право владения. Между тем право собственности при передаче вещи в таких случаях не утрачивается у законного хозяина. Он продолжает им оставаться. Право владения несобственника имеет производный характер. При этом субъект, принявший вещь, может не иметь возможности пользоваться ею (например, при залоге или хранении), либо ее условия определяются законным хозяином. Как правило, отсутствует и право распоряжения.

Пользование

Оно представляет собой возможность извлекать из объекта полезные свойства. Формы пользования будут зависеть от естественных характеристик вещи. В данном случае целесообразно в комментарии ст. 209 ГК РФ включить ссылки на другие нормы законодательства. Пользование вещью может осуществляться по назначению либо другим способом. Первое, в частности, закрепляют ст. 209, 288 ГК РФ. Рассматриваемые нормы разъясняют общий порядок реализации права собственности. Ст. 288 ГК содержит описание распоряжения, пользования и владения жилым помещением. В части первой этой нормы указано, в частности, что данные действия совершаются собственником в соответствии с назначением объекта. Вместе с этим у законного хозяина есть определенные обязанности. По нормам 209, 210 ГК РФ собственник, осуществляя владение, пользование и распоряжение жилым объектом, несет бремя по его содержанию, если другое не вытекает из закона либо договора.

Распоряжение

Оно предполагает возможность определять правовую судьбу вещи. Право распоряжения реализуется посредством совершения актов, направленных на достижение конкретных юридических последствий. Собственник, в частности, может продать, подарить, передать в аренду принадлежащее ему имущество. В некоторых случаях субъект, принимающий вещь, получает также и право распоряжаться ею. К примеру, наниматель при определенных обстоятельствах может сдать объект, полученный по арендному соглашению, в субаренду. Право распоряжения, однако, ограничено.

Особенности нормативных предписаний

В основном законе установлено, что никого нельзя лишить его имущества, кроме как по судебному решению. Нормами, между тем, допускается принудительное отчуждение объектов для госнужд. При этом законному хозяину должно быть предоставлено предварительно равноценное возмещение. базируется на признании неприкосновенности При установлении основания возникновения положения дают характеристику его содержанию (норма 209 ГК РФ), определяют категории субъектов и проч. Гражданским законодательством не допускается произвольное вмешательство в частные дела. Это, в числе прочего, означает невозможность затрагивать право собственности при отсутствии соответствующих оснований.

Защита субъекта

Законодательство предусматривает способы восстановления нарушенных прав. В частности, речь о судебной защите. Любой субъект, чье было нарушено, может обратиться в уполномоченную инстанцию с иском. Ущемление интересов может быть прямым либо косвенным. При нарушении непосредственно права собственности в суд направляется вещно-правовой иск. В других случаях подается обязательственно-правовое требование.

Специфика действий собственника

Пунктом вторым нормы 209 ГК РФ установлена возможность законного хозяина совершать любые сделки. При этом во избежание всевластия субъектов установлено ограничение. Действие собственника должно соответствовать законодательным предписаниям и не нарушать интересов иных лиц. Для предотвращения конфликтных ситуаций законодатель гарантирует реальность правомочий субъекта и неприкосновенность его имущества. При этом он устанавливает пределы и ограничения прав собственности. Эти границы имеют различную природу.

Пределы права

Они установлены в законодательстве. В частности, нормами запрещены действия, которые осуществляются для нанесения ущерба другим лицам, а также любые формы злоупотребления правом. Собственник может осуществлять действия, соответствующие закону и не ущемляющие интересов иных субъектов. Например, по ст. 260 хозяин участка может подарить, продать, сдать его в аренду/залог постольку, поскольку земли, в состав которых включен надел, не изъяты из оборота или не ограничены в нем.

Ограничения

Эти рамки права собственности носят субъективный характер. Они устанавливаются в зависимости от воли лиц либо судебных органов, основанной на законодательных положениях. Границы права допустимы, если стороны отношений устанавливают соответствующие ограничения по соглашению. К примеру, при подписании ипотечного договора участники сделки предусматривают, что залогодатель не может распоряжаться имуществом.

Право собственности на природные ресурсы

Ему уделяется внимание в пункте 3. В целом в отношении природных ресурсов действуют общие правила распоряжения, владения и пользования. Вместе с воспроизведением уже установленного порядка норма указывает на возможность реализации правомочий в той степени, в которой она допускается законодательством. Кроме этого, запрещается причинение ущерба природе при владении, распоряжении или пользовании.

Доверительное управление

Оно регулируется гл. 53 ГК. Доверительное управление является способом реализации права распоряжения собственником. Положения рассматриваемой нормы конкретизированы в ст. 1012 ГК (пункт первый). В соответствии с ней один участник отношений передает другому объект на конкретный срок в доверительное управление. При этом принимающая сторона берет на себя обязанности совершать надлежащие действия в интересах и в пользу собственника либо лица, указанного им.

В Самаре присяжные вынесли вердикт по делу о похищении Александра Душкова

В Самарском облсуде коллегия присяжных вынесла вердикт по уголовному делу о похищении владельца группы компаний «ЭкоВоз» Александра Душкова. Об этом корреспонденту Волга Ньюс сообщили в прокуратуре Самарской области.

Присяжные вынесли обвинительный вердикт Евгению Егорову, Александру Браеву, Роману Зинину и Сергею Сенькину. Их всех обвиняли в похищении бизнесмена и участии в подразделении ОПС Сергея Неверова, возглавляемом Тырлышкиным.

Напомним, пропавший 7 сентября 2012 г. Александр Душков был главой группы компаний «ЭкоВоз», занимавшейся обращением отходов, в том числе в Самаре. По версии следствия, в 2012 г. лидер тольяттинской ОПГ Неверов не хотел терять контролируемую ОАО «Автоградтранс» и решил приобрести акции компании. Но выяснилось, что Душков хотел приобрести эту фирму.

В число подозреваемых в причастности к исчезновению бизнесмена попал помощник Неверова Игорь Тырлышкин. Его застрелили через четыре месяца после исчезновения Душкова.

Тольяттинские оперативники и следователи не смогли раскрыть преступление. Потерпевшие добились передачи расследования в СК РФ. Почти через шесть лет начались задержания подозреваемых.

По версии предварительного следствия, заказчиком устранения конкурента был Тырлышкин, который поручил своему подчиненному Владимиру Сафронову (его называли телохранителем Неверова) разобраться с «мусорщиком». Тот привлек к этому делу Михаила Душенкова, считавшегося штатным киллером ОПГ. Вскоре он вместе с Романом Зининым и Сергеем Сенькиным похитили жертву. Обвинение опирается именно на показания этих людей, хотя эти свидетельства неоднократно менялись.

По словам обвиняемых, они дождались Душкова у ограды детского дома, куда тот часто приезжал, ударили и увезли. Позже Сафронов якобы дважды выстрелил в жертву. Затем, по показаниям обвиняемых, тело расчленили и сожгли.

Уголовное дело, насчитывающее 120 томов, поступило в Самарский областной суд 24 ноября 2020 года. Кроме похищения Душкова, 33-летнему Евгению Егорову, 37-летним Александру Браеву и Роману Зинину, 47-летнему Сергею Сенькину вменяют еще «Участие в преступном сообществе» и «Бандитизм». Также в списке обвинений, предъявленных Браеву, значится покушение на мошенничество (ч. 3 ст. 30 ч. 3 ст. 159.5 УК РФ).

29 декабря 2021 года вердиктом коллегии присяжных заседателей, Браев, Зинин, Стенькин и Егоров были признаны виновными в участии в преступном сообществе, созданном Сергеем Неверовым, для получения контроля над деятельностью различных коммерческих структур Самарской области, целью которого было систематическое совершение тяжких и особо тяжких преступлений (ч. 2 ст. 210 УК РФ), в участии в ее вооруженном структурном подразделении, возглавляемом Тырлышкиным (ч.2 ст. 209 УК РФ), а также в совершении 7 сентября 2012 года примерно в 8:53 возле жилого дома на пр. Степана Разина, 7 похищения человека — известного тольяттинского предпринимателя, директора ГК ООО «Эковоз» Александра Душкова (п. «а» ч. 3 ст. 126 УК РФ).

В облсуде пояснили, что из обвинения Браева присяжные исключили статью о покушении на мошенничество, а также решили, что Егоров имеет право на снисхождение.

Меру наказания для каждого из подсудимых представитель гособвинения запросит в прениях.

Лечение затылочной невралгии с помощью терморадиочастотной абляции

Ochsner J. 2018 Fall; 18(3): 209–214.

, MD, 1 , MD, MD, 2 , MD, 1 и, MD 1 и, MD 1

Lance M. Hoffman

1 Департамент анестезиологии, Университет Цинциннати, Цинциннати, Ох

Алаа Абд-Эльсайед

2 Кафедра анестезиологии, Школа медицины и общественного здравоохранения Университета Висконсин, Мэдисон, Висконсин

Тим Дж.Burroughs

1

1 Департамент анестезиологии, Университета Цинциннати, Цинциннати, ОН

суровые Sachdeva

1 Департамент анестезиологии, Университет Цинциннати, Цинциннати, ОН

1 Департамент анестезиологии, Университет Цинциннати, Цинциннати, Огайо

2 Кафедра анестезиологии, Школа медицины и общественного здравоохранения Университета Висконсина, Мэдисон, Висконсин

Адрес корреспонденции Лэнсу М. Хоффман, доктор медицинских наук, отделение анестезиологии, Университет Цинциннати, 2F31 Albert Sabin Way, PO Box 670531, Cincinnati, OH 45267-0531. Тел.: (309) 368-7721. Электронная почта: [email protected]Авторское право © Академический отдел Ochsner Clinic FoundationЭта статья цитировалась другими статьями в PMC.

Abstract

Справочная информация:

Затылочная невралгия — редкое заболевание, характеризующееся сильной болью, вовлекающей заднюю часть черепа в области иннервации большого и малого затылочных нервов.В случаях, не поддающихся фармакотерапии, могут быть оправданы варианты инвазивного лечения. Целью настоящего исследования было изучить влияние терморадиочастотной абляции (ТРЧ) на затылочную невралгию. Мы предположили, что эта процедура приведет к долгосрочному облегчению боли.

Методы:

Выявлены все пациенты, перенесшие ТРФ большого и малого затылочных нервов в период с 1 января 2013 г. по 23 марта 2016 г. Медицинские записи были проанализированы на предмет оценки боли до процедуры, оценки боли через 1 месяц после процедуры, определяемого пациентом процента облегчения боли в соответствии с визуальной аналоговой шкалой (на которой ноль соответствует отсутствию боли, а 10 представляет самую сильную вообразимую боль) и продолжительность обезболивания. Первичными результатами были различия между показателями боли до процедуры и через 1 месяц после процедуры (среднее изменение по сравнению с исходным уровнем), процент облегчения боли и продолжительность облегчения, о которой сообщают пациенты.

Результаты:

Всего было выявлено 50 пациентов; 4 пациента были исключены из-за недостаточности данных в результате потери для последующего наблюдения. Значительная разница была обнаружена между показателями боли, сообщаемыми пациентами до и после процедуры (6,7 против 2,7 соответственно; P < 0.001), что соответствует среднему снижению боли через 1 месяц после процедуры на 4,0 ± 3,3. Средний процент облегчения боли, определяемый пациентом, составил 76,3% ± 25,0%. Средняя продолжительность облегчения, о которой сообщают пациенты, составила 6,5 ± 5,1 месяца.

Заключение:

Это исследование предполагает, что TRF может снижать показатели боли примерно на 6 месяцев.

ключевые слова: denervation denervation , Лицевая невралгия , Лицевая лание для лица , Импульсная радиочастотная обработка

Введение

Затылочная невралгия — это необычное расстройство, характеризующееся пароксизмалом, стрельбой или углубленной болью, связанной с задней коже расположение большого и малого затылочных нервов. Большой и малый затылочные нервы отходят от медиальной ветви дорсальной ветви спинномозгового нерва С2. Выходя из-под подзатылочного треугольника между нижней косой и полуостистой мышцами головы, большой затылочный нерв часто прободает трапециевидную мышцу вблизи ее затылочных прикреплений. В нескольких точках пути прохождения нерва — от нервного отверстия к скальпу, заканчиваясь на макушке и над ухом — сжатие, раздражение и трение могут способствовать боли.Эта боль иногда связана с дизестезией или гиперестезией в пораженной области. Эти симптомы связаны с болезненностью при пальпации пораженного нерва (нервов). Реагирование на блокаду большого и/или малого затылочного нерва местным анестетиком является диагностическим признаком. 1 Затылочная невралгия часто связана с травмами головы и хлыстовыми травмами. 2 Хотя заболеваемость точно неизвестна из-за предполагаемого занижения данных и ошибочного диагноза, Koopman et al. подсчитали, что 3.2/100 000 человек могут страдать затылочной невралгией. 3

Диагноз затылочной невралгии может быть трудно поставить, в значительной степени из-за редкости этого заболевания. Лечение затылочной невралгии также может представлять проблему для медработников из-за невосприимчивости к консервативному лечению. Общие методы лечения первой линии, которые часто рассматриваются для лечения, включают нестероидные противовоспалительные препараты, противосудорожные препараты, миорелаксанты, массаж и физиотерапию. 2 В случаях, не поддающихся фармакотерапии, могут быть показаны варианты инвазивного лечения.Хотя онаботулотоксин А (БОТОКС) обычно используется для лечения хронической мигрени и цервикальной дистонии, недостаточно данных, подтверждающих его использование для лечения затылочной невралгии. В таких случаях может быть оправдана терапевтическая блокада затылочного нерва кортикостероидами. Такие блокады нервов обеспечивают симптоматическое облегчение и помогают диагностировать потенциальную цель для дальнейшего лечения. Однако, согласно последним данным (2002-2014 гг.), процедура такого типа обычно приводит к временному облегчению на срок менее 1 месяца. 4-6

Учитывая непрактичность и вредный характер многократных повторных инъекций стероидов, стратегии лечения с длительным обезболиванием вызывают интерес у многих специалистов по обезболиванию. Хотя в литературе описано множество интервенционных и хирургических процедур, в немногих исследованиях оценивалась эффективность или продолжительность действия этих вариантов лечения. 7-9 В частности, опубликованные данные о полезности и эффективности терморадиочастотной абляции (ТРЧ) для лечения затылочной невралгии ограничены. 10

Учитывая недостаток опубликованных данных о полезности TRF для лечения затылочной невралгии, это исследование было направлено на определение эффективности этого метода лечения. Общая гипотеза этого исследования заключалась в том, что TRF может уменьшать боль в течение длительного времени.

МЕТОДЫ

Это ретроспективное исследование было одобрено Институциональным наблюдательным советом Медицинского центра Университета Цинциннати (ID исследования 2014-1291). Поскольку исследование ограничивалось просмотром зарегистрированных данных, от необходимости получения информированного согласия отказались.Были идентифицированы и включены все пациенты, у которых была диагностирована затылочная невралгия после диагностической блокады затылочного нерва и которые впоследствии подверглись TRF большого и малого затылочных нервов в Университете Цинциннати в отделении медицины боли в период с 1 января 2013 г. по 23 марта 2016 г. в базе данных.

Большинству выявленных пациентов была выполнена ТРТ как большого, так и малого затылочного нерва. Чтобы сохранить согласованность внутри выборочной группы, в это исследование были включены только пациенты, перенесшие TRF как большого, так и малого затылочного нерва.Многие из пациентов, выявленных в этом исследовании, прошли более одного раунда TRF, но были собраны данные только о первой процедуре TRF каждого пациента. Пациенты с неадекватным сбором данных из-за отсутствия документации или невозможности последующего наблюдения были исключены. Всем пациентам, перенесшим ФРТ, проводилась блокада большого и малого затылочных нервов со стероидами или без них с использованием 0,25% бупивакаина. Блокада нервов выполнялась с использованием анатомических ориентиров как для большого, так и для малого затылочного нерва.Пациенты, достигшие уменьшения боли на 50% и более после блокады нервов, подходили для проведения TRF.

Процедура TRF выполнялась одинаково у всех пациентов. 50-мм изолированные иглы 20-го калибра для радиочастотного поражения (5-мм активный наконечник) помещали в непосредственной близости от большого и малого затылочных нервов с помощью методики, основанной на ориентирах. В частности, большой затылочный нерв определяли путем пальпации затылочной артерии, размещения иглы медиально от артерии, продвижения ее перпендикулярно затылочной кости до тех пор, пока игла не приблизилась к надкостнице нижележащего затылочного бугра, и при необходимости перенаправляли ее вверх до точки. выявлена ​​максимальная болезненность.Малый затылочный нерв идентифицировали путем пальпации сосцевидного отростка, введения второй иглы непосредственно медиальнее сосцевидного отростка и продвижения ее вверх до определения точки максимальной болезненности. После введения игл сенсорная стимуляция с частотой 50 Гц использовалась для подтверждения близости к нижележащим большому и малому затылочным нервам путем воспроизведения боли или парестезии в интересующей области. ТРФ проводили в режиме поражения после введения 1-2 мл 2% лидокаина.Настройки были 80°C и 180 секунд.

Мы изучили медицинские записи на предмет демографических данных пациентов, таких как возраст и пол, латеральность заболевания, показатели боли до и после процедуры, определяемый пациентом процент обезболивания и определяемая пациентом продолжительность облегчения. Оценка боли перед процедурой была определена как оценка по визуальной аналоговой шкале (ВАШ), которую пациент сообщил о боли, возникшей в затылочной части головы во время посещения офиса до прохождения процедуры. ВАШ оценивается от 0 (отсутствие боли) до 10 (самая сильная боль, какую только можно себе представить).Постпроцедурную боль определяли как оценку по ВАШ, которую пациент сообщал при посещении офиса через 1 месяц после процедуры, когда пациента конкретно спрашивали о задней головной боли и боли, иррадиирующей в заднюю часть головы. Первичными результатами были разница между показателями ВАШ до процедуры и через 1 месяц после процедуры (среднее изменение по сравнению с исходным уровнем), процент облегчения боли (согласно субъективному впечатлению пациента) и сообщаемая пациентом продолжительность купирования затылочной головной боли. Непрерывные переменные сравнивали с использованием парных тестов t , предполагая при необходимости равную или неравную дисперсию.Для ясности неравная дисперсия использовалась только при сравнении мужчин и женщин. Регрессионный анализ использовался для интерпретации любой корреляции между продолжительностью облегчения боли, о которой сообщают пациенты, и облегчением боли, которое пациент ощущал при посещении через 1 месяц после процедуры. Двусторонние значения P ≤0,05 считались статистически значимыми.

РЕЗУЛЬТАТЫ

Мы определили 50 пациентов, у которых была диагностирована затылочная невралгия после диагностической блокады затылочного нерва и которым впоследствии была проведена ТРФ большого и малого затылочных нервов в период с 1 января 2013 г. по 23 марта 2016 г.Четыре пациента были исключены из-за недостаточности данных, поэтому в анализ было включено 46 пациентов. Средний возраст пациентов составил 46,5 ± 13,6 лет, и большинство пациентов были женщинами (82,6% женщин против 17,4% мужчин). В этой популяции пациентов у 54,3% была диагностирована двусторонняя затылочная невралгия, а у 45,7% — односторонняя затылочная невралгия. Этим пациентам была выполнена двусторонняя и односторонняя TRF соответственно.

Мы обнаружили значительную разницу между показателями ВАШ до процедуры и через 1 месяц после процедуры (6.7 против 2,7, P <0,001), среднее снижение 4,0 ± 3,3 (+). Как показано на рисунке, продолжительность облегчения после TRF, о которой сообщают пациенты, различалась у разных пациентов, но в среднем составляла 6,5 ± 5,1 месяца. Это среднее значение было рассчитано на основе данных для 39 пациентов. Результаты остальных 7 пациентов были исключены, поскольку в клинической документации не было конкретно определено время облегчения. В большинстве этих случаев клиническая картина не определяла четко продолжительность облегчения из-за отсутствия постоянного наблюдения более 1 месяца.

Средние баллы боли, сообщаемые пациентами, до процедуры и через 1 месяц после терморадиочастотной абляции (n = 46), измеренные с помощью визуальной аналоговой шкалы (ВАШ), где ноль соответствует отсутствию боли, а 10 соответствует самой сильной боли, какую только можно вообразить.

Определяемая пациентом продолжительность обезболивания в месяцах после терморадиочастотной абляции (n = 39).

На основании данных, полученных от 44 пациентов, средний процент облегчения боли, о котором сообщили пациенты при контрольном посещении через 1 месяц, составил 76%.3% ± 25,0% (). Клиническая документация для двух других пациентов определила их облегчение боли как «значительное», что не может быть представлено в числовой форме.

Определяемое пациентом процентное улучшение обезболивания по сравнению с исходным уровнем после терморадиочастотной абляции (n = 44).

Регрессионный анализ для выявления любой корреляционной тенденции между продолжительностью облегчения, сообщаемой пациентом, и воспринимаемым пациентом процентом облегчения на 1-месячном визите в офис после процедуры показал статистически значимую тенденцию (), несмотря на высокую вариабельность в наборе данных ( R 2 = 0.148; скорректировано R 2 = 0,125; P = 0,016). Не было выявлено статистически значимых различий между мужчинами и женщинами при сравнении показателей боли, сообщаемых пациентами, процента облегчения или продолжительности облегчения ( P = 0,122, P = 0,475 и P = 0,490 соответственно).

Регрессионный анализ выявил корреляцию между длительностью облегчения боли, о которой сообщают пациенты, и процентом облегчения боли, о котором сообщают пациенты, при посещении врача через 1 месяц после процедуры (n = 39).

ОБСУЖДЕНИЕ

Исследователи изучали использование импульсной радиочастоты (PRF), неразрушающей формы радиочастотной терапии для лечения затылочной невралгии. Несколько исследований PRF затылочного нерва показали статистически значимое улучшение показателей боли и качества жизни, а также сокращение использования обезболивающих препаратов. 8,9,11 Cohen и соавт. сравнили эффекты PRF с блокадой затылочного нерва стероидами в рандомизированном двойном слепом исследовании и обнаружили, что PRF лучше с точки зрения уменьшения средней оценки боли через 6 недель в течение 6 месяцев. 9 Принимая во внимание эти результаты, Cohen et al. предлагают рассматривать PRF как метод лечения с длительным эффектом, помимо блокады затылочного нерва с использованием стероидов.

В зависимости от того, как радиочастотная энергия воздействует на нервные ткани, радиочастотную терапию можно определить как тепловую или импульсную. TRF производит больше тепла, что приводит к нарушению работы нервной системы за счет создания деструктивного поражения. Для сравнения, PRF обеспечивает короткие всплески тока высокой амплитуды между сравнительно длинными паузами, которые позволяют рассеивать тепло. 12 Нервная ткань сохраняется за счет рассеивания этого тепла, что доказано гистологическими исследованиями. 13-16 Преобладающая теория относительно механизма действия PRF связана с микроскопическим повреждением аксональных микротрубочек и микрофиламентов. Считается, что эти микроскопические изменения приводят к изменениям в синаптической передаче. 12-17 Особый интерес представляет тот факт, что эффекты PRF наиболее выражены в С-волокнах по сравнению с А-дельта- и А-бета-волокнами. 16 Несмотря на теоретические преимущества улучшенного предела безопасности при использовании PRF, недостаточные клинические данные поддерживают использование PRF в качестве сопоставимой альтернативы TRF для лечения хронических болевых состояний. 12,18

Несмотря на то, что ни в одном исследовании не проводилось специального сравнения результатов TRF и PRF для лечения затылочной невралгии, исследования сравнивали эти два радиочастотных метода лечения невралгии тройничного нерва, похожего нейропатического типа, опосредованного головной болью. В проспективном рандомизированном двойном слепом исследовании Erdine et al. TRF гассерова узла продемонстрировала более высокую эффективность по сравнению с PRF при лечении идиопатической невралгии тройничного нерва. 19 В общей сложности 40 пациентов были распределены либо в группу TRF, либо в группу PRF. В то время как группа TRF продемонстрировала статистически значимое снижение показателей боли и улучшение удовлетворенности пациентов, только 10% (2 из 20) пациентов в группе PRF сообщили об уменьшении показателей боли. Пациенты в группе PRF впоследствии перенесли TRF через 3 месяца из-за продолжающейся непреодолимой боли.После TRF группа PRF также показала статистически значимое уменьшение боли в дополнение к улучшению удовлетворенности, что свидетельствует о превосходстве TRF по сравнению с PRF. 19

Результаты нашего исследования согласуются с результатами другого исследования, в котором применение TRF к перикраниальным нервам уменьшало боль у пациентов с головной болью. 20 Эти данные показывают, что TRF может быть эффективным вариантом лечения затылочной невралгии, и его следует рассматривать для пациентов с затылочной невралгией, которые не реагируют на фармакологическую терапию или не переносят ее.По нашему опыту, TRF является методом лечения головной боли с относительно низким риском; у него нет побочных эффектов от лекарств и низкая частота осложнений.

Другие минимально инвазивные процедуры могут быть полезны при лечении затылочной головной боли, такие как блокада или абляция верхних медиальных ветвей шеи при фасето-опосредованной боли, вызывающей цервикогенную головную боль. Однако, поскольку блокада затылочного нерва, возможно, представляет меньший риск, чем блокада медиальной ветви С2, и может быть надежно выполнена без визуального контроля, она часто служит частью начального диагностического алгоритма для определения наиболее эффективной терапевтической цели.Учитывая низкую наблюдаемую распространенность затылочной невралгии, метод диагностики и лечения этого изнурительного состояния с низким риском может исключить ненужное лечение с увеличением побочных эффектов и осложнений.

Как указывалось ранее, ретроспективный обзор населения в целом в Нидерландах сообщил о частоте затылочной невралгии 3,2 на 100 000 человек, но это исследование, вероятно, недооценило частоту этого расстройства из-за занижения данных. 3 Одной из наиболее вероятных причин занижения данных является недостаточная осведомленность о затылочной невралгии среди врачей первичного звена, участвовавших в сборе данных.Кроме того, врачи первичной медико-санитарной помощи, создавшие эту базу данных, не стремились диагностировать и лечить определенные состояния лицевой боли. В результате в исследовании сообщалось только о случаях затылочной невралгии, в которых жалоба была точно адресована. В результате эпидемиологические данные этого расстройства еще предстоит выяснить.

Ограничения нашего исследования включают те, которые обычно связаны с ретроспективными исследованиями, в первую очередь предвзятость исследователя и смешанные переменные. Ожидания конкретного результата могут повлиять на интерпретацию результата процедуры. Более обширный вопросник, включающий функциональные изменения, может быть использован в будущих проспективных исследованиях для получения более надежной оценки результатов. Кроме того, до, во время или после лечения TRF не учитывалось никаких сопутствующих терапий. Вполне вероятно, что такие методы лечения могут повлиять на результаты, приписываемые процедуре.

Другим потенциальным ограничением этого исследования является использование метода ориентиров для идентификации большого и малого затылочных нервов. Хотя еще предстоит установить превосходство в отношении использования техники под ультразвуковым контролем над техникой на основе ориентиров для этой процедуры, в недавней литературе обычно предпочтение отдается использованию методов под визуальным контролем. 21 Поскольку большинство интервенционистов сходятся во мнении, что ультразвуковой контроль обеспечивает повышенную точность установки иглы и безопасность (в том, что касается избегания сосудистых структур), на результаты этого исследования может негативно повлиять метод, используемый для установки иглы, из-за врожденная неточность.

ЗАКЛЮЧЕНИЕ

Это исследование продемонстрировало статистически значимое снижение показателей боли, о которых сообщают пациенты, после TRF со средней продолжительностью облегчения, о которой сообщают пациенты, более 6 месяцев.Эти результаты дополняют доказательства, подтверждающие использование TRF в качестве метода лечения пациентов с диагнозом затылочная невралгия, у которых консервативное лечение оказалось неэффективным. Однако, учитывая присущие ретроспективным исследованиям ограничения, необходимо провести проспективное рандомизированное контролируемое исследование для выяснения эффективности TRF для лечения затылочной невралгии. Кроме того, учитывая высокую вариабельность продолжительности обезболивания, о которой сообщили пациенты в этом исследовании, дальнейшие исследования могут также помочь определить факторы пациента, которые играют роль в эффективности этой процедуры.

БЛАГОДАРНОСТЬ

Авторы благодарят доктора Джеймса Фортмана II, доктора Джима Брунса и Дениз Ричардсон за их помощь в поддержке этого проекта. Доктор Абд-Эльсайед является консультантом компаний Medtronic, Halyard, Axsome, Ultimaxx Health, Innocol и SpineLoop. Другие авторы не имеют финансовой или имущественной заинтересованности в предмете этой статьи.

Эта статья отвечает требованиям Совета по аккредитации последипломного медицинского образования и Американского совета по медицинским специальностям, подтверждающим компетентность в области ухода за пациентами и медицинских знаний.

ЛИТЕРАТУРА

1. Комитет по классификации головной боли Международного общества головной боли (HIS). Международная классификация головных болей, 3-е издание (бета-версия). цефалгия. 2013. Июль; 33 (9): 629-808. дои: 10.1177/0333102413485658. [PubMed] [CrossRef] [Google Scholar]2. Догерти С. Затылочная невралгия. Представитель Curr Pain Headache 2014. Май; 18 (5): 411. doi: 10.1007/s11916-014-0411-x. [PubMed] [CrossRef] [Google Scholar]3. Купман Дж. С., Дилеман Дж. П., Хюйген Ф. Дж., де Мос М., Мартин К. Г., Стуркенбум М. С.Частота лицевых болей в общей популяции. Боль. 2009. Декабрь 15;147(1-3):122-127. doi: 10.1016/j.pain.2009.08.023. [PubMed] [CrossRef] [Google Scholar]4. Африди С.К., Шилдс К.Г., Бхола Р., Годсби П.Дж. Инъекция большого затылочного нерва при синдромах первичной головной боли — пролонгированные эффекты от однократной инъекции. Боль. 2006. Май; 122 (1-2): 126-129. [PubMed] [Google Scholar]5. Ламбру Г., Абу Бакар Н., Штальхут Л. и др. . Блокада большого затылочного нерва при хронической кластерной головной боли: проспективное открытое исследование.Евр Дж Нейрол. 2014. 21 февраля (2): 338-343. doi: 10.1111/en.12321. [PubMed] [CrossRef] [Google Scholar]6. Перес М.Ф., Стайлз М.А., Сиов Х.К., Розен Т.Д., Янг В.Б., Зильберштейн С.Д. Блокада большого затылочного нерва при кластерной головной боли. цефалгия. 2002. Сентябрь; 22 (7): 520-522. [PubMed] [Google Scholar]8. Ванелдерен П., Руветт Т., Де Войт П. и др. . Импульсная радиочастота для лечения затылочной невралгии: проспективное исследование с последующим 6-месячным наблюдением. Reg Anesth Pain Med. 2010. март-апрель;35(2):148-151.[PubMed] [Google Scholar]9. Коэн С.П., Петерлин Б.Л., Фултон Л. и др. . Рандомизированное двойное слепое исследование сравнительной эффективности, сравнивающее импульсную радиочастоту с инъекциями стероидов при затылочной невралгии или мигрени с болезненностью затылочного нерва. Боль. 2015. Декабрь; 156 (12): 2585-2594. doi: 10.1097/j.pain.0000000000000373. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10. Вальдман С.Д. Атлас интервенционного обезболивания. 4-е изд. Филадельфия, Пенсильвания: Elsevier Saunders, 2015. [Google Scholar]11.Хуан Дж. Х., Гальваньо С. М. мл., Хамид Х. и др. . Импульсное радиочастотное лечение затылочного нерва: многоцентровое исследование, оценивающее предикторы исхода. Боль Мед. 2012. Апрель; 13 (4): 489-497. doi: 10.1111/j.1526-4637.2012.01348.x. [PubMed] [CrossRef] [Google Scholar] 12. Чуа Н.Х., Виссерс К.С., Слейтер М.Е. Импульсная радиочастотная терапия при интервенционном лечении боли: механизмы и потенциальные показания — обзор. Acta Neurochir (Вена). 2011. Апрель; 153 (4): 763-771. doi: 10.1007/s00701-010-0881-5. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13.Богдук Н. Импульсная радиочастота. Боль Мед. 2006. Сентябрь-октябрь; 7 (5): 396-407. [PubMed] [Google Scholar] 14. Вальехо Р., Тилли Д.М., Уильямс Дж., Лабак С., Алиага Л., Беньямин Р.М. Импульсная радиочастота модулирует экспрессию генов, регулирующих боль, вдоль ноцицептивного пути. Врач боли. 2013. Сентябрь-октябрь;16(5):E601-E613. [PubMed] [Google Scholar] 15. Эрдине С., Юсел А., Чимен А., Айдын С., Сав А., Билир А.. Влияние импульсного и обычного радиочастотного тока на морфологию ганглия задних корешков кролика. Евр Джей Пейн.2005. 9 июня (3): 251-256. [PubMed] [Google Scholar] 16. Эрдине С., Билир А., Косман Э.Р., Косман Э.Р. мл. Ультраструктурные изменения аксонов после воздействия импульсных радиочастотных полей. Практика боли. 2009. Ноябрь-декабрь; 9 (6): 407-417. doi: 10.1111/j.1533-2500.2009.00317.x. [PubMed] [CrossRef] [Google Scholar] 18. ван Боксем К., ван Эрд М., Бринхёйзен Т., Патейн Дж., ван Клиф М., ван Зундерт Дж. Радиочастотная и импульсная радиочастотная терапия хронических болевых синдромов: имеющиеся доказательства. Практика боли. 2008.Сентябрь-октябрь; 8 (5): 385-393. doi: 10.1111/j.1533-2500.2008.00227.x. [PubMed] [CrossRef] [Google Scholar] 19. Эрдине С., Озялчин Н.С., Чимен А., Челик М., Талу Г.К., Диски Р. Сравнение импульсной радиочастоты с обычной радиочастотой при лечении идиопатической невралгии тройничного нерва. Евр Джей Пейн. 2007. 11 апреля (3): 309-313. [PubMed] [Google Scholar] 20. Абд-Эльсайед А., Крюгер Л., Уилер С., Робиллард Дж., Сигер С., Дулли Д.. Радиочастотная абляция перикраниальных нервов для лечения головной боли: многообещающий вариант для пациентов.Окснер Дж. 2018. Весна;18(1):59-62. [Бесплатная статья PMC] [PubMed] [Google Scholar]21. Вандерхук М.Д., Хоанг Х.Т., Гофф Б. Блокада большого затылочного нерва под ультразвуковым контролем и импульсная радиочастотная абляция для диагностики и лечения затылочной невралгии. Анест Болеутоляющее Мед. 2013. Сентябрь; 3 (2): 256-259. doi: 10.5812/aapm.10985. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Онколитический HSV-1 G207 Иммуновиротерапия для педиатрических высокозлокачественных глиом

  • 1. Cohen KJ, Pollack IF, Zhou T, et al.Темозоломид в лечении глиом высокой степени злокачественности у детей: отчет Детской онкологической группы. Нейро Онкол 2011;13:317-323.

  • 2. Jakacki RI, Cohen KJ, Buxton A, et al. Исследование фазы 2 одновременной лучевой терапии и темозоломида с последующим назначением темозоломида и ломустина при лечении детей с глиомой высокой степени: отчет об исследовании детской онкологической группы ACNS0423. Нейро Онкол 2016;18:1442-1450.

  • 3. Клайн С., Фелтон Э., Аллен И.Е., Тахир П., Мюллер С.Исходы выживания при рецидивирующей глиоме высокой степени злокачественности у детей: результаты 20-летнего систематического обзора и метаанализа. Дж. Нейронкол 2018; 137:103-110.

  • 4. Jones C, Karajannis MA, Jones DTW, et al. Детская глиома высокой степени злокачественности: биологически и клинически нуждается в новом мышлении. Нейро Онкол 2017;19:153-161.

  • 5. Mackay A, Burford A, Carvalho D, et al. Комплексный молекулярный метаанализ 1000 педиатрических высокозлокачественных и диффузных внутренних глиом моста.Раковая клетка 2017;32(4):520-537.e5.

  • 6. Минета Т., Рабкин С.Д., Язаки Т., Хантер В.Д., Мартуза Р.Л. Аттенуированный мультимутированный вирус простого герпеса-1 для лечения злокачественных глиом. Nat Med 1995; 1:938-943.

  • 7. He B, Gross M, Roizman B. Белок гамма(1)34,5 вируса простого герпеса 1 образует комплексы с протеинфосфатазой 1альфа, чтобы дефосфорилировать альфа-субъединицу эукариотического фактора инициации трансляции 2 и предотвратить отключение синтеза белка с помощью двухцепочечной РНК-активируемой протеинкиназы. Proc Natl Acad Sci U S A 1997;94:843-848.

  • 8. Goldstein DJ, Weller SK. Активность рибонуклеотидредуктазы, индуцированная вирусом простого герпеса типа 1, необязательна для роста вируса и синтеза ДНК: выделение и характеристика мутанта с вставкой ICP6 lacZ. Дж. Вирол 1988; 62:196-205.

  • 9. Тода М., Рабкин С.Д., Кодзима Х., Мартуза Р.Л. Вирус простого герпеса как вакцина против рака in situ для индукции специфического противоопухолевого иммунитета.Hum Gene Ther 1999; 10:385-393.

  • 10. Тодо Т., Рабкин С.Д., Сундаресан П. и соавт. Системный противоопухолевый иммунитет при экспериментальной терапии опухоли головного мозга с использованием мультимутированного репликативно-компетентного вируса простого герпеса. Hum Gene Ther 1999; 10:2741-2755.

  • 11. Benencia F, Courrèges MC, Fraser NW, Coukos G. Онколитическая терапия вируса герпеса обращает вспять иммунную дисфункцию опухоли и облегчает представление опухолевого антигена. Cancer Biol Ther 2008;7:1194-1205.

  • 12. Leddon JL, Chen CY, Currier MA, et al. Онколитическая виротерапия ВПГ при саркомах мышей по-разному запускает противоопухолевый Т-клеточный ответ в отсутствие пермиссивности вируса. Mol Ther Oncolytics 2015; 1:14010-14010.

  • 13. Advani SJ, Markert JM, Sood RF, et al. Повышенная онколитическая эффективность при глиомах высокой степени злокачественности за счет оптимальной интеграции ионизирующего излучения в репликативный цикл ВПГ-1. Джин Тер 2011; 18:1098-1102.

  • 14. Markert JM, Medlock MD, Rabkin SD, et al. Условно реплицирующийся мутант вируса простого герпеса G207 для лечения злокачественной глиомы: результаты фазы I исследования. Джин Тер 2000; 7: 867-874.

  • 15. Markert JM, Liechty PG, Wang W, et al. Фаза Ib испытания мутантного вируса простого герпеса G207, инокулированного до и после резекции опухоли, для рецидивирующей глиобластомы. Мол Тер 2009; 17:199-207.

  • 16. Markert JM, Razdan SN, Kuo H-C, et al.Испытание фазы 1 онколитического HSV-1, G207, назначаемого в сочетании с облучением при рецидивирующей глиобластоме, демонстрирует безопасность и рентгенологический ответ. Мол Тер 2014; 22:1048-1055.

  • 17. Friedman GK, Bernstock JD, Chen D, et al. Повышенная чувствительность полученных от пациентов ксенотрансплантатов педиатрических опухолей головного мозга высокой степени злокачественности к онколитической виротерапии ВПГ-1 коррелирует с экспрессией нектина-1. Научный представитель 2018; 8: 13930-13930.

  • 18. Friedman GK, Langford CP, Coleman JM, et al.Сконструированные вирусы простого герпеса эффективно инфицируют и убивают CD133+ клетки ксенотрансплантата глиомы человека, которые экспрессируют CD111. Дж. Нейронкол 2009; 95:199-209.

  • 19. Friedman GK, Moore BP, Nan L, et al. Ксенотрансплантаты детской медуллобластомы, включая молекулярную подгруппу 3 и клетки CD133+ и CD15+, чувствительны к лизису онколитическими вирусами простого герпеса. Нейро Онкол 2016;18:227-235.

  • 20. Bernstock JD, Vicario N, Li R, et al. Безопасность и эффективность онколитического HSV-1 G207, инокулированного в мозжечок мышей.Раковый ген Ther 2020; 27: 246-255.

  • 21. Carceller F, Fowkes LA, Khabra K, et al. Псевдопрогрессирование у детей, подростков и молодых людей с глиомой высокой степени злокачественности, не относящейся к стволу мозга, и диффузной внутренней глиомой моста. Дж. Нейронкол 2016; 129:109-121.

  • 22. Andtbacka RHI, Kaufman HL, Collichio F, et al. Талимоген лагерпарепвек повышает частоту длительного ответа у пациентов с запущенной меланомой. Дж. Клин Онкол 2015; 33:2780-2788.

  • 23. Desjardins A, Gromeier M, Herndon JE II, et al. Рецидивирующая глиобластома лечится рекомбинантным полиовирусом. N Engl J Med 2018; 379: 150-161.

  • 24. Ланг Ф.Ф., Конрад С., Гомес-Мансано С. и др. Исследование фазы I онколитического аденовируса DNX-2401 (Delta-24-RGD): репликация и иммунотерапевтические эффекты при рецидивирующей злокачественной глиоме. Дж. Клин Онкол 2018; 36:1419-1427.

  • 25. Kaufman HL, Amatruda T, Reid T, et al.Системные и местные реакции у пациентов с меланомой, получавших талимоген лагерпарепвек, по данным многоучрежденческого исследования фазы II. J Иммунный рак 2016;4:12-12.

  • 26. Okada H, Weller M, Huang R, et al. Оценка ответа на иммунотерапию в нейроонкологии: доклад рабочей группы РАНО. Ланцет Онкол 2015;16(15):e534-e542.

  • 27. Тайпале К., Лииканен И., Коски А. и др. Прогностические и прогностические клинические переменные у онкологических больных, получавших аденовирусную онколитическую иммунотерапию. Мол Тер 2016; 24:1323-1332.

  • 28. Маротель М., Хасим М.С., Хагерман А., Ардолино М. Два лица NK-клеток в онколитической виротерапии. Цитокиновый фактор роста, ред. 2020; 56:59–68.

  • 29. Киран М.В., Гумнерова Л., Мэнли П. и др. Фаза I исследования генно-опосредованной цитотоксической иммунотерапии с AdV-tk в качестве адъюванта к хирургическому вмешательству и лучевой терапии при детской злокачественной глиоме и рецидивирующей эпендимоме. Нейро Онкол 2019;21:537-546.

  • 30. Chiocca EA, Yu JS, Lukas RV, et al. Регулируемая генная терапия интерлейкином-12 у пациентов с рецидивирующей глиомой высокой степени злокачественности: результаты исследования фазы 1. Sci Transl Med 2019;11(505):eaaw5680-eaaw5680.

  • 31. Форман П.М., Фридман Г.К., Кэссиди К.А., Маркерт Дж.М. Онколитическая виротерапия для лечения злокачественной глиомы. Нейротерапия 2017;14:333-344.

  • 32. Сюй Ф., Ли Ф.К., Морроу Р.А. и др. Распространенность вируса простого герпеса 1 типа у детей в США.Дж. Педиатр 2007; 151:374-377.

  • 33. Ланг А., Николич-Зугич Дж. Развитие и миграция защитных CD8+ Т-клеток в нервную систему после заражения глазным вирусом простого герпеса-1. Дж. Иммунол 2005; 174:2919-2925.

  • 34. Whitley RJ, Kern ER, Chatterjee S, Chou J, Roizman B. Репликация, установление латентности и индуцированная реактивация делеционных мутантов вируса простого герпеса гамма 1 34,5 в моделях грызунов. J Clin Invest 1993;91:2837-2843.

  • 35. Mackay A, Burford A, Molinari V, et al. Молекулярное, патологическое, рентгенологическое и иммунное профилирование детской глиомы высокой степени злокачественности, не относящейся к стволу головного мозга, из рандомизированного исследования HERBY фазы II. Раковая клетка 2018;33(5):829-842.e5.

  • Реакция IFN у летучих мышей демонстрирует отличительную кинетику экспрессии генов, стимулированную IFN, с атипичной индукцией RNASEL

    %PDF-1. 4 % 1 0 объект > эндообъект 4 0 объект >поток doi:10.4049/иммунол.1701214application/pdf

  • Реакция IFN у летучих мышей демонстрирует отличительную кинетику экспрессии генов, стимулированную IFN, с атипичной индукцией RNASEL
  • 10.4049/jimmunol.1701214http://dx.doi.org/10.4049/jimmunol.17012142017-11-24false10.4049/jimmunol.1701214
  • http://www.jimmunol.org
  • http://www.jimmunol.org
  • 10.4049/jimmunol.17012142017-11-24false
  • http://www.jimmunol.org
  • 2017-11-24T19:00:01+05:30Arbortext Advanced Print Publisher 9.1.510/W Unicode2022-01-28T06:29:22-08:002022-01-28T06:29:22-08:00Acrobat Distiller 10.0.0 (Windows)uuid:0096a082-1dd2-11b2-0a00-b30827bd7700uuid:0501dd20 -11b2-0a00-

    0000000 конечный поток эндообъект 3 0 объект > эндообъект 2 0 объект > эндообъект 252 0 объект >/ProcSet[/PDF/Text/ImageC]/XObject>>>/Type/Page>> эндообъект 5 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Rotate 0/Thumb 15 0 R/Type/Page>> эндообъект 6 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Rotate 0/Thumb 53 0 R/Type/Page>> эндообъект 7 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]/Properties>>>/Rotate 0/Thumb 69 0 R/Type/Page>> эндообъект 8 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text/ImageC]/Properties>/XObject>>>/Rotate 0/Thumb 73 0 R/Type/Page>> эндообъект 9 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text/ImageC]/XObject>>>/Rotate 0/Thumb 78 0 R/Type/Page>> эндообъект 10 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text/ImageC]/Properties>/Shading>/XObject>>>/Rotate 0/Thumb 83 0 R/Type/Page>> эндообъект 11 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text/ImageC]/Properties>/XObject>>>/Rotate 0/Thumb 86 0 R/Type/Page>> эндообъект 12 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Rotate 0/Thumb 92 0 R/Type/Page>> эндообъект 13 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Rotate 0/Thumb 95 0 R/Type/Page>> эндообъект 293 0 объект [297 0 Р] эндообъект 294 0 объект >поток HWr8}Wڊ»)꒷$��L.

    =ջ3=[[ؚ%$L,;Nv/2

    Сверхэкспрессия человеческого BAG3P209L у мышей вызывает рестриктивную кардиомиопатию

    Генерация αMHC-BAG3

    WT -eGFP и αMHC-BAG3 P209L -eGFP12 Человека

    0000005 -eGFP1 900 кДНК BAG3

    WT и BAG3 P209L 3 клонировали в результате слияния с кДНК eGFP под контролем промотора CAG. Путем рестрикции CAG-hBAG3 WT -eGFP с помощью EcoRI , затупления и последующего расщепления с помощью NotI фрагмент длиной 2468 пар оснований, содержащий кДНК hBAG3 WT -eGFP, был выделен и вставлен в AgeI 9045 (blunted). и NotI сайтов αMHC-плазмиды.Замена фрагмента кДНК hBAG3 WT -eGFP на эквивалентную область кДНК hBAG3 P209L , содержащую мутацию, приводила к образованию αMHC-hBAG3 P209L -eGFP.

    Все векторы были подтверждены секвенированием.

    Создание конструкций Tg(CAG-flox-hBAG3

    P209L -eGFP) и Tg(CAG-flox-hBAG3 WT -eGFP) вездесущий промотор CAG клонировали в вектор pDonor Rosa26 от Addgene (плазмида № 37200). Первоначально гигромицин-стоп-кассета, фланкированная loxP-последовательностями, была вставлена ​​ниже промотора CAG в плазмиде CAG-hBAG3 WT -eGFP и CAG-hBAG3 P209L -eGFP, соответственно, с использованием набора для условного нокаута Quick&Easy. -loxP от Джина Бриджеса. Полученные плазмиды расщепляли SnaBI и MunI. Фрагменты и 5763 п.н., содержащие 3′-часть промотора CAG, фланкированную стоп-кассету loxP и BAG WT -eGFP или BAG P209L обменивали на экспрессионные кассеты. фрагмент 2233 bp SnaBI MunI вектора CAG-eGFP-Neo pDonor Rosa26.

    Все векторы были подтверждены секвенированием.

    Получение и культивирование трансгенных клонов мЭСК

    Культивирование гибридных ЭСК G4 27 проводили в среде Игла, модифицированной Нокаутом-Дульбекко (DMEM с высоким содержанием глюкозы, с добавлением 15% об./об. фетальной телячьей сыворотки (FCS), 0,1 мМ заменимых аминокислот, 2 мг/мл L-глютамина, 50 мкг/мл пенициллина/стрептомицина, 500 ЕД/мл фактора ингибирования лейкемии (LIF), 0,1 мМ β-меркаптоэтанола). Клетки содержали на облученных устойчивых к неомицину эмбриональных фибробластах мыши (Millipore).Для получения трансгенных мЭСК 5 × 10 6 клеток смешивали с 30 мкг линеаризованной плазмидной ДНК в PBS, подвергали электропорации (250 В, 500 мкФ и 1 импульс (Bio-Rad, Gene Pulser)) и высевали на две посуда мм. Отбор трансгенных мЭСК начинали через 2 дня после электропорации путем добавления в среду 165 мкг/мл G418. Устойчивые колонии выделяли и культивировали на устойчивых к неомицину эмбриональных фибробластах мыши перед их размножением и анализировали на экспрессию BAG3 WT /BAG3 P209L -eGFP.

    Генерация трансгенных мышей

    Эксперименты на животных проводились в соответствии с указаниями Директивы 2010/63/ЕС Европейского парламента по защите животных, используемых в научных целях. Для получения линий трансгенных мышей трансгенные мЭСК с соответствующей интегрированной нацеливающей конструкцией и кариотипом из 40 хромосом агрегировали с диплоидными эмбрионами стадии морулы CD-1 28 . Для генотипирования трансгенных мышей αMHC-BAG3 WT -eGFP и αMHC-BAG3 P209L -eGFP выделяли геномную ДНК кончиков хвостов и проводили ПЦР с использованием праймеров BAG3 для и BAG3 rev (см. Табл. 2 для информации о праймерах).Количество интеграций определяли с помощью количественной ПЦР геномной ДНК с зондом на ген TfrC для нормализации. Было 18 копий трансгена у мышей αMHC-BAG3 WT -eGFP и 32 копии у мышей αMHC-BAG3 P209L -eGFP. Для генотипирования трансгенных мышей Tg(CAG-flox-hBAG3 WT -eGFP) и Tg(CAG-flox-hBAG3 P209L -eGFP) выделяли геномную ДНК кончиков хвостов и проводили ПЦР с использованием праймеров CAG2-fw. и BAG3-h-spez.tev (см. Дополнительную таблицу 2 для информации о праймерах).Количество интеграций определяли методом КПЦР как одну копию трансгена. Для линий мышей Tg(CAG-flox-hBAG3 P209L -eGFP) и Tg(CAG-flox-hBAG3 WT -eGFP) гомозиготные мыши были определены как имеющие два аллеля flox-BAG3 P209L -eGFP либо с одна или две делеции STOP-кассеты, что было достигнуто путем их скрещивания с мышами PGK-Cre. Для генотипирования мышей PGK-Cre выделяли геномную ДНК кончиков хвостов и проводили ПЦР с использованием праймеров Pgk1_for и Int-Cre_rev (информацию о праймерах см. в дополнительной таблице 2).Кроме того, у гомозиготных мышей Tg(CAG-flox-hBAG3 P209L -eGFP) только с одной делецией экспрессия была значительно выше, чем у гетерозиготных мышей с делецией.

    Мышей дикого типа (WT) определяли как нетрансгенных однопометников мышей αMHC-BAG3 WT -eGFP или αMHC-BAG3 P209L -eGFP. Контрольные мыши (CTRL) были определены как братья и сестры гомозиготных мышей PGK-Cre/CAG-flox-hBAG3 P209L -eGFP или PGK-Cre/CAG-flox-hBAG3 WT -eGFP с WT, PGK-Cre, CAG. -flox-hBAG3 P209L -eGFP или CAG-flox-hBAG3 WT -генотип eGFP.Мыши из гомозиготного штамма (PGK-Cre/CAG-flox-hBAG3 WT -eGFP) не проявляли явного фенотипа, несмотря на сильную экспрессию hBAG3 WT -eGFP в их сердцах (дополнительная рис. 10a–h). Трансгенный αMHC-BAG3 WT -eGFP, αMHC-BAG3 P209L -eGFP, Tg(CAG-flox-hBAG3 WT -eGFP), Tg(CAG-flox-hBAG3 P209L -KPG-eCFPre), Мыши /CAG-flox-hBAG3 WT -eGFP и PGK-Cre/CAG-flox-hBAG3 P209L -eGFP находились на смешанном генетическом фоне 129S6/SvEvTac × C57BL/6Ncr × CD-1.

    Сбор и фиксация сердец мышей

    Взрослых мышей подвергали гепаринизации и эвтаназии путем смещения шейных позвонков. Извлекали сердца и канюлировали аорту. Сердца перфузировали PBS, а затем 4% PFA. Дальнейшую фиксацию в 4% PFA проводили в течение ночи при 4 °C. Изолированные эмбриональные и постнатальные сердца фиксировали в 4% PFA в течение ночи при 4 °C. Сердца далее инкубировали в 20% растворе сахарозы и заключали в О.К.Т. компаунд (Sakura Finetek Europe B.V.).

    Выделение одиночных КМ с помощью диссоциации по Лангендорфу

    КМ были выделены из вскрытых сердец взрослых с использованием диссоциации по Лангендорфу 29 . Сокращение предотвращали добавлением 25 мМ БДМ во все использованные растворы. Раствор фермента предварительно нагревали до 37 °С, подключив перфузионную систему к водяной бане. Сердца были канюлированы и подключены к системе перфузии. После промывания PBS и раствором Tyrode, не содержащим Ca 2+ , сердца перфузировали раствором фермента со скоростью 2,2 мл/мин 30 . Побледневшие и мягкие сердца удаляли из перфузионной системы, предсердия отсоединяли, а желудочки измельчали ​​механически с помощью щипцов.Ферментативную реакцию останавливали 5 мл перфузионного буфера с 5% FBS, 50 мкМ CaCl 2 и суспензию фильтровали через 100-мкм клеточный фильтр. Клетки центрифугировали при 200 ×  g в течение 5 минут и ресуспендировали осадок в 5 мл перфузионного буфера с 5% FBS, 50 мкМ CaCl 2 .

    Эхокардиография

    Морфологию и функцию сердца определяли с помощью эхокардиографии в парастернальной и апикальной проекциях во время анестезии изофлураном (1,5 об. % кислорода) с использованием ультразвуковой системы VisualSonics Vevo2100 и Vevo LAB версии 3.2.5 программное обеспечение для анализа. Ударный объем рассчитывали по двумерным изображениям (ударный объем = LVIDd 3  × фракция выброса) 12 . Давление в легочной артерии получали путем неинвазивного измерения кровотока в легочной артерии, как описано ранее 31 . Исследователь не знал генотипа.

    Проточная цитометрия

    Изолированные КМ взрослых диссоциированных по Лангендорфу сердец мышей αMHC-BAG3 P209L сортировали методом проточной цитометрии при 488 нм с использованием цитометра inFlux v7 Sorter (Becton-Dickinson).Количественную оценку eGFP + CM проводили путем анализа n  = 3 экспериментов по диссоциации с использованием программного обеспечения BD FACS™ Sortware версии 1.0.1.654. Гейтинг для eGFP был установлен с использованием CM от мышей дикого типа (дополнительная рис. 12).

    Экспрессия и очистка белков

    BAG3 WT и BAG3 P209L кДНК были клонированы в pET-M11 (Novagen) и HSPB8 человека, а фрагмент кДНК FLNC человека, соответствующий Ig-подобным доменам 19–21, был клонирован в pET-28a. (Новаген).Белки, меченные His, экспрессировали и очищали с использованием Ni-NTA-агарозы (Qiagen), как описано производителем. Перед элюированием добавляли дополнительную стадию промывки MgATP (2 мМ АТФ, 1 мМ MgCl 2 , 20 мМ MOPS, pH 7,2, 100 мМ KCl). Крысиный HSPA8 экспрессировали в клетках насекомых Sf9 после инфицирования рекомбинантным бакуловирусом, несущим соответствующую кодирующую область, и затем очищали на АТФ-сефарозе (Sigma-Aldrich). IPV2 wt и IPV2 P209L , кодирующие фрагменты кДНК (соответствующие а.о. 125–285 BAG3 человека) и PPPY, кодирующие фрагменты кДНК (соответствующие а.о. 537–670 TSC1 человека), субклонировали в вектор pMAL-c2 (New England Biolabs). ).Слитые белки MBP экспрессировали в E. coli BL21 (DE3) и очищали на амилозной смоле (New England Biolabs) в соответствии с протоколом производителя (со стадией промывки MgATP, как указано выше) перед элюированием.

    Исследования связывания in vitro и антитела

    Для исследования связывания BAG3 WT /BAG3 P209L с HSPA8, HSPB8 или FLNC 1,5 мкг очищенного белка иммобилизовали соответствующим антителом на протеине G-сефарозе в течение 1 ч при 4 °С, а затем инкубировали с 1. 5 мкМ предполагаемого взаимодействующего белка в 200 мкл буфера для связывания в течение 2 часов при 4 °C с последующими шестью этапами промывки промывочным буфером и двумя промывками буфером для связывания. Оставшиеся белки элюировали глициновым буфером для элюирования (0,1 М глицин-HCl, рН 3,5), осаждали в 15% трихлоруксусной кислоте и анализировали с помощью иммуноблоттинга. Для обнаружения белка использовали следующие антитела: анти-BAG3 (10599-1-AP, Proteintech Group, 1:1000), анти-His (MCA1396, Serotec, 1:1000), анти-HSPA8 (выработанные против очищенного крысиного HSPA8 после рекомбинантную экспрессию в клетках насекомых, иммунизацию кроликов и очистку антител проводили в BioGenes GmbH, 1:1000), анти-HSPB8 (#3059, Cell Signaling Technology, 1:1000) и анти-MBP (ab23903, Abcam, 1:1000) .Необрезанные блоты и гели представлены в Исходных данных.

    Частичное расщепление трипсином

    Для выявления структурной изменчивости между диким типом и мутантным BAG3 0,7 мкМ очищенного BAG3 WT или BAG3 P209L инкубировали с 20 нМ трипсина (T1426, Sigma) при 5 °C. , 1, 2, 5 и 15 мин. Реакцию останавливали добавлением буфера для образцов SDS и немедленной инкубацией при 95°С в течение 10 мин. Образцы анализировали методом иммуноблоттинга. Неразрезанные гели представлены в Исходных данных.

    Тепловая денатурация

    Для изучения термостабильности BAG3 WT и BAG3 P209L 50 мкл очищенного белка (2 мг/мл) инкубировали при 0, 60 или 70 °C для 15 деннатурамина и 15  протеина. осаждается при 100 000 ×  г в течение 30 мин при 4 °C. Белки в супернатанте и нерастворимые белки ресуспендировали в эквивалентном объеме загрузочного буфера SDS. Супернатант и осажденные фракции анализировали с помощью SDS-PAGE, а окрашенные гели фотографировали с помощью системы визуализации Bio-Rad Chemidoc.Необрезанные блоты представлены в Исходных данных.

    Гистология, иммунофлуоресцентное окрашивание и микроскопия

    На криотоме CM 3050S (Leica) делали криосрезы толщиной 10 мкм. Окрашивание Sirius Red и Fast Green проводили с использованием стандартных гистологических протоколов. Для окрашивания фиксированных клеток и срезов сердца использовали следующие антитела (в течение 2 ч при комнатной температуре в 0,2% тритоне X в PBS, 5% ослиной сыворотке или в течение ночи при 4°C в 0,2% тритоне X в PBS, 5% ослиной сыворотке) : α-актинин (1:200, Sigma-Aldrich), BAG3 (1:200, Proteintech, распознающий человеческий и мышиный BAG3), десмин (1:100, DAKO), FLNC (1:1000, Biogene), SYNPO2 ( 1:200, Invitrogen), титин (1:50, T12 32 ), cCasp3 (1:50, Cell Signaling Technology), CD45 (1:200, Merck Millipore), CD68 (1:100, eBioscience), виментин (1:400, Merck Millipore), HSPA8 (1:200, Enzo Life Sciences), эндомуцин (1:200, Санта-Крус) и HSPB8 (1:100, Abcam).После промывки вторичные антитела, конъюгированные с Cy2, Alexa Fluor 488, Cy3 или Alexa Fluor 647 соответственно (все 1:400, Jackson ImmunoResearch), разведенные в 1 мкг мл -1 Hoechst 33342 в PBS, наносили на 1 ч при комнатной температуре. . Срезы закрывали покровными стеклами и визуализировали с помощью инвертированного флуоресцентного микроскопа (Axiovert 200, Carl Zeiss) с фильтрами для DAPI, GFP, Cy3 и Alexa Fluor 647, а также масляными объективами ×25, ×40 и DIC Plan Apochrom, светом ebx 75. источник и цифровая камера AxioCam MRm.Редактирование изображений было выполнено с помощью Axiovision Rel. 4.8 Программное обеспечение (Zeiss).

    (Иммуно)электронная микроскопия

    Фиксированные 4% PFA образцы тканей сердца 16-недельных мышей разрезали на продольные срезы с помощью вибратома VT 1000S Leica и дважды промывали в PBS. Для иммуно-ЭМ образцы блокировали в 20% NGS в течение 1 ч и инкубировали с соответствующими первичными антителами в PBS с добавлением 5% нормальной козьей сыворотки в течение ночи при 4°C. Затем срезы трижды промывали PBS и инкубировали с 1.Вторичные антитела, связанные с золотом размером 4 нм (нанозонды), в течение ночи при 4°C. После обширной промывки все срезы были постфиксированы в 1% глутаральдегиде в течение 10 минут, а после промывки срезы подверглись реакции с набором HQ Silver (Nanoprobes). После обработки OsO 4 образцы докрашивали уранилацетатом в 70% EtOH, обезвоживали и заключали в смолу Durcupan (Fluka). Ультратонкие срезы готовили с помощью Leica Ultracut S (Mannheim), а срезы адсорбировали на медные сетки, покрытые формваром и углеродом, в тлеющем разряде. Изображения были получены с использованием электронного микроскопа Zeiss LEO 910, оснащенного ПЗС-камерой TRS sharpeye (Troendle).

    Восстановление флуоресценции после фотообесцвечивания (FRAP) и анализ данных

    КМ желудочков, выделенные из αMHC-BAG3 WT /BAG3 Мышей P209L -eGFP высевали на чашки со стеклянным дном, покрытые 1% ламинином, и хранили при 37 °C и 5% CO 2 в течение всего эксперимента. Эксперименты FRAP проводились и анализировались с использованием конфокального микроскопа с вращающимся диском Cell Observer SD (Carl Zeiss, Йена, Германия), оснащенного внешним лазером с длиной волны 473 нм, подключенным через сканер (UGA-40, Rapp OptoElectronic, Гамбург), с использованием план-апохромата. ×63/1.4 масляная цель. Для анализа FRAP отдельные области Z-диска соседних зрелых миофибрилл были выбраны в качестве областей интереса (ROI). В каждой ячейке анализировали от 1 до 4 ROI. Фотообесцвечивание проводилось восемью импульсами 1 мс 473-нм лазера (100 мВт) при 100% интенсивности. Изображения были сделаны до и сразу после отбеливания. После этого отслеживали восстановление флуоресценции с интервалом времени 0,5 с в течение первых 30 с и с интервалом 1 с до конца эксперимента. Пакет ImageJ Fiji использовался для определения интенсивности флуоресценции обесцвеченных и необесцвеченных участков в каждый момент времени.Нормализованные кривые FRAP были созданы из необработанных данных, как описано ранее 33 . Вкратце, для создания скорректированных кривых FRAP интенсивность в обесцвеченной области интереса (\({I}_{{{\rm{frap}}}}\left(t\right)\)) и во всей ячейке, исключая обесцвеченную площади (\({I}_{{{\rm{total}}}}\left(t\right)\)) в каждый момент времени первоначально вычитались из соответствующей фоновой интенсивности (\({I}_{{ {\rm{bg}}}}(t)\)). Эти скорректированные интенсивности были масштабированы до интенсивностей до отбеливания (\({I}_{{{\rm{frap}}}-{{\rm{pre}}}}\) и \({I}_{{{ \rm{total}}}-{{\rm{pre}}}}\)).Это привело к следующему уравнению для расчета нормализованной кривой FRAP:

    $${I}_{{{\rm{frap}}}-{{\rm{norm}}}}\left(t\right)= \frac{{I}_{{{\rm{total}}}-{{\rm{pre}}}}}{{I}_{{{\rm{total}}}}\left(t\ справа)-{I}_{{{\rm{bg}}}}(t)}\ast \frac{{I}_{{{\rm{frap}}}}(t)-{I}_ {{{\rm{bg}}}}(t)}{{I}_{{{\rm{frap}}}-{{\rm{pre}}}}}$$

    Нормализованная интенсивность флуоресценции по сравнению с время было построено с использованием Prism 4. 0 (программное обеспечение GraphPad). Периоды полураспада t 1/2 рассчитывали следующим образом:

    $${t}_{1/2}=\frac{{\rm{ln}}(2)}{K}$ $

    Подвижные фракции ( M f ) рассчитывали по следующей формуле:

    $${M}_{{\rm{f}}}=\frac{{F}_{{{\rm {конец}}}}-{F}_{{{\rm{post}}}}}{{F}_{{{\rm{pre}}}}-{F}_{{{\rm{ post}}}}}$$

    F end — интенсивность флуоресценции на уровне плато, F post — интенсивность флуоресценции сразу после обесцвечивания, F pre — интенсивность флуоресценции на уровне плато. начало эксперимента.Результаты представлены как среднее значение ± SEM.

    Анализ тканевой РНК-Seq

    Для экспериментов RNA-Seq тотальная РНК, не содержащая ДНК, была выделена из полных сердец 6 CAG-BAG3 P209L и 6 контрольных мышей с использованием набора RNeasy Kit (Qiagen), включая расщепление ДНКазой на колонке. . Качество РНК анализировали с помощью биоанализатора Agilent (Agilent). Для подготовки библиотеки использовали набор для подготовки библиотеки Trio RNA-Seq для мышей (TECAN), начиная с 50 нг общей РНК. Для амплификации библиотек использовали тринадцать циклов ПЦР, и библиотеки со средним размером фрагмента 380  п.н. секвенировали на NextSeq 500 в режиме парных концов (75  п.н., Illumina).Для биоинформатического анализа мы использовали платформу Galaxy (Freiburg Galaxy Project 34 ). Прочтения секвенирования РНК картировали с использованием RNA STAR 35 с последующим подсчетом прочтений на ген с использованием featureCounts 36 . Дифференциально экспрессируемые гены идентифицировали с помощью DESeq2 37 . Для визуализации данных, нормализации и кластерного анализа использовалась тепловая карта2 и график вулканов (Freiburg Galaxy Project 34 ). Анализ онтологии генов был выполнен с помощью ClueGO (двусторонний гипергеометрический тест) с использованием баз данных путей KEGG и GO-term с интервалом значимости для путей p  < 0. 05. p -значения были скорректированы для многократного тестирования с помощью пошагового метода Бонферрони.

    Анализ одноклеточной РНК-Seq

    Отдельные CM из диссоциированных по Лангендорфу сердец мыши ( n  = 2 контрольных сердец и n  = 2 CAG-BAG3 P209L сердец) были отобраны вручную. планшеты, которые были заполнены 9,5 мкл лизирующего буфера (0,25 мкл ингибитора РНКазы, 0,05 мкл 10% тритона, 2,5 мкл 10 мМ dNTP, 6,7 мкл H 2 O). Процедура секвенирования мРНК одиночных клеток была проведена в Stanford Functional Genomics Facility в соответствии с протоколом SMART-seq2 38 .Вкратце, отдельные CM лизировали, а их мРНК подвергали обратной транскрипции в кДНК и предварительно амплифицировали. После процедуры очистки кДНК определяли количественно и использовали для создания библиотек одиночных клеток в соответствии с производственным протоколом в наборе библиотек ДНК Illumina Nextera. Библиотеки отдельных клеток были дополнительно секвенированы на платформе Illumina HiSeq 4000 с использованием режима 2 × 75 bp.

    Прочтения секвенирования для каждой клетки были сопоставлены с эталонной базой данных с геномом мыши и последовательностями транскриптов BAG3 и eGFP человека с использованием STAR2.7.0f с параметрами по умолчанию, а количество экспрессий генов рассчитывали с использованием параметра STAR «-quantMode GeneCounts». Дальнейший анализ данных был проведен в Seurat V3.1 с параметрами по умолчанию 39 . Вкратце, отдельные клетки были отфильтрованы на основе их общего количества экспрессированных генов, нормализованы с использованием метода нормализации глобального масштабирования «LogNormalize» и масштабированы с помощью функции «ScaleData». После дальнейшего линейного и нелинейного уменьшения размеров было построено соотношение экспрессии трансгенного человеческого BAG3 и мышиного эндогенного Bag3 с использованием функции VlnPlot.Анализ дифференциальной экспрессии выполняли в виде кластерного анализа данных одноклеточной РНК-Seq. Кластеры одиночных клеток мышей CAG-BAG3 P209L ( n  = 80 ярких CM от 2 мышей) и контрольных мышей ( n  = 33 CM от 2 мышей) объединяли и анализировали на наличие дифференциально экспрессируемых генов с использованием функции FindMarkers. в Сера V3.1.

    Подготовка образцов протеома и сбор данных

    Образцы сердца мыши собирали, взвешивали и замораживали в жидком азоте до использования.Для анализа протеома около 100 мг образца сердца гомогенизировали с использованием TissueLyser LT (Qiagen) в 1 мл 50 мМ Трис-буфера (pH 6,8), содержащего 8 М мочевины, 2 % SDS, 1,5 % Triton-X100, 1 мМ DTT, 1 мл. мМ PMSF и смесь ингибиторов протеазы 1:100 (об./об.). Концентрацию белка измеряли с использованием набора для анализа белка Pierce BCA (Thermo Scientific), а 100 мкг протеома восстанавливали с помощью 10 мМ DTT при 37 °C в течение 30 минут с последующим карбамидометилированием с использованием 50 мМ хлорацетамида при комнатной температуре (КТ) в темноте в течение еще 30 минут. мин.Реакцию гасили 50 мМ ДТТ при комнатной температуре в течение 20 мин. Белки очищали с использованием парамагнитных гранул SP3 и элюировали буфером для расщепления, содержащим 50 мМ HEPES, pH 7,4, и 5 мМ CaCl 2 . К элюированному протеому добавляли трипсин (Serva) в соотношении 1:100 (мас. /мас.) и инкубировали на шейкере при 37°С в течение 18 ч. Расщепленные пептиды были обессолены путем обращенно-фазовой твердофазной экстракции с использованием самонабивающихся наконечников C18 STAGE перед анализом с помощью системы нано-ЖХ (Dionex NCS-3500 RS), работающей на двух колонках (колонка-ловушка PharmaFluidics µPAC C18 и Аналитическая колонка PharmaFluidics µPAC C18 диаметром 50 см).500 нг пептида разделяли при скорости потока 600 нл/мин с бинарным градиентом от 2 до 32% элюента B (A, 0,1% муравьиной кислоты в воде для ВЭЖХ; B, 0,1% муравьиной кислоты в ацетонитриле) и вводили в масс-спектрометр Q-TOF высокого разрешения (Impact-II, Bruker) с использованием ионного источника CaptiveSpray. Программное обеспечение HyStar (v3.2, Bruker Daltonics) использовалось для сбора данных в линейном режиме в диапазоне масс от 200 до 1750 m/z с частотой сбора данных 4 Гц для спектров MS1, и 17 наиболее интенсивных ионов были выбраны. отобраны для фрагментации.Окно динамического исключения прекурсоров, выбранных в течение 30 с, применялось, если отношение сигнал/шум не улучшалось более чем в 3 раза. Спектры фрагментации были получены между 5 Гц для ионов-предшественников низкой интенсивности (> 500 cts) и 20 Гц для ионов высокой интенсивности (> 5 тыс. cts), каждый со ступенчатыми параметрами, каждый с 50% времени сбора данных, выделенным для каждого предшественника: 100 время передачи в мкс, энергия столкновения 7 эВ и RF столкновения 1500 Vpp, за которым следует время передачи 100 µs, энергия столкновения 9 eV и RF столкновения 1700 Vpp.

    Анализ протеомных данных

    Сопоставление спектра с последовательностью проводили с MaxQuant версии 1.6.6.0 и 1.6.10.43 40 для данных, полученных от 2-недельных сердец ( n  = 6 контрольных и 6 CAG-BAG3

    4 P2004 ) и 5-недельных мышей ( n  = 6 контрольных и 6 сердец CAG-BAG3 P209L ), соответственно, с использованием стандартных настроек для инструментов Bruker Q-TOF. База данных белка UniProt Mus musculus с добавленными общими примесями, перечисленными в MaxQuant, последовательность BAG3 P209L -GFP человека и последовательности обратной ловушки использовались для поиска в базе данных цель-ловушка с FDR 0. 01 на уровне PSM и белка. Были включены функции количественного определения без меток (LFQ) и «совпадения между сериями». Трипсин был установлен как пищеварительный фермент, окисление (M) и ацетилирование (N-конец белка) были установлены как переменные модификации, в то время как карбамидометилирование цистеина было установлено как фиксированная модификация. Данные LFQ были проанализированы с использованием Perseus 40 версии 1.6.10.0, с фильтрацией белков, количественно определенных по крайней мере в четырех биологических повторах/животных по крайней мере в одном из двух генотипов, с последующим вменением отсутствующих значений с использованием стандартных настроек Perseus и определением значимых изменяется с помощью двухвыборочного t-критерия с FDR Бенджамини-Хохберга < 0.05, чтобы скорректировать множественную проверку гипотез.

    Иммуноблот-анализ сердец мышей

    Для выделения белка сердца механически гомогенизировали в мочевинном буфере (8 M мочевина, 2% SDS, 1,5% Igepal, 0,05 M Tris-HCL pH 6,8 в водной биде) с ингибиторами протеаз (Roche) . Концентрацию белка определяли с использованием набора для анализа белка Pierce BCA (Thermo Fischer Scientific). SDS-PAGE проводили в 12,5% полиакриламидном геле. Затем белки переносили на нитроцеллюлозную мембрану методом полусухого блоттинга.Использовали следующие первичные антитела: анти-альфа-В кристаллин (1:5000, Enzo Life Science), анти-HSPB7 (1:1000, Abcam), анти-HSPB8 (1:1000, Abcam), анти-LC3B (1:1000). , Thermo Fisher Scientific), анти-p62 (1:1000, Progen), анти-Bag3 (1:5000, Proteintech), анти-GAPDH (1:1000, Calbiochem), анти-mCherry (1:5000, Novus), бета-актин (1:2000, Invitrogen). Антитело против мыши, связанное с пероксидазой (1:10 000, Jackson ImmunoResearch), антитело, связанное с Cy3, против кролика (1:3000, Jackson ImmunoResearch) и антитело, связанное с Alexa Fluor 647, против кролика (1:3000, Jackson ImmunoResearch) использовали в качестве вторичных антител.Хемилюминесцентные сигналы регистрировали с использованием субстрата SuperSignal TM West Pico Plus Substrate (Thermo Fischer Scientific) и системы визуализации ChemiDocTM MP (BioRad), а сигналы флуоресценции — непосредственно с помощью системы визуализации ChemiDocTM MP (BioRad). Интегральные интенсивности белковых полос количественно определяли с использованием программного обеспечения Fiji (ImageJ) версии 1.47n или программного обеспечения Image Lab версии 5.2.1. Необрезанные блоты представлены в Исходных данных.

    Фракционирование и иммуноблот-анализ сердец мышей

    Замороженные сердца гомогенизировали в 2-мл пробирках с безопасным замком (Eppendorf) с 7-мм шариками из нержавеющей стали (Qiagen, 69990) в 16 мкл/мг ткани низкосолевого буфера (30 мМ фосфата). буфер рН 6.8, 100 мМ KCl, 5 мМ EDTA, 5 мМ EGTA, 1 мМ DTT и ингибиторы протеазы (Sigma-Aldrich) в течение 5 мин при 50 Гц в предварительно охлажденном Tissue Lyser LT (Qiagen). После обработки ультразвуком на льду с использованием ультразвукового процессора (UP100, Hielscher) при цикле 0,9 и амплитуде 100% в течение не менее 10 вспышек нерастворимая фракция осаждается центрифугированием (16000 ×  г в течение 15 мин). Собирали супернатант и растворяли осадок в 16 мкл мочевинного буфера (100 мМ трис, рН 6,8, 2 М тиомочевины, 7 М мочевины, 5 мМ ЭГТА, 5 мМ ЭДТА, 1 мМ ДТТ и ингибиторы протеазы) на мг осадка с использованием Tissue Lyser (2 мин, 50 Гц), как описано выше, с последующей инкубацией в течение 15 мин при 37°C. Предварительно нагретый 5-кратно концентрированный SDS-буфер для образцов добавляли к супернатанту и солюбилизированному осадку до конечной 2-кратной концентрации и образцы инкубировали в течение 5 минут при 55 °C. Все экстракты анализировали электрофорезом в полиакриламидном геле. Гели окрашивали красителем Coomassie Brilliant Blue R-250 и измеряли относительную концентрацию общего белка с использованием системы инфракрасной визуализации LI-COR Odyssey (LI-COR Biosciences). Для сравнительного количественного блоттинга одинаковые количества общего белка разделяли на полиакриламидных гелях и белки переносили на мембраны PVDF с использованием аппарата Transblot SD (Biorad).Окрашивание Ponceau Red подтвердило эффективность переноса. Мембраны инкубировали с кроличьим поликлональным антителом против BAG3 (Proteintech 1:5000) и козьим вторичным антителом против кролика, конъюгированным с IRDye-800 (LI-COR Biosciences, 1:10 000), и анализировали с использованием системы инфракрасной визуализации LI-COR Odyssey. (LI-COR Biosciences). Интегральные интенсивности белковых полос количественно определяли с использованием программного обеспечения для инфракрасной визуализации Odyssey v. 3.0 (LI-COR Biosciences). Эффективность фракционирования проверяли окрашиванием анти-pan MyHC (клон MF20, 1:100), распознающим все изоформы тяжелых цепей миозина и анти-GAPDH (1:1000), с последующим окрашиванием козьим антимышиным вторичным антителом, конъюгированным с IRDye-800. антитело (LI-COR Biosciences, 1:10 000).Это подтвердило присутствие тяжелых цепей миозина только в нерастворимой фракции и GAPDH только в супернатанте. Необрезанные блоты и гели представлены в Исходных данных.

    Инъекция AAV/rh20

    Для генной терапии использовали AAV/rh20-mCherry-U6-h-BAG3-shRNA (RNAi) и AAV/rh20-mCherry-U6-scrmb-shRNA (контроль) (Vector BioLabs ). Оба вируса содержат кДНК mCherry, управляемую CMV, и либо управляемую промотором U6 кшРНК против BAG3 человека (целевая последовательность CTTGAACAGAAAGCCATTGAT), либо случайно скремблированную кшРНК. Общий объем 100 мкл PBS, содержащий 2 × 10 12 вирусных частиц либо РНКи, либо контрольного AAV/rh20, вводили в левую яремную вену мышам P15 CAG-BAG3 P209L . Через 3 недели мышей вскрывали (P37) и анализировали.

    Статистика

    Данные представлены в виде среднего ± SEM или среднего ± SD. Для проверки значимости использовали непарный t -критерий (двусторонний) или односторонний ANOVA (односторонний) с критерием множественных сравнений Бонферрони. P -значения <0.05 считались статистически значимыми (GraphPad Prism V9.0.1). Все измерения были взяты из отдельных образцов. Минимальный размер выборки для всех исследований на мышах был определен с помощью анализа мощности с использованием программы PS Power and Sample Size Calculations V3.1.6 Университета Вандербильта (http://biostat.mc.vanderbilt.edu/PowerSampleSize) со следующими допущениями: планирование исследования непрерывной переменной ответа от независимых контрольных и экспериментальных субъектов с 1 контролем на экспериментального субъекта. В предыдущем исследовании ответ в каждой группе субъектов был нормально распределен со стандартным отклонением 0,1. Если истинная разница экспериментальных и контрольных средних составляет 0,2, нам потребуется изучить 5 экспериментальных и 5 контрольных субъектов, чтобы иметь возможность отвергнуть нулевую гипотезу о том, что средние значения популяции экспериментальной и контрольной групп равны с вероятностью (мощностью). 0,8. Вероятность ошибки первого рода, связанная с этой проверкой этой нулевой гипотезы, составляет 0,05.

    Разрешение на исследование

    Соблюдались все применимые международные, национальные и/или ведомственные рекомендации по уходу и использованию животных.Все процедуры, выполненные в исследованиях с участием животных, соответствовали этическим стандартам учреждения, в котором проводились исследования, и были одобрены ответственным государственным управлением по уходу за животными и их использованию, Landesamt für Natur, Umwelt und Verbraucherschutz, LANUV (84-02. 04.2012). .А146 и 81-02.04.2019.А062).

    Содержание и содержание мышей

    Все мыши содержатся в условиях отсутствия специфических патогенов (SPF) в индивидуально вентилируемых клетках в виварии Университетской клиники Бонна.Наша программа эпиднадзора соответствует рекомендациям Федерации европейских лабораторных ассоциаций животных (FELASA). Максимум 5 мышей содержали в клетках типа 2 L с 12/12-часовым циклом свет/темнота, и мыши имели свободный доступ к пище и воде. В вольерах для лабораторных грызунов предусмотрены нормированная температура воздуха 22 °С, влажность 50–70% и до 15-кратный воздухообмен. Подстилочный материал добавляется во все клетки для спаривания, а небольшие домики и игрушки регулярно добавляются, чтобы обогатить среду обитания мышей.Доступ к помещениям разрешен только квалифицированному персоналу, прошедшему соответствующую подготовку по обращению с животными и проведению экспериментов. В учреждении назначен сертифицированный ветеринарный врач, который регулярно следит за санитарным состоянием помещений и состоянием здоровья всех содержащихся животных.

    Сводка отчета

    Дополнительную информацию о дизайне исследования можно найти в Сводке отчета об исследовании природы, связанной с этой статьей.

    JHUAPL — , Хайе, Корт

    С.М. Эрнст, С. Кубота, Н. Шабо, Р. Клима, Г. Роджерс, П. Бирн, С.А. Хаук, К.Е. Вандер Кааден, Р.Дж. Вервак, С. Бесс, Д. Блюетт, Б. Деневи, С. Гуссенс, С. Индик, Н. Изенберг, К. Джонсон, Л. Йозвяк, Х. Корт, Р. МакНатт, С. Мурчи, П. Пепловски, Дж. Рейнс, Э. Рэмп, М. Томпсон, (2021), Посадочный модуль «Меркурий»: концептуальное исследование планетарной миссии для десятилетнего обзора 2023–2032 гг., arXiv

    Г.К. Стивенс, С.Т. Бингэм, М.И. Ситнов, М. Гкиулиду, В.Г. Меркин, Х. Корт, Н.А. Цыганенко, А.Ю. Ухорский, (2020), Давление плазмы во время шторма, полученное на основе измерений нескольких миссий, и его проверка с использованием данных о частицах с зондов Ван Аллена, Космическая погода, 18, 12

    М. И. Ситнов, Г.К. Стивенс, Н.А. Цыганенко, Х. Корт, Э.К. Рулоф, П.К. Брандт, В.Г. Меркин, А.Ю. Ухорский, (2020), Реконструкция экстремальных геомагнитных бурь: преодоление проклятия нехватки данных, Космическая погода, 18, 10

    Х. Сангха, С.Э. Милан, Дж.А. Картер, А.Р. Фогг, Б. Дж. Андерсон, Х. Корт, Л. Дж. Пакстон, (2020), Продольные токи в раздвоенной области 2, связанные с суббурями, Журнал геофизических исследований: космическая физика, 125, 1

    Р.М. Робинсон, С.Р. Капплер, Л. Занетти, Б. Андерсон, С.К. Вайнс, Х. Корт, А. Фицморис, (2020), Статистические взаимосвязи между авроральной электрической проводимостью и продольными токами в высоких широтах, Журнал геофизических исследований: космическая физика, 125, 7

    В. Ангелопулос, П. Крус, А. Дроздов, Э. У. Граймс, Н. Хацигеоргиу, Д.А. Кинг, Д. Ларсон, Дж.В. Льюис, Дж.М. Мактирнан, Д.А. Робертс, К.Л. Рассел, Т. Хори, Ю. Касахара, А. Кумамото, А. Мацуока, Ю. Мияшита, Ю. Миёси, И. Шинохара, М. Терамото, Дж. Б. Фаден, А.Дж. Хэлфорд, М. Маккарти, Р.М. Миллан, Дж.Г. Образец, Д.М. Смит, Л.А. Вуджер, А. Массон, А.А. Нарок, К. Асамура, Т.Ф. Чанг, К.-Ю. Чанг, Ю. Казама, К. Кейка, С. Мацуда, Т. Сегава, К. Секи, М. Сёдзи, С.В.Ю. Там, Н. Умемура, Б.-Дж. Ван, С.-Ю. Ван, Р. Редмон, Дж. В. Родригес, Х. Дж. Сингер, Дж. Вандегрифф, С.Абэ, М. Нос, А. Шинбори, Ю.-М. Танака, С. Уэно, Л. Андерссон, П. Данн, К. Фаулер, Дж.С. Халекас, Т. Хара, Ю. Харада, К.О. Ли, Р. Лиллис, Д.Л. Митчелл, М.Р. Аргалл, К. Бромунд, Дж.Л. Берч, И.Дж. Коэн, М. Галлой, Б. Джайлз, А.Н. Джейнс, О. Ле Контель, М. Ока, Т.Д. Фан, Б.М. Уолш, Дж. Вестлейк, Ф.Д. Уайлдер, С.Д. Бэйл, Р. Ливи, М. Пулупа, П. Уиттлси, А. ДеВулф, Б. Хартер, Э. Лукас, У. Остер, Дж.В. Боннелл, К.М. Калли, Э. Донован, Р.Э. Эргун, Х. У. Фрей, Б.Джекел, А. Кейлинг, Х. Корт, Дж. П. Макфадден, Ю. Нисимура, Ф. Плашке, П. Роберт, Д.Л. Тернер, Дж.М. Вейганд, Р.М. Кэнди, Р.К. Джонсон, Т. Ковалик, М.Х. Лю, Р.Э. Макгуайр, А. Бренеман, К. Керстен, П. Шредер, (2019), Система анализа данных космической физики (SPEDAS), Space Science Reviews, 215, 1

    Г.К. Стивенс, М.И. Ситнов, Х. Корт, Н.А.Цыганенко, С. Отани, М. Гкиулиду, А.Ю. Ухорский, (2019), Глобальная эмпирическая картина магнитосферных суббурь, полученная по данным многоразового магнитометра, Журнал геофизических исследований: космическая физика, 124, 2, 1085-1110

    Б.Дж. Андерсон, К.Л. Джонсон, Х. Корт, Л.К. Филпотт, (2018), Токи Биркеланда на ртути: обзор и сравнение с землей, Electric Currents in Geospace and Beyond, 279-302

    М. И. Ситнов, Г.К. Стивенс, М. Гкиулиду, В. Меркин, А.Ю. Ухорский, Х. Корт, П.К. Брандт, Н.А. Цыганенко, (2018), Эмпирическое моделирование экстремальных явлений: распределение геомагнитного поля, электрического тока и давления во время бури, Экстремальные явления в геопространстве: происхождение, предсказуемость и последствия, 259-279

    Н. Бузулукова, Дж. Гольдштейн, М.К. Фок, А. Глосер, П. Валек, Д.МакКомас, Х. Корт, Б. Андерсон (2018 г.), Динамика магнитосферы во время шторма 14 ноября 2012 г. по данным TWINS, AMPERE, Van Allen Probes и BATS-R-US-CRCM, Annales Geophysicae, 36, 1, 107- 124

    Р.М. Робинсон, Ю. Чжан, Б. Дж. Андерсон, Л. Дж. Занетти, Х. Корт, А. Фицморис, (2018), Статистические взаимосвязи между продольными токами и потоком энергии высыпающихся электронов, Письма о геофизических исследованиях, 45, 17, 8738-8745

    Р. Никукар, Д.Дж. Лоуренс, П.Н. Пепловский, Р.М. Дьюи, Х. Корт, Д. Н. Бейкер, Р. Л. МакНатт, (2018), Статистическое исследование событий, связанных с энергетическими электронами Меркурия, по наблюдениям с помощью прибора гамма-излучения и нейтронного спектрометра на борту MESSENGER, Журнал геофизических исследований: космическая физика, 123, 6, 4961 -4978

    С.Э. Милан, Дж.А. Картер, Х. Сангха, К.М. Лаундал, Н. Остгаард, П.Тенфьорд, Дж. П. Рейстад, К. Снеквик, Дж. К. Коксон, Х. Корт, Б. Дж. Андерсон, (2018), Временные шкалы реакции дневного и ночного направленных по полю течений на изменения связи солнечного ветра и магнитосферы, Журнал геофизических исследований: космическая физика, 123, 9, 7307-7319

    Б.Дж. Андерсон, К.Н. Олсон, Х. Корт, Р.Дж. Барнс, К.Л. Уотерс, С.К. Виноград, (2018), Временное и пространственное развитие глобальных течений Биркеланда, Журнал геофизических исследований: космическая физика, 123, 6, 4785-4808

    М. И. Ситнов, Г.К. Стивенс, Н.А. Цыганенко, А.Ю. Ухорский, С. Винг, Х. Корт, Б. Дж. Андерсон, (2017), Пространственная структура и асимметрии магнитосферных токов, полученные на основе эмпирических моделей геомагнитного поля с высоким разрешением, Асимметрии рассвета и заката в планетарной плазменной среде, 199–212

    Дж. К. Коксон, С.Э. Милан, Дж.А. Картер, Л.Б.Н. Клаузен, Б. Дж. Андерсон, Х. Корт, (2017), Сезонные и суточные вариации в наблюдениях AMPERE течений Биркеланда по сравнению с результатами моделирования, arXiv

    ЧАС.Корт, К.Л. Джонсон, Л. Филпотт, Н. А. Цыганенко, Б. Дж. Андерсон, (2017), Динамическая модель магнитосферного магнитного поля Меркурия, Письма о геофизических исследованиях, 44, 20, 10,147-10,154

    С. Э. Милан, L.B.N. Клаузен, Дж.К. Коксон, Дж.А. Картер, М.-Т. Валах, К. Лаундал, Н. Остгаард, П. Тенфьорд, Дж. Рейстад, К. Снеквик, Х. Корт, Б. Дж. Андерсон, (2017), Обзор взаимодействия солнечного ветра, магнитосферы, ионосферы, атмосферы и генерации магнитосферных токов , Обзоры космической науки, 206, 1–4, 547–573.

    Дж.Ву, М.С. Брайант, К.Г. Ридли, Ю. Шен, Л. Ян, Л.Б.Н. Клаузен, К.А. Маквильямс, К.Р. Мерфи, И.Р. Манн, Л.Г. Озеке, Х. Корт, Б.Дж. Андерсон, К.Л. Уотерс, (2017), Сравнение мелкомасштабных магнитных флуктуаций в системах продольных токов в регионах 1 и 2, Журнал геофизических исследований: космическая физика, 122, 3, 3277-3290

    Б. Дж. Андерсон, Х. Корт, Д.Т. Веллинг, В.Г. Меркин, М.Дж. Уилтбергер, Дж. Редер, Р.Дж. Барнс, К.Л. Уотерс, А.А. Пулккинен, Л. Растэттер, (2017), Сравнение прогностических оценок высокоширотной электродинамики с наблюдениями глобальных течений Биркеланда, Космическая погода, 15, 2, 352-373

    Р. М. Уинслоу, Л. Филпотт, К.С. Пати, Н. Лугас, Н.А. Швадрон, К.Л. Джонсон, Х. Корт, (2017), Статистическое исследование воздействия ICME на границы магнитосферы Меркурия и область северного каспа из MESSENGER, Журнал геофизических исследований: космическая физика, 122, 5, 4960-4975

    Дж.В. МакАдамс, К.Г. Брайан, С.С. Бушман, А.Б. Кэллоуэй, Э. Карранса, С.Х. Фланиган, М.Н. Кирк, Х. Корт, Д.П. Месснер, Д.Дж. О-Шонесси, К.Е. Уильямс, (2016), Грандиозный финал Engineering MESSENGER на Меркурии — Кампания висения на малой высоте, Достижения в области астронавтических наук, 156, 3251-3270

    Г. Пох, Дж.А. Славин, X. Цзя, Г.А. ДиБраччо, Дж. М. Рейнс, С.М.Имбер, Д.Дж. Гершман, В.-Дж. Сан, Б.Дж. Андерсон, Х. Корт, Т.Х. Зурбухен, Р. Л. МакНатт, С. К. Соломон, (2016), Наблюдения MESSENGER за касповыми плазменными нитями на Меркурии, Журнал геофизических исследований: космическая физика, 121, 9, 8260-8285

    Х. Люр, Т. Хуанг, С. Винг, Г. Кервалишвили, Дж. Рауберг, Х. Корт, (2016), Филаментарные продольные токи в области полярной шапки во время северного межпланетного магнитного поля, полученные с помощью созвездия Роя, Анналы Геофизика, 34, 10, 901-915.

    М.К. Джеймс, Э.Дж. Банс, Т.К. Йоман, С.М. Имбер, Х. Корт, (2016), Статистический обзор мощности и поляризации ультранизкочастотных волн в гермейской магнитосфере, Журнал геофизических исследований: космическая физика, 121, 9, 8755-8772

    Б.Дж. Андерсон, К.Т. Рассел, Р.Дж. Strangeway, F. Plaschke, W. Magnes, D. Fischer, H. Korth, V.G. Меркин, Р.Дж. Барнс, К.Л. Уотерс, И.Дж. Коэн, Дж.Х. Вестлейк, Б.Х. Маук, Х.К. Лайнвебер, Д.Дж. Гершман, Б.Л. Джайлз, Г. Ле, Р. Б. Торберт, Дж. Л. Берч, (2016), Электродинамический контекст динамики магнитопаузы, наблюдаемой многомасштабным магнитосферным исследованием, Письма о геофизических исследованиях, 43, 12, 5988-5996

    К. Л. Джонсон, Л.К. Филпотт, Б.Дж. Андерсон, Х. Корт, С.А. Хаук, Д. Хейнер, Р.Дж. Филлипс, Р.М. Уинслоу, С.К. Соломон, (2016), Наблюдения MESSENGER за индуцированными магнитными полями в ядре Меркурия, Geophysical Research Letters, 43, 6, 2436-2444

    Х. Мацуи, П. Дж. Эриксон, Дж. К. Фостер, Р. Б. Торберт, М. Р. Аргалл, Б. Дж. Андерсон, Дж. Б. Блейк, И. Дж. Коэн, Р.Э. Эргун, С.Дж. Фарруджа, Ю.В. Хотяинцев, Х. Корт, П.-А. Линдквист, В. Магнес, Г.Т. Марклунд, Б.Х. Маук, К.В. Полсон, К.Т. Рассел, Р.Дж. Стрэнджвей, Д.Л. Тернер, (2016), Диполяризация во внутренней магнитосфере во время геомагнитной бури 7 октября 2015 г., Письма о геофизических исследованиях, 43, 18, 9397-9405

    Д. Н. Бейкер, Р. М. Дьюи, Д.Дж. Лоуренс, Дж.О. Голдстен, П.Н. Пепловский, Х. Корт, Дж.А. Славин, С. М. Кримигис, Б.Дж. Андерсон, Г.К. Хо, Р. Л. МакНатт, Дж. М. Рейнс, Д. Шривер, С.К. Соломон, (2016), Интенсивное усиление потока энергичных электронов в магнитосфере Меркурия: интегрированный вид с наблюдениями с высоким разрешением от MESSENGER, Журнал геофизических исследований A: Space Physics, 121, 3, 2171-2184

    С.Т. Линдси, М.К. Джеймс, Э.Дж. Банс, С.М. Имбер, Х. Корт, А. Мартиндейл, Т.К. Йоман, (2016), Рентгеновские наблюдения MESSENGER за взаимодействием магнитосферы с поверхностью на ночной стороне Меркурия, Planetary and Space Science, 125, 72-79

    ЧАС.Корт, К. Стробен, Ф. Техада, А.Г. Андреу, Дж. Китчинг, С. Кнаппе, С.Дж. Лехтонен, С.М. Лондон, М. Кафель, (2016), Миниатюрный атомно-скалярный магнитометр для космоса на основе изотопа рубидия 87 Rb, Журнал геофизических исследований: космическая физика, 121, 8, 7870-7880

    Дж. К. Коксон, С.Э. Милан, Дж.А. Картер, Л.Б.Н. Клаузен, Б. Дж. Андерсон, Х. Корт, (2016), Сезонные и суточные вариации в наблюдениях AMPERE за течениями Биркеланда по сравнению с результатами моделирования, Журнал геофизических исследований A: Space Physics, 121, 5, 4027-4040

    Г.К. Хо, Р.Д. Старр, С.М. Кримигис, Дж.Д. Вандегрифф, Д.Н. Бейкер, Р.Е. Голд, Б. Дж. Андерсон, Х. Корт, Д. Шривер, Р. Л. МакНатт, С. К. Соломон, (2016), Наблюдения MESSENGER надтепловых электронов в магнитосфере Меркурия, Geophysical Research Letters, 43, 2, 550-555

    В.-Дж. Сан, Дж.А. Славин, С. Фу, Дж. М. Рейнс, К.-Г. Зонг, С.М. Имбер, К. Ши, З. Яо, Г. Пох, Д.Дж. Гершман, З. Пу, Т. Сандберг, Б. Дж. Андерсон, Х. Корт, Д. Н. Бейкер, (2015), Наблюдения MESSENGER за магнитосферной суббуревой активностью вблизи хвоста магнитосферы Меркурия, Письма о геофизических исследованиях, 42, 10, 3692-3699

    Д. Дж. Лоуренс, Б.Дж. Андерсон, Д.Н. Бейкер, У.К. Фельдман, Г.К. Хо, Х. Корт, Р.Л. МакНатт, П.Н. Пепловски, С. С. Соломон, Р. Д. Старр, Дж. Д. Вандегрифф, Р.М. Уинслоу, (2015), Всесторонний обзор событий с энергичными электронами в магнитосфере Меркурия с использованием данных гамма- и нейтронного спектрометра MESSENGER, Журнал геофизических исследований: космическая физика, 120, 4, 2851-2876

    К.Л. Джонсон, Р.Дж. Филлипс, М.Е. Пурукер, Б.Дж. Андерсон, П.К. Бирн, Б.В. Деневи, Дж.М. Файнберг, С.А. Хаук, Дж.В. Хед, Х. Корт, П.Б.Джеймс, Э. Мазарико, Г.А. Нейманн, Л.К. Филпотт, М.А. Зиглер, Н.А. Цыганенко, С.К. Соломон, (2015), Измерения магнитного поля на малых высотах с помощью MESSENGER выявили поле древней коры Меркурия, Science, 348, 6237, 892-895.

    Р.М. Дьюи, Д. Н. Бейкер, Б. Дж. Андерсон, М. Бенна, К.Л. Джонсон, Х. Корт, Д.Дж. Гершман, Г.К. Хо, В.Е. МакКлинток, Д. Одстрсил, Л.К. Филпотт, Дж.М. Рейнс, Д. Шривер, Дж.А. Славин, С.С. Соломон, Р.М. Уинслоу, Т.Х. Зурбухен, (2015), Улучшение моделирования солнечного ветра на Меркурии: включение нестационарных солнечных явлений в модель WSA-ENLIL с расширением конуса, Журнал геофизических исследований A: Space Physics, 120, 7, 5667-5685

    Г.А. ДиБраччо, Дж.А. Славин, С.М. Имбер, Д.Дж. Гершман, Дж. М. Рейнс, К.М. Джекман, С.А. Бордсен, Б.Дж. Андерсон, Х. Корт, Т.Х. Зурбухен, Р. Л. МакНатт, С. К. Соломон, (2015), Наблюдения MESSENGER за жгутами в хвосте магнитосферы Меркурия, Planetary and Space Science, 115, 77-89

    Г.А. ДиБраччо, Дж.А. Славин, Дж. М. Рейнс, Д.Дж. Гершман, П.Дж. Трейси, С.А. Бордсен, Т. Х. Зурбухен, Б. Дж. Андерсон, Х. Корт, Р. Л. МакНатт, С. К. Соломон, (2015), Первые наблюдения плазменной мантии Меркурия с помощью MESSENGER, Geophysical Research Letters, 42, 22, 9666-9675

    С.А. Бордсен, Э.-Х. Ким, Дж. М. Рейнс, Дж. А. Славин, Д.Дж. Гершман, Б. Дж. Андерсон, Х. Корт, Т. Сандберг, Д. Шривер, П. Травничек, (2015), Интерпретация магнитных волн сжатия частотой ~ 1 Гц во внутренней магнитосфере Меркурия с точки зрения распространяющихся ионно-бернштейновских волн, Журнал геофизических исследований: космос Физика, 120, 6, 4213-4228

    С.Э. Милан, Дж.А. Картер, Х. Корт, Б.Дж. Андерсон, (2015), Анализ основных компонентов токов Биркеланда, определенный с помощью эксперимента активной магнитосферы и планетарной электродинамики, Журнал геофизических исследований: космическая физика, 120, 12, 10415-10424

    Д. Дж. Гершман, Дж.М. Рейнс, Дж.А. Славин, Т.Г. Зурбухен, Б.Дж. Андерсон, Х. Корт, Г.К. Хо, С.А. Бордсен, Т.А. Кэссиди, Б.М. Уолш, С.К. Соломон, (2015), Наблюдения MESSENGER за солнечными энергичными электронами в магнитосфере Меркурия, Журнал геофизических исследований A: Space Physics, 120, 10, 8559-8571

    С.А. Бордсен, Л.К. Цзянь, Дж. Л. Рейнс, Д.Дж. Гершман, Т.Х. Зурбухен, Д.А. Робертс, Х. Корт, (2015), Обзор MESSENGER низкочастотных волновых бурь на месте между 0,3 и 0,7 а.е., Журнал геофизических исследований: космическая физика, 120, 12, 10207-10220

    ЧАС.Корт, Н.А. Цыганенко, К.Л. Джонсон, Л.К. Филпотт, Б.Дж. Андерсон, М.М. Аль Асад, С. К. Соломон, Р. Л. МакНатт, (2015), Модульная модель магнитосферного магнитного поля Меркурия в пределах средней наблюдаемой магнитопаузы, Журнал геофизических исследований: космическая физика, 120, 6, 4503-4518

    Д. Дж. Гершман, Дж.М. Рейнс, Дж.А. Славин, Т.Г. Зурбухен, Т. Сандберг, С.А. Бордсен, Б. Дж. Андерсон, Х. Корт, С. К. Соломон, (2015), Наблюдения MESSENGER за многомасштабными вихрями Кельвина-Гельмгольца на Меркурии, Журнал геофизических исследований A: Space Physics, 120, 6, 4354-4368

    Т. Мотоба, С. Отани, Б. Дж. Андерсон, Х. Корт, Д. Митчелл, Л. Дж. Ланзеротти, К. Шиокава, М. Коннорс, К.А. Клецинг, Г. Д. Ривз, (2015), О формировании и происхождении дуг полярных сияний фазы роста / начала суббури, полученных на основе сопряженных космических и наземных наблюдений, Журнал геофизических исследований A: Space Physics, 120, 10, 8707-8722

    В.М. Урицкий, Ю.А. Славин, С.А. Бордсен, Т. Сандберг, Дж. М. Рейнс, Д.Дж. Гершман, Г. Коллинсон, Д. Сибек, Г.В. Хазанов, Б. Дж. Андерсон, Х. Корт, (2014), Активные токовые слои и возможные аномалии горячего потока вверх по течению от головной ударной волны Меркурия, Журнал геофизических исследований A: Space Physics, 119, 2, 853-876

    Дж. К. Коксон, С.Э. Милан, L.B.N. Клаузен, Б.Дж. Андерсон, Х.Корт, (2014), Наложенный эпохальный анализ течений Биркеланда в областях 1 и 2, наблюдаемых AMPERE во время суббурь, Журнал геофизических исследований: космическая физика, 119, 12, 9834-9846.

    Д.Дж. Книпп, Т. Мацуо, Л. Килкоммонс, А. Ричмонд, Б. Андерсон, Х. Корт, Р. Редмон, Б. Меро, Н. Пэрриш, (2014 г.), Сравнение данных о магнитных возмущениях со спутников созвездий LEO: статистика DMSP и AMPERE, Космическая погода, 12, 1, 2-23

    Л. К. Филпотт, К.Л. Джонсон, Р.М. Уинслоу, Б. Дж. Андерсон, Х. Корт, М. Э. Пурукер, С. К. Соломон, (2014), Ограничения вековых вариаций магнитного поля Меркурия на основе комбинированного анализа данных MESSENGER и Mariner 10, Geophysical Research Letters, 41, 19, 6627-6634

    Х. Корт, Б.Дж. Андерсон, Д.Дж. Гершман, Дж.М. Рейнс, Дж.А. Славин, Т.Г. Зурбухен, С.К.Соломон, Р.Л. МакНатт-младший, (2014), Распределение плазмы в магнитосфере Меркурия, полученное на основе наблюдений магнитометра MESSENGER и плазменного спектрометра быстрого формирования изображений, Журнал геофизических исследований: космическая физика, 119, 4, 2917-2932

    Г. Лу, М. Е. Хаган, К. Хойслер, Э. Дорнбос, С. Бруинсма, Б. Дж. Андерсон, Х. Корт, (2014 г.), Глобальная реакция ионосферы и термосферы на геомагнитную бурю 5 апреля 2010 г. : исследование интегрированной модели данных, Журнал геофизических исследований: космическая физика, 119, 12, 10 358–10 375.

    Д.Дж. Гершман, Дж.А. Славин, Дж. М. Рейнс, Т.Х. Зурбухен, Б. Дж. Андерсон, Х. Корт, Д. Н. Бейкер, С. К. Соломон, (2014), Кинетические свойства ионов в предполуночном плазменном слое Меркурия, Письма о геофизических исследованиях, 41, 16, 5740-5747

    Б.Дж. Андерсон, К.Л. Джонсон, Х. Корт, Дж.А. Славин, Р.М. Уинслоу, Р.Дж. Филлипс, Р. Л. МакНатт, С. К. Соломон, (2014), Стационарные продольные токи на Меркурии, Письма о геофизических исследованиях, 41, 21, 7444-7452

    Дж.А. Славин, Г.А. Дибраччо, Д.Дж. Гершман, С.М. Имбер, Г.К. Пох, Дж. М. Рейнс, Т.Х. Zurbuchen, X. Jia, D.N. Baker, K.-H. Глассмайер, С.А. Ливи, С.А. Бордсен, Т.А. Кэссиди, М. Сарантос, Т. Сандберг, А. Мастерс, К.Л. Джонсон, Р.М. Уинслоу, Б. Дж. Андерсон, Х. Корт, Р. Л. МакНатт, С. К. Соломон, (2014), Наблюдения MESSENGER за дневной магнитосферой Меркурия в экстремальных условиях солнечного ветра, Журнал геофизических исследований: космическая физика, 119, 10, 8087-8116

    М.Коннорс, Р.Л. Макферрон, Б.Дж. Андерсон, Х. Корт, К.Т. Рассел, X. Чу, (2014), Электрические токи клина суббури 24 февраля 2010 г., Письма о геофизических исследованиях, 41, 13, 4449-4455

    Б.Дж. Андерсон, Х. Корт, К.Л. Уотерс, Д.Л. Грин, В.Г. Меркин, Р.Дж. Барнс, Л. П. Дайруд, (2014), Развитие крупномасштабных токов Биркеланда, определенных в эксперименте активной магнитосферы и планетарной электродинамики, Письма о геофизических исследованиях, 41, 9, 3017-3025

    Р. М. Уинслоу, К.Л. Джонсон, Б.Дж. Андерсон, Д.Дж. Гершман, Дж. М. Рейнс, Р.Дж. Лиллис, Х. Корт, Дж.А. Славин, С.С. Соломон, Т.Х. Зурбухен, М.Т. Зубер, (2014), Магнитное поле поверхности Меркурия, определенное с помощью протонной магнитометрии, Geophysical Research Letters, 41, 13, 4463-4470

    С.М. Имбер, Дж.А. Славин, С.А. Бордсен, Б.Дж. Андерсон, Х. Корт, Р.Л. МакНатт мл., SC Solomon, (2014), Наблюдения MESSENGER за крупными событиями переноса потока на дневной стороне: управляют ли они суббуревым циклом Меркурия? , Журнал геофизических исследований: космическая физика, 119, 7, 5613-5623

    В.А. Сергеев, А.В. Николаев, М.В. Кубышкина, Н.А. Цыганенко, Х.Дж. Сингер, Х.В. Родригес, В. Ангелопулос, Р. Накамура, С.Э. Милан, Дж. К. Коксон, Б. Дж. Андерсон, Х. Корт, (2014), Исследование событий, сочетающее магнитосферные и ионосферные перспективы моделирования клина суббури, Журнал геофизических исследований: космическая физика, 119, 12, 9714-9728

    Дж. К. Коксон, С.Э. Милан, L.B.N. Клаузен, Б. Дж. Андерсон, Х. Корт, (2014), Величины токов Биркеланда в областях 1 и 2, наблюдаемые AMPERE, и их роль в соединении солнечного ветра, магнитосферы и ионосферы, Журнал геофизических исследований: космическая физика, 119, 12, 9804-9815

    С.Р. Кеплер, К.А. Клецинг, С.Р. Баундс, Дж.В. Гьерлоев, Б.Дж. Андерсон, Х. Корт, Дж.В.Лабель, член парламента Домбровский, М. Лессар, Р.Ф. Пфафф, Д.Э. Роуленд, С. Джонс, К. Хайнзельман, (2013), Закрытие тока в авроральной ионосфере: результаты миссии ракеты по авроральному току и электродинамической структуре, авроральная феноменология и магнитосферные процессы: Земля и другие планеты, 183–192

    Б.Дж. Андерсон, К.Л. Джонсон, Х. Корт, (2013), Индекс магнитных возмущений для магнитного поля Меркурия, полученный по данным магнитометра MESSENGER, Геохимия, Геофизика, Геосистемы, 14, 9, 3875-3886

    Я. Дж. Коэн, М.Р. Лессард, С.Р. Кеплер, С.Р. Баундс, К.А. Клецинг, А.В. Стрельцов, Ю.В. Лабель, М.П. Домбровский, С.Л. Джонс, Р.Ф. Пфафф, Д.Э. Роуленд, Б.Дж. Андерсон, Х. Корт, Дж.В. Гьерлоев, (2013), Авроральный ток и электродинамическая структура (ACES) наблюдения ионосферной обратной связи в резонаторе Альфвена и модельных откликов, Журнал геофизических исследований: космическая физика, 118, 6, 3288-3296

    Г.К. Стивенс, М.И. Ситнов, Дж. Киссинджер, Н. А. Цыганенко, Р. Л. Макферрон, Х. Корт, Б. Дж. Андерсон, (2013), Эмпирическая реконструкция явлений устойчивой магнитосферной конвекции во время шторма, Журнал геофизических исследований: космическая физика, 118, 10, 6434-6456

    Т. Сандберг, С.А. Бордсен, Дж.А. Славин, В.М. Урицкий, Б.Дж. Андерсон, Х. Корт, Д.Дж. Гершман, Дж. М. Рейнс, Т.Х. Зурбухен, С. К. Соломон, (2013), Циклическое преобразование квазипараллельной головной ударной волны на Меркурии: наблюдения MESSENGER, Журнал геофизических исследований: космическая физика, 118, 10, 6457-6464

    Дж. М. Рейнс, Д.Дж. Гершман, Т.Х. Зурбухен, М. Сарантос, Дж.А. Славин, Ю.А. Гилберт, Х. Корт, Б.Дж. Андерсон, Г. Глеклер, С.М. Кримигис, Д.Н. Бейкер, Р.Л. МакНатт-младший, С.К. Соломон, (2013), Распределение и вариации состава ионов плазмы в космической среде Меркурия: первые три года наблюдений MESSENGER за Меркурий, Журнал геофизических исследований: космическая физика, 118, 4, 1604-1619 гг.

    Ф.Д. Уайлдер, С. Эрикссон, Х. Корт, Дж.Б.Х. Бейкер, М. Р. Хейрстон, К. Хайнзельман, Б. Дж. Андерсон, (2013), Реконфигурация продольного тока и реакция магнитосферы на импульс в компоненте BY межпланетного магнитного поля, Письма о геофизических исследованиях, 40, 11, 2489-2494

    А. Мастерс, Дж.А. Славин, Г.А. Дибраччо, Т. Сандберг, Р.М. Уинслоу, К.Л. Джонсон, Б.Дж. Андерсон, Х. Корт, (2013), Сравнение магнитных выбросов при ударных волнах Меркурия и Сатурна, Журнал геофизических исследований: космическая физика, 118, 7, 4381-4390

    Т. Сотирелис, Х. Корт, С.-Ю. Се, Ю. Чжан, Д. Моррисон, Л. Пакстон, (2013), Эмпирическая взаимосвязь между электронными высыпаниями и авроральным излучением в далеком ультрафиолете по данным наблюдений DMSP, Журнал геофизических исследований: космическая физика, 118, 3, 1203-1209.

    П.К. Брандт, Дж. Гольдштейн, Б.Дж. Андерсон, Х. Корт, Т.Дж. Иммель, Э.К. Рулоф, Р. Демаджистр, Д.Г. Митчелл, Б. Сандел, (2013), О взаимосвязи между электрическими полями во внутренней магнитосфере, кольцевым током, авроральной проводимостью и движением плазмопаузы, Взаимодействия во внутренней магнитосфере: новые перспективы визуализации, 159, 159-166

    В. Г. Меркин, Б.Дж. Андерсон, Дж.Г. Лион, Х.Корт, М. Уилтбергер, Т. Мотоба, (2013), Глобальная эволюция течений Биркеланда в 10-минутном масштабе времени: МГД-моделирование и наблюдения, Журнал геофизических исследований: космическая физика, 118, 8, 4977-4997

    Г. Ле, П. Дж. Чи, X. Бланко-Кано, С. Бордсен, Дж. А. Славин, Б. Дж. Андерсон, Х. Корт, (2013), Ультранизкочастотные волны вверх по течению в области форшока Меркурия: наблюдения магнитного поля MESSENGER, Журнал геофизических исследований: космическая физика, 118, 6, 2809-2823

    Т.Сотирелис, Х. Корт, С.-Ю. Се, Ю. Чжан, Д. Моррисон, Л. Пакстон, (2013), Ответ на комментарий к «эмпирической взаимосвязи между высыпаниями электронов и авроральным излучением в далеком ультрафиолете по данным наблюдений DMSP», Журнал геофизических исследований: космическая физика, 118, 10 , 6827-6828

    Д. Ларио, Г.К. Хо, Э. К. Рулоф, Б. Дж. Андерсон, Х. Корт, (2013), Интенсивные солнечные почти релятивистские электронные события в 0.3 AU, Журнал геофизических исследований: космическая физика, 118, 1, 63-73.

    Р.М. Уинслоу, Б.Дж. Андерсон, К.Л. Джонсон, Дж.А. Славин, Х. Корт, М. Е. Пурукер, Д. Н. Бейкер, С. К. Соломон, (2013), Магнитопауза Меркурия и головная ударная волна по наблюдениям магнитометра MESSENGER, Журнал геофизических исследований: космическая физика, 118, 5, 2213-2227

    Д.Н. Бейкер, Г. Пох, Д. Одстрчил, К.Н. Арге, М. Бенна, К.Л. Джонсон, Х. Корт, Д.Дж. Гершман, Г.К. Хо, В.Е. МакКлинток, Т.А. Кэссиди, А. Меркель, Дж. М. Рейнс, Д. Шривер, Дж.А. Славин, С.С. Соломон, П.М. Травничек, Р.М. Уинслоу, Т.Х. Зурбухен, (2013), Воздействие солнечного ветра на Меркурий: результаты модели WSA-ENLIL, Журнал геофизических исследований: космическая физика, 118, 1, 45-57

    Д. Дж. Гершман, Дж.А. Славин, Дж. М. Рейнс, Т.Х. Зурбухен, Б. Дж. Андерсон, Х. Корт, Д. Н. Бейкер, С. К. Соломон, (2013), Накопление магнитного потока и истощение плазмы в подсолнечном магнитослое Меркурия, Журнал геофизических исследований: космическая физика, 118, 11, 7181-7199

    Г.А. Дибраччо, Дж.А. Славин, С.А. Бордсен, Б.Дж. Андерсон, Х. Корт, Т.Х. Зурбухен, Дж. М. Рейнс, Д.Н. Бейкер, Р. Л. МакНатт-младший, С. К. Соломон, (2013), Наблюдения MESSENGER за структурой и динамикой магнитопаузы на Меркурии, Журнал геофизических исследований: космическая физика, 118, 3, 997-1008

    К.Р. Мерфи, И.Р. Манн, И.Дж. Рэй, К.Л. Уотерс, Х.У. Фрей, А. Кале, Х. Дж. Сингер, Б. Дж. Андерсон, Х. Корт, (2013), Детальная пространственная структура продольных течений, составляющих клин суббуревых течений, Журнал геофизических исследований: космическая физика, 118, 12, 7714-7727

    Т. Сандберг, Дж.А. Славин, С.А. Бордсен, Б.Дж. Андерсон, Х. Корт, Г.К. Хо, Д. Шривер, В.М. Урицкий, Т.Г. Зурбухен, Дж.М. Рейнс, Д.Н. Бейкер, С.М. Кримигис, Р. Л. МакНатт-младший, С. К. Соломон, (2012), Наблюдения за событиями диполяризации в хвосте магнитосферы Меркурия, Журнал геофизических исследований: космическая физика, 117, 9

    Х. Корт, Б.Дж. Андерсон, К.Л. Джонсон, Р.М. Уинслоу, Дж.А. Славин, М.Е. Пурукер, С.С. Соломон, Р.Л. МакНатт, (2012), Характеристики распределения плазмы в экваториальной магнитосфере Меркурия, полученные по наблюдениям магнитометра MESSENGER, Журнал геофизических исследований: космическая физика, 117, 12

    Дж.А. Славин, С.М. Имбер, С.А. Бордсен, Г.А. Ди Браччо, Т. Сандберг, М. Сарантос, Т. Ньевес-Шиншилла, А.Сабо, Б.Дж. Андерсон, Х. Корт, Т. Х. Зурбухен, Дж. М. Рейнс, К.Л. Джонсон, Р.М. Уинслоу, Р.М. Киллен, Р. Л. МакНатт-младший, С. К. Соломон, (2012), Наблюдения MESSENGER за потоком событий переноса потока на Меркурии, Журнал геофизических исследований: космическая физика, 117, 10

    Дж.А. Славин, Б.Дж. Андерсон, Д.Н. Бейкер, М. Бенна, С.А. Бордсен, Р.Е. Золото, Г.К. Хо, С.М. Имбер, Х.Корт, С.М. Кримигис, Р.Л. МакНатт мл., Дж.М. Рейнс, М. Сарантос, Д. Шривер, С.С. Соломон, П. Травничек, Т.Х. Zurbuchen, (2012), MESSENGER и Mariner 10, пролетные наблюдения за структурой и динамикой хвоста магнитосферы на Меркурии, Журнал геофизических исследований: космическая физика, 117, 1

    Б.Дж. Андерсон, К.Л. Джонсон, Х. Корт, Р.М. Уинслоу, Дж. Э. Боровский, М. Э. Пурукер, Дж.А. Славин, С.С. Соломон, М.Т. Зубер, Р.Л. МакНатт, (2012), Структура низкого порядка в планетарном магнитном поле Меркурия, Журнал геофизических исследований E: Planets, 117, 12

    К.Р. Мерфи, И.Р. Манн, И.Дж. Рэй, К.Л. Уотерс, Б.Дж. Андерсон, Д.К. Миллинг, Х. Дж. Сингер, Х. Корт, (2012), Уменьшение продольных токов, предшествующих началу авроральной суббури и локальное по отношению к нему, Письма о геофизических исследованиях, 39, 15

    Р.М. Уинслоу, К.Л. Джонсон, Б.Дж. Андерсон, Х. Корт, Дж.А. Славин, М.Е. Пурукер, С.К. Соломон, (2012), Наблюдения за областью северного куспида Меркурия с помощью магнитометра MESSENGER, Письма о геофизических исследованиях, 39, 8

    Т. Сандберг, С.А. Бордсен, Дж.А. Славин, Б. Дж. Андерсон, Х. Корт, Т.Х. Зурбухен, Дж. М. Рейнс, С. К. Соломон, (2012), Орбитальные наблюдения MESSENGER волн Кельвина-Гельмгольца большой амплитуды на магнитопаузе Меркурия, Журнал геофизических исследований: космическая физика, 117, 4

    С.Л. Джонсон, М.Э. Пурукер, Х. Корт, Б.Дж. Андерсон, Р.М. Уинслоу, М.М.Х. Аль Асад, Дж.А. Славин, И.И. Алексеев, Р.Дж. Филлипс, М.Т. Зубер, С. К. Соломон, (2012), Наблюдения MESSENGER за структурой магнитного поля Меркурия, Журнал геофизических исследований E: Planets, 117, 12

    С. Перри, В. Карбоне, А. Веккьо, Р. Бруно, Х. Корт, Т.Х. Зурбухен, Л. Соррисо-Вальво, (2012), Фазовая синхронизация, энергетический каскад и перемежаемость турбулентности солнечного ветра, Physical Review Letters, 109, 24

    С. Отани, Х. Корт, С. Винг, Э. Р. Талаат, Х.У. Фрей, Дж.В. Гьерлоев, (2012), Двойной овал полярных сияний в сумеречно-полуночном секторе: формирование, картографирование и динамика, Журнал геофизических исследований: Космическая физика, 117, 8

    Д.Дж. Гершман, Т.Х. Зурбухен, Л.А. Фиск, Дж.А. Гилберт, Дж. М. Рейнс, Б. Дж. Андерсон, К. В. Смит, Х. Корт, С. К. Соломон, (2012), Альфа-частицы солнечного ветра и тяжелые ионы во внутренней гелиосфере, наблюдаемые с помощью MESSENGER, Журнал геофизических исследований: космическая физика, 117, 9

    С.А. Бордсен, Дж.А. Славин, Б. Дж. Андерсон, Х. Корт, Д. Шривер, С. К. Соломон, (2012), Обзор когерентных волн частотой ?1 Гц во внутренней магнитосфере Меркурия по наблюдениям MESSENGER, Журнал геофизических исследований: космическая физика, 117, 9

    Г. К. Хо, С.М. Кримигис, Р.Э. Голд, Д. Н. Бейкер, Б. Дж. Андерсон, Х. Корт, Дж. А. Славин, Р.Л. МакНатт мл., Р.М. Уинслоу, С.С. Соломон, (2012), Пространственное распределение и спектральные характеристики энергичных электронов в магнитосфере Меркурия, Журнал геофизических исследований: космическая физика, 117, 9

    Т.Ньевес-Шиншилла, Р. Коланинно, А. Вурлидас, А. Сабо, Р. П. Леппинг, С. А. Бордсен, Б. Дж. Андерсон, Х. Корт, (2012), Удаленные и на месте наблюдения необычного направленного на Землю выброса корональной массы с разных точек зрения , Журнал геофизических исследований: космическая физика, 117, 6

    Д. Шривер, П. Травничек, М. Ашур-Абдалла, Р.Л. Ричард, П. Хеллингер, Дж.А.Славин, Б.Дж. Андерсон, Д.Н. Бейкер, М. Бенна, С.А. Бордсен, Р.Е. Золото, Г.К. Хо, Х. Корт, С. М. Кримигис, В.Е. МакКлинток, Дж.Л. Маклейн, Т.М. Орландо, М. Сарантос, А.Л. Спраг, Р.Д. Старр, (2011), Электронный перенос и осаждение на Меркурии во время пролета MESSENGER: последствия для электронно-стимулированной десорбции, Planetary and Space Science, 59, 15, 2026–2036 гг.

    Т.Х. Зурбухен, Дж. М. Рейнс, Дж.А. Славин, Д.Дж. Гершман, Дж.А. Гилберт, Г. Глеклер, Б.Дж. Андерсон, Д.Н. Бейкер, Х. Корт, С.М. Кримигис, М. Сарантос, Д. Шривер, Р. Л. МакНатт-младший, С. К. Соломон, (2011), Наблюдения MESSENGER за пространственным распределением планетарных ионов вблизи Меркурия, Science, 333, 6051, 1862-1865.

    В.М. Урицкий, Ю.А. Славин, Г.В. Хазанов, Е.Ф.Донован, С. А. Бордсен, Б. Дж. Андерсон, Х. Корт, (2011), Магнитная турбулентность кинетического масштаба и эффекты конечного ларморовского радиуса на Меркурии, Журнал геофизических исследований: космическая физика, 116, 9

    Х. Корт, Л. Растэттер, Б.Дж. Андерсон, А.Дж. Ридли, (2011), Сравнение наблюдаемой зависимости крупномасштабных течений Биркеланда от параметров солнечного ветра с зависимостью, полученной в результате глобального моделирования, Annales Geophysicae, 29, 10, 1809-1826.

    Дж.М. Рейнс, Дж.А. Славин, Т.Г. Зурбухен, Г. Глеклер, Б.Дж. Андерсон, Д.Н. Бейкер, Х. Корт, С.М. Кримигис, Р.Л. МакНатт-младший, (2011), Наблюдения MESSENGER за плазменной средой вблизи Меркурия, Planetary and Space Science, 59, 15, 2004–2015 гг.

    Х. Корт, Б.Дж. Андерсон, Дж.М. Рейнс, Дж.А. Славин, Т.Г. Зурбухен, К.Л. Джонсон, М.Е. Пурукер, Р.М. Уинслоу, С.С. Соломон, Р.Л. МакНатт, (2011), Давление плазмы в экваториальной магнитосфере Меркурия, полученное из наблюдений магнитометра MESSENGER, Письма о геофизических исследованиях, 38, 22

    Б. Дж. Андерсон, Дж.А. Славин, Х. Корт, С.А. Бордсен, Т.Х. Зурбухен, Дж. М. Рейнс, Г. Глоклер, Р. Л. МакНатт мл., С. К. Соломон, (2011), Дневной пограничный слой магнитосферы на Меркурии, Planetary and Space Science, 59, 15, 2037–2050

    Д.Н. Бейкер, Д. Одстрсил, Б.Дж. Андерсон, К.Н. Арге, М. Бенна, Г. Глеклер, Х. Корт, Л.Р. Майер, Дж.М. Рейнс, Д. Шривер, Дж.А. Славин, С.С. Соломон, П.М. Травничек, Т.Х. Зурбухен, (2011), Космическая среда Меркурия во время второго и третьего пролета MESSENGER, Planetary and Space Science, 59, 15, 2066–2074.

    Г.К. Хо, С.М. Кримигис, Р.Э. Голд, Д.Н. Бейкер, Дж.А. Славин, Б.Дж. Андерсон, Х. Корт, Р.Д. Старр, Д.Дж. Лоуренс, Р.Л. МакНатт-младший, С.К. Соломон, (2011), Наблюдения MESSENGER за кратковременными вспышками энергичных электронов в магнитосфере Меркурия, Science, 333, 6051, 1865-1868.

    Д. Шривер, П.М. Трвник, Б.Дж. Андерсон, М. Ашур-Абдалла, Д.Н. Бейкер, М. Бенна, С.А. Бордсен, Р.Е. Голд, П. Хеллингер, Г.К. Хо, Х. Корт, С.М. Кримигис, Р.Л. МакНатт мл., Дж.М. Рейнс, Р.Л. Ричард, Дж.А. Славин, С.С. Соломон, Р.Д. Старр, Т.Х. Зурбухен, (2011), Население квазизахваченных ионов и электронов на Меркурии, Письма о геофизических исследованиях, 38, 23.

    Т. Сандберг, С.А. Бордсен, Дж.А. Славин, Л.Г. Бломберг, Дж.А. Камнок, С. К. Соломон, Б. Дж. Андерсон, Х. Корт, (2011), Реконструкция распространения вихрей Кельвина-Гельмгольца на магнитопаузе Меркурия, Планетарные и космические науки, 59, 15, 2051-2057

    ЧАС.Корт, Б.Дж. Андерсон, Т.Х. Зурбухен, Дж. А. Славин, С. Перри, С. А. Бордсен, Д. Н. Бейкер, С. К. Соломон, Р. Л. МакНатт мл., (2011), Межпланетное магнитное поле на орбите Меркурия, Планетарные и космические науки, 59, 15, 2075-2085

    Б.Дж. Андерсон, К.Л. Джонсон, Х. Корт, М.Е. Пурукер, Р.М. Уинслоу, Дж.А. Славин, С.С. Соломон, Р.Л. МакНатт мл., Дж.М.Рейнс, Т.Х. Зурбухен, (2011), Глобальное магнитное поле ртути по данным орбитальных наблюдений MESSENGER, Science, 333, 6051, 1859-1862.

    Х. Корт, К. Стробен, Ф. Техада, А. Андреу, С. Маквей, Дж. Китчинг, С. Кнаппе, (2010), Абсолютный скалярный магнитометр в масштабе микросхемы для космических приложений, Технический дайджест APL Джона Хопкинса (Прикладная физика Лаборатория), 28, 3, 248-249

    М. И. Ситнов, Н.А. Цыганенко, А.Ю. Ухорский, Б.Дж. Андерсон, Х. Корт, А.Т.Ю. Луи, П.К. Брандт, (2010), Эмпирическое моделирование магнитной бури, вызванной CIR, Журнал геофизических исследований: космическая физика, 115, 7.

    С.А. Бордсен, Т. Сандберг, Дж.А. Славин, Б.Дж. Андерсон, Х. Корт, С.К. Соломон, Л.Г. Бломберг, (2010), Наблюдения волн Кельвина-Гельмгольца вдоль сумеречной границы магнитосферы Меркурия во время третьего пролета MESSENGER, Письма о геофизических исследованиях, 37, 12

    Д.Т. Блеветт, С.А. Хаук, Х. Корт (2010), Введение в специальный выпуск Icarus о «Меркурии после двух пролетов MESSENGER», Icarus, 209, 1, 1-2.

    Дж.А. Славин, Р.П. Леппинг, К. -К. Ву, Б.Дж. Андерсон, Д.Н. Бейкер, М. Бенна, С.А. Бордсен, Р.М. Киллен, Х. Корт, С.М. Кримигис, В.Е. МакКлинток, Р.Л. МакНатт мл., М. Сарантос, Д. Шривер, С.С. Соломон, П. Травничек, Т.Х. Зурбухен, (2010), Наблюдения MESSENGER за крупными переносами потока на ртути, Письма о геофизических исследованиях, 37, 2

    Д. Хайнер, Д. Шмитт, Дж. Вихт, К.-Х. Глассмайер, Х. Корт, У. Мотчманн, (2010), Начальная временная эволюция динамо с обратной связью для Меркурия, Геофизическая и астрофизическая гидродинамика, 104, 4, 419-429

    М.Бенна, Б.Дж. Андерсон, Д.Н. Бейкер, С.А. Бордсен, Г. Глеклер, Р.Е. Золото, Г.К. Хо, Р.М. Киллен, Х. Корт, С.М. Кримигис, М.Е. Пурукер, Р.Л. МакНатт, Дж.М. Рейнс, У.Е. МакКлинток, М. Сарантос, Дж.А. Славин, С.С. Соломон, Т.Х. Зурбухен, (2010), Моделирование магнитосферы Меркурия во время первого пролета MESSENGER, Icarus, 209, 1, 3-10

    С. Отани, Х.Корт, К. Кейка, Ю. Чжэн, П.К. Брандт, С.Б. Менде, (2010), Индуктивные электрические поля во внутренней магнитосфере в периоды геомагнитной активности, Журнал геофизических исследований: космическая физика, 115, 12

    Т. Сандберг, С.А. Бордсен, Дж.А. Славин, Л.Г. Бломберг, Х. Корт, (2010), Неустойчивость Кельвина-Гельмгольца на Меркурии: оценка, Planetary and Space Science, 58, 11, 1434-1441

    Я.И. Алексеев, Е.С. Беленькая, Ю.А. Славин, Х. Корт, Б.Дж. Андерсон, Д.Н. Бейкер, С.А. Бордсен, К.Л. Джонсон, М. Э. Пурукер, М. Сарантос, С. К. Соломон, (2010), магнитосферное магнитное поле Меркурия после первых двух пролетов MESSENGER, Icarus, 209, 1, 23–39.

    Дж.А. Славин, Б.Дж. Андерсон, Д.Н. Бейкер, М. Бенна, С.А. Бордсен, Г. Глеклер, Р.Е. Золото, Г.К. Хо, Х.Корт, С.М. Кримигис, Р.Л. МакНатт мл., Л.Р. Ниттлер, Дж. М. Рейнс, М. Сарантос, Д. Шривер, С. К. Соломон, Р. Д. Старр, П. М. Травничек, Т.Х. Zurbuchen, (2010), MESSENGER наблюдения за экстремальной нагрузкой и разгрузкой магнитного хвоста ртути, Science, 329, 5992, 665-668

    Х. Корт, Б.Дж. Андерсон, К.Л. Уотерс, (2010), Статистический анализ зависимости крупномасштабных течений Биркеланда от параметров солнечного ветра, Анналы геофизики, 28, 2, 515-530

    Б.Дж. Андерсон, М.Х. Акунья, Х. Корт, Дж.А. Славин, Х. Уно, К.Л. Джонсон, М.Э. Пурукер, С.К. Соломон, Дж.М. Рейнс, Т.Х. Zurbuchen, G. Gloeckler, RL McNutt Jr., (2010), Магнитное поле ртути, Space Science Reviews, 152, 1–4, 307–339.

    Д.Л. Грин, К.Л. Уотерс, Б. Дж. Андерсон, Х. Корт, (2009), Зависимость продольных токов от сезонного и межпланетного магнитного поля для северного и южного полушарий, Annales Geophysicae, 27, 4, 1701-1715

    Дж.А. Славин, М.Х. Акуна, Б.Дж. Андерсон, Д.Н. Бейкер, М. Бенна, С.А. Бордсен, Г. Глеклер, Р.Э. Золото, Г.К. Хо, Х. Корт, С.М. Кримигис, Р.Л. МакНатт мл., Дж.М. Рейнс, М. Сарантос, Д. Шривер, С.С. Соломон, П. Травничек, Т.Х. Зурбухен, (2009), Наблюдения MESSENGER за магнитным пересоединением в магнитосфере Меркурия, Science, 324, 5927, 606-610

    Х. Уно, К.Л.Джонсон, Б. Дж. Андерсон, Х. Корт, С. К. Соломон, (2009), Моделирование внутреннего магнитного поля Меркурия с плавными инверсиями, Earth and Planetary Science Letters, 285, 3-4, 328-339

    Дж.А. Славин, М.Г. Акунья, Б.Дж. Андерсон, С. Барабаш, М. Бенна, С.А. Бордсен, М. Фреенц, Г. Глеклер, Р.Э. Золото, Г.К. Хо, Х. Корт, С.М. Кримигис, Р. Л. МакНатт мл., Дж. М. Рейнс, М.Сарантос, С.С. Соломон, Т. Чжан, Т.Х. Zurbuchen, (2009), MESSENGER и наблюдения Venus Express за взаимодействием солнечного ветра с Венерой, Geophysical Research Letters, 36, 9

    М. Бенна, М.Х. Акуна, Б.Дж. Андерсон, С. Барабаш, С.А. Бордсен, Г. Глеклер, Р.Э. Золото, Г.К. Хо, Х. Корт, С.М. Кримигис, Р.Л. МакНатт мл., Дж.М. Рейнс, М. Сарантос, Дж.А. Славин, С.К. Соломон, Т.Л. Чжан, Т.Х. Зурбухен, (2009), Моделирование отклика индуцированной магнитосферы Венеры на изменение направления ММП с использованием экспресс-наблюдений MESSENGER и Венеры, Письма о геофизических исследованиях, 36, 4

    С.А. Бордсен, Дж.А. Славин, Б. Дж. Андерсон, Х. Корт, С. К. Соломон, (2009), Сравнение ультранизкочастотных волн на Меркурии при северном и южном ММП, Письма о геофизических исследованиях, 36, 18

    С.А. Бордсен, Б.Дж. Андерсон, М.Х. Акунья, Дж.А. Славин, Х. Корт, С. К. Соломон, (2009), Наблюдения узкополосных ультранизкочастотных волн аппаратом MESSENGER во время его пролета через магнитосферу Меркурия в январе 2008 г., Письма о геофизических исследованиях, 36, 1

    М.Э. Пурукер, Т.Дж. Сабака, С.С. Соломон, Б.Дж. Андерсон, Х. Корт, М.Т. Зубер, Г.А. Нейманн, (2009), Внутреннее магнитное поле Меркурия: ограничения на крупно- и мелкомасштабные поля корового происхождения, Письма о науке о Земле и планетах, 285, 3-4, 340-346

    Дж.А. Славин, Б.Дж. Андерсон, Т.Х. Зурбухен, Д.Н. Бейкер, С.М. Кримигис, М.Х. Акунья, М. Бенна, С.А. Бордсен, Г. Глеклер, Р.Е. Золото, Г.К. Хо, Х. Корт, Р. Л. МакНатт-младший, Дж. М. Рейнс, М. Сарантос, Д. Серивер, С. К. Соломон, П. Травничек, (2009), Наблюдения MESSENGER за магнитосферой Меркурия во время северного ММП, Geophysical Research Letters, 36, 2

    Б. Зигер, К.К. Хансен, О. Коэн, Т.И. Гомбози, Т.Х. Зурбухен, Б. Дж. Андерсон, Х. Корт, (2009), Условия вверх по течению на ртути во время первого пролета MESSENGER: результаты двух независимых моделей солнечного ветра, Письма о геофизических исследованиях, 36, 10

    Дж.А. Славин, М.Г. Акунья, Б.Дж. Андерсон, Д.Н. Бейкер, М. Бенна, Г. Глеклер, Р.Э. Золото, Г.К. Хо, Р.М. Киллен, Х. Корт, С.М. Кримигис, Р.Л. МакНатт-младший, Л.Р. Ниттлер, Дж. М. Рейнс, Д. Шривер, С. К. Соломон, Р. Д. Старр, П. Травник, Т. Х. Zurbuchen, (2008), Магнитосфера Меркурия после первого пролета MESSENGER, Science, 321, 5885, 85–89.

    Б.Дж. Андерсон, Х. Корт, К.Л. Уотерс, Д.Л. Грин, П. Стаунинг, (2008), Статистические распределения тока Биркеланда по наблюдениям магнитного поля в созвездии Иридиум, Annales Geophysicae, 26, 3, 671-687

    Б.Дж. Андерсон, М.Х. Акунья, Х. Корт, М.Э. Пурукер, К.Л. Джонсон, Дж.А. Славин, С.С. Соломон, Р.Л. МакНатт-младший, (2008), Структура магнитного поля Меркурия во время первого пролета MESSENGER, Science, 321, 5885, 82-85.

    Х. Корт, Б.Дж. Андерсон, Дж.Г. Лайон, М. Уилтбергер, (2008), Сравнение наблюдений токов Биркеланда во время двух событий магнитного облака с моделированием МГД, Annales Geophysicae, 26, 3, 499-516

    ЧАС.Корт, Б.Дж. Андерсон, Дж.М. Руохониеми, Х.У. Фрей, К.Л. Уотерс, Т.Дж. Иммель, Д.Л. Грин, (2008), Глобальные наблюдения за электромагнитным потоком и потоком энергии частиц для события северной зимы с южным межпланетным магнитным полем, Annales Geophysicae, 26, 6, 14:15-14:30

    С. Эрикссон, М. Р. Хейрстон, Ф. Дж. Рич, Х. Корт, Ю. Чжан, Б. Дж. Андерсон, (2008), Высокоширотная ионосферная конвекция и реакция тока Биркеланда на фазе восстановления магнитной бури 15 мая 2005 г., Журнал геофизических исследований: космос Физика, 113, к. 3

    С.Отани, Х. Корт, П.К. Брандт, Л.Г. Бломберг, Х.Дж. Сингер, М.Г. Хендерсон, Э.А. Лучек, Х.У. Фрей, К. Зонг, Дж. М. Вейган, Ю. Чжэн, А.Т.Ю. Луи, (2007), Журнал геофизических исследований: космическая физика, 112, 8.

    В.Г. Меркин, Дж.Г. Лайон, Б.Дж. Андерсон, Х. Корт, К.К. Гудрич, К. Пападопулос, (2007), Глобальное МГД-моделирование события с квазистационарной северной составляющей ММП, Annales Geophysicae, 25, 6, 1345-1358

    Дж.А. Славин, С.М. Кримигис, М.Х. Акунья, Б.Дж. Андерсон, Д.Н. Бейкер, П.Л. Коэн, Х. Корт, С. Ливи, Б.Х. Маук, С.С. Соломон, Т.Х. Zurbuchen, (2007), MESSENGER: Изучение магнитосферы Меркурия, Space Science Reviews, 131, 1–4, 133–160.

    Д.Л. Грин, К.Л. Уотерс, Х. Корт, Б.Дж. Андерсон, А.Дж. Ридли, Р.Дж. Барнс, (2007), Техника: крупномасштабная ионосферная проводимость, оцененная по комбинированным спутниковым и наземным электромагнитным данным, Журнал геофизических исследований: космическая физика, 112, 5

    Б.Дж. Андерсон, Х. Корт, (2007), Насыщение глобальных токов, ориентированных по полю, наблюдаемых во время штормов созвездием спутников Иридиум, Журнал атмосферной и солнечно-земной физики, 69, 1-2, 166-169

    Б.Дж. Андерсон, М.Х. Акунья, Д.А. Лор, Дж. Шайфеле, А. Раваль, Х. Корт, Дж.А. Славин, (2007), Магнитометр на MESSENGER, Space Science Reviews, 131, 1-4, 417-450

    Д.Л. Грин, К.Л. Уотерс, Б.Дж. Андерсон, Х. Корт, Р.Дж. Барнс, (2006), Сравнение крупномасштабных течений Биркеланда, определенных по данным иридия и SuperDARN, Annales Geophysicae, 24, 3, 941-959.

    Б. Дж. Андерсон, С.-И. Отани, Х. Корт, А. Ухорский, (2005), Асимметрия крупномасштабных течений Биркеланда во время шторма на рассвете и закате, Журнал геофизических исследований: космическая физика, 110, A12

    А.Ю. Ухорский, К. Такахаши, Б. Дж. Андерсон, Х. Корт, (2005), Воздействие тороидальных УНЧ-волн на электроны внешнего радиационного пояса, Журнал геофизических исследований: космическая физика, 110, A10

    М.Х. Дентон, М.Ф. Томсен, Х. Корт, С. Линч, Дж. К. Чжан, М. В. Лимон, (2005), Свойства объемной плазмы на геостационарной орбите, Журнал геофизических исследований: космическая физика, 110, A7

    ЧАС.Корт, Б.Дж. Андерсон, Х.У. Фрей, К.Л. Уотерс, (2005), Высокоширотный электромагнитный поток и поток энергии частиц во время события с устойчивым сильно направленным на север ММП, Annales Geophysicae, 23, 4, 1295-1310

    Х. Корт, Б.Дж. Андерсон, М.Х. Акунья, Дж.А. Славин, Н. А. Цыганенко, С. С. Соломон, Р. Л. МакНатт мл., (2004), Определение свойств магнитного поля Меркурия с помощью миссии MESSENGER, Planetary and Space Science, 52, 8, 733-746

    ЧАС.Корт, Б.Дж. Андерсон, Х.У. Фрей, Т.Дж. Иммель, С.Б. Менде, (2004), Условия, определяющие локализованное высокоширотное дневное сияние, Письма о геофизических исследованиях, 31, 4.

    Х.У. Фрей, Н. Остгаард, Т.Дж. Иммель, Х. Корт, С.Б. Менде, (2004), Сезонная зависимость локализованного высокоширотного дневного сияния (HiLDA), Журнал геофизических исследований: космическая физика, 109, A4

    ЧАС.Корт, Б.Дж. Андерсон, М.Дж. Уилтбергер, Дж.Г. Лион, ПК Андерсон, (2004), Взаимное сравнение электродинамики ионосферы из созвездия Иридиум с глобальным моделированием МГД, Журнал геофизических исследований: космическая физика, 109, A7

    С. Лю, М. В. Чен, Л. Р. Лайонс, Х. Корт, Дж. М. Альберт, Дж. Л. Родер, П.К. Андерсон, М.Ф. Томсен, (2003), Вклад конвективного переноса в инжекцию электронов кольцевого тока грозового периода, Журнал геофизических исследований: космическая физика, 108, A10

    Т.В. Гарнер, Р.А. Вольф, Р.В. Спиро, М.Ф. Томсен, Х. Корт, (2003), Несоответствие баланса давления, проявляющееся в статистической модели магнитосферной плазмы, Журнал геофизических исследований: космическая физика, 108, A8

    Х. Корт, М.Ф. Томсен, К.-Х. Глассмайер, В.С. Филлипс, (2002), Томография частиц внутренней магнитосферы, Журнал геофизических исследований: космическая физика, 107, A9

    М.Ф. Томсен, Х. Корт, Р.К. Эльфик, (2002), Верхняя граница энергии электронно-плазменного слоя как мера силы магнитосферной конвекции, Журнал геофизических исследований: космическая физика, 107, A10

    Х. Корт, М.Ф. Томсен, (2001), Доступ плазменного листа к геосинхронной орбите: обобщение численных моделей глобального поля, Журнал геофизических исследований: космическая физика, 106, A12, 29655-29667

    Р.Х.В. Фридель, Х. Корт, М.Г. Хендерсон, М.Ф. Томсен, Дж. Д. Скаддер, (2001), Доступ плазменного слоя к внутренней магнитосфере, Журнал геофизических исследований: космическая физика, 106, 4, 5845-5858

    Хайе Корт (2001 г.), Всестороннее исследование среды геостационарной плазмы. транспорт и потеря

    Хайе Корт (2001 г.), Всестороннее исследование среды геостационарной плазмы.перевозки и потери , 135 бл.

    А. Корт, Р.Х.В. Фридель, К.Г. Муикис, Дж. Ф. Феннелл, Дж. Р. Вигант, Х. Корт, (2000), Всесторонние наблюдения частиц и полей магнитных бурь в разное время с космического корабля CRRES, Журнал геофизических исследований: космическая физика, 105, A8, 18729-18740

    ЧАС.Корт, М.Ф. Томсен, Дж. Э. Боровский, Д.Дж. МакКомас, (1999), Доступ плазменного листа к геостационарной орбите, Журнал геофизических исследований: космическая физика, 104, A11, 25047-25061


    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка браузера на прием файлов cookie

    Существует множество причин, по которым файл cookie не может быть установлен правильно.Ниже приведены наиболее распространенные причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
    • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
    • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

    Дендритные клетки, происходящие из моноцитов, генерируемые IFN-α, приобретают свойства зрелых дендритных клеток и естественных клеток-киллеров, как показывает анализ экспрессии генов | Journal of Translational Medicine

  • 1.

    Banchereau J, Steinman RM: Дендритные клетки и контроль иммунитета.Природа. 1998, 392: 245-252. 10.1038/32588.

    КАС Статья пабмед Google Scholar

  • 2.

    Zhou LJ, Tedder TF: CD14+ моноциты крови могут дифференцироваться в функционально зрелые CD83+ дендритные клетки. Proc Natl Acad Sci U S A. 1996, 93: 2588-2592. 10.1073/пнас.93.6.2588.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 3.

    Thurner B, Roder C, Dieckmann D, Heuer M, Kruse M, Glaser A, Keikavoussi P, Kampgen E, Bender A, Schuler G: Получение большого количества полностью зрелых и стабильных дендритных клеток из продуктов лейкафереза для клинического применения.Дж Иммунол Методы. 1999, 223: 1-15. 10.1016/С0022-1759(98)00208-7.

    КАС Статья пабмед Google Scholar

  • 4.

    Nestle FO, Farkas A, Conrad C: Терапевтическая вакцинация против рака на основе дендритных клеток. Курр Опин Иммунол. 2005, 17: 163-169. 10.1016/j.coi.2005.02.003.

    КАС Статья пабмед Google Scholar

  • 5.

    Schott M, Feldkamp J, Klucken M, Kobbe G, Scherbaum WA, Seissler J: Кальцитонин-специфический противоопухолевый иммунитет при медуллярной карциноме щитовидной железы после вакцинации дендритными клетками.Рак Иммунол Иммунотер. 2002, 51: 663-668. 10.1007/с00262-002-0325-з.

    КАС Статья пабмед Google Scholar

  • 6.

    Paquette RL, Hsu NC, Kiertscher SM, Park AN, Tran L, Roth MD, Glaspy JA: Интерферон-альфа и гранулоцитарно-макрофагальный колониестимулирующий фактор дифференцируют моноциты периферической крови в мощные антигенпрезентирующие клетки. Дж. Лейкок Биол. 1998, 64: 358-367.

    КАС пабмед Google Scholar

  • 7.

    Сантини С.М., Лапента С., Логоцци М., Парлато С., Спада М., Ди Пуччио Т., Беларделли Ф.: Интерферон типа I в качестве мощного адъюванта для развития и активности дендритных клеток, происходящих из моноцитов, in vitro и у мышей Hu-PBL-SCID. J Эксперт Мед. 2000, 191: 1777-1788. 10.1084/ем.191.10.1777.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 8.

    Парлато С., Сантини С.М., Лапента С., Ди Пуччио Т., Логоцци М., Спада М., Джаммариоли А.М., Малорни В., Фаис С., Беларделли Ф.: Экспрессия CCR-7, MIP-3beta и Th- 1 хемокины в дендритных клетках, происходящих из моноцитов, индуцированных интерфероном I типа: важность для быстрого приобретения мощной миграционной и функциональной активности.Кровь. 2001, 98: 3022-3029. 10.1182/кровь.В98.10.3022.

    КАС Статья пабмед Google Scholar

  • 9.

    Lapenta C, Santini SM, Logozzi M, Spada M, Andreotti M, Di Pucchio T, Parlato S, Belardelli F: Сильный иммунный ответ против ВИЧ-1 и защита от заражения вирусом у мышей hu-PBL-SCID иммунизировали инактивированными дендритными клетками с импульсным вирусом, полученными в присутствии IFN-альфа. J Эксперт Мед. 2003, 198: 361-367. 10.1084/джем.20021924.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 10.

    Делла Б.С., Никола С., Рива А., Биасин М., Клеричи М., Вилла М.Л.: Функциональный репертуар дендритных клеток, генерируемых гранулоцитами, макрофагами, колониестимулирующим фактором и интерфероном-альфа. Дж. Лейкок Биол. 2004, 75: 106-116. 10.1189/jlb.0403154.

    Артикул Google Scholar

  • 11.

    Този Д., Валенти Р., Кова А., Совена Г., Хубер В., Пилла Л., Ариенти Ф., Беларделли Ф., Пармиани Г., Ривольтини Л.: роль перекрестных помех между индуцированными IFN-альфа дендритными клетками, происходящими из моноцитов, и NK-клетками в праймировании ответов CD8+ Т-клеток против опухолевых антигенов человека. Дж Иммунол. 2004, 172: 5363-5370.

    КАС Статья пабмед Google Scholar

  • 12.

    Biron CA: Интерфероны альфа и бета как иммунные регуляторы – новый взгляд. Иммунитет.2001, 14: 661-664. 10.1016/С1074-7613(01)00154-6.

    КАС Статья пабмед Google Scholar

  • 13.

    Долгосрочное наблюдение итальянского исследования интерферона-альфа по сравнению с обычной химиотерапией при хроническом миелоидном лейкозе. Итальянская совместная исследовательская группа по хроническому миелоидному лейкозу. Кровь. 1998, 92: 1541-1548.

  • 14.

    Рохатинер А.З., Грегори В.М., Петерсон Б., Борден Э., Солал-Селиньи П., Хагенбек А., Фишер Р.И., Унтерхальт М., Арранц Р., Чисези Т., Авилес А., Листер Т.А.: метаанализ для оценки Роль интерферона в фолликулярной лимфоме.Дж. Клин Онкол. 2005, 23: 2215-2223. 10.1200/JCO.2005.06.146.

    КАС Статья пабмед Google Scholar

  • 15.

    Bautz F, Denzlinger C, Kanz L, Mohle R: Хемотаксис и трансэндотелиальная миграция CD34(+) гемопоэтических клеток-предшественников, индуцированные медиатором воспаления лейкотриеном D4, опосредованы 7-трансмембранным рецептором CysLT11. Кровь. 2001, 97: 3433-3440. 10.1182/кровь.В97.11.3433.

    КАС Статья пабмед Google Scholar

  • 16.

    Диас-Бланко Э., Брунс И., Нойманн Ф., Фишер Дж. К., Греф Т., Росскопф М., Брорс Б., Пехтель С., Борк С., Кох А., Баер А., Рор У. П., Коббе Г., фон Хазелер А., Гаттерманн Н., Хаас R, Kronenwett R: Молекулярная подпись CD34+ гемопоэтических стволовых клеток и клеток-предшественников у пациентов с ХМЛ в хронической фазе. Лейкемия. 2007

    Google Scholar

  • 17.

    Кроненветт Р., Баттервек У., Стейдл У., Клишевский С., Нойманн Ф., Борк С., Бланко Э.Д., Роуз Н., Граф Т., Брорс Б., Эйлс Р., Меркер С., Коббе Г., Гаттерманн Н., Хаас Р. : Отдельный молекулярный фенотип злокачественных CD34(+) гемопоэтических стволовых клеток и клеток-предшественников при хроническом миелогенном лейкозе.Онкоген. 2005, 24: 5313-5324. 10.1038/sj.onc.1208596.

    КАС Статья пабмед Google Scholar

  • 18.

    Hilkens CM, Schlaak JF, Kerr IM: Дифференциальные ответы на подтипы IFN-альфа в человеческих Т-клетках и дендритных клетках. Дж Иммунол. 2003, 171: 5255-5263.

    КАС Статья пабмед Google Scholar

  • 19.

    Stroncek DF, Basil C, Nagorsen D, Deola S, Arico E, Smith K, Wang E, Marincola FM, Panelli MC: Замедленная поляризация программы транскрипции мононуклеарных фагоцитов изоформами интерферона I типа2.J Transl Med. 2005, 3: 24-10.1186/1479-5876-3-24.

    Центральный пабмед Статья пабмед Google Scholar

  • 20.

    Le Naour F, Hohenkirk L, Grolleau A, Misek DE, Lescure P, Geiger JD, Hanash S, Beretta L: Профилирование изменений в экспрессии генов во время дифференцировки и созревания дендритных клеток, происходящих из моноцитов, с использованием обоих олигонуклеотидных микрочипов и протеомика. Дж. Биол. Хим. 2001, 276: 17920-17931. 10.1074/jbc.M100156200.

    КАС Статья пабмед Google Scholar

  • 21.

    Чжоу А., Скоггин С., Гейнор Р.Б., Уильямс Н.С.: Идентификация генов, регулируемых NF-каппа B, индуцированных TNF-альфа, с использованием профилирования экспрессии и РНК-интерференции. Онкоген. 2003, 22: 2054-2064. 10.1038/sj.onc.1206262.

    КАС Статья пабмед Google Scholar

  • 22.

    Сен-Вис Б., Винсент Дж., Ванденабиле С., Ванбервлиет Б., Пин Дж.Дж., Айт-Яхия С., Патель С., Маттеи М.Г., Баншеро Дж., Зуравски С., Давуст Дж., Ко С., Лебек С.: А новый ассоциированный с лизосомой мембранный гликопротеин, DC-LAMP, индуцируемый при созревании DC, временно экспрессируется в компартменте MHC класса II.Иммунитет. 1998, 9: 325-336. 10.1016/S1074-7613(00)80615-9.

    Артикул пабмед Google Scholar

  • 23.

    Forster R, Schubel A, Breitfeld D, Kremmer E, Renner-Muller I, Wolf E, Lipp M: CCR7 координирует первичный иммунный ответ, создавая функциональное микроокружение во вторичных лимфоидных органах. Клетка. 1999, 99: 23-33. 10.1016/S0092-8674(00)80059-8.

    КАС Статья пабмед Google Scholar

  • 24.

    Puig-Kroger A, Sanz-Rodriguez F, Longo N, Sanchez-Mateos P, Botella L, Teixido J, Bernabeu C, Corbi AL: Зависимая от созревания экспрессия и функция интегрина CD49d на дендритных клетках человека, происходящих из моноцитов. Дж Иммунол. 2000, 165: 4338-4345.

    КАС Статья пабмед Google Scholar

  • 25.

    Berney C, Herren S, Power CA, Gordon S, Martinez-Pomares L, Kosco-Vilbois MH: член семейства дендритных клеток, который проникает в фолликулы B-клеток и стимулирует первичный ответ антител, определяемый маннозным рецептором. белок слияния.J Эксперт Мед. 1999, 190: 851-860. 10.1084/ем.190.6.851.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 26.

    Mueller CG, Rissoan MC, Salinas B, Ait-Yahia S, Ravel O, Bridon JM, Briere F, Lebecque S, Liu YJ: полимеразная цепная реакция выбирает новую дезинтегриновую протеиназу из CD40-активированного зародышевого центра дендритного клетки1. J Эксперт Мед. 1997, 186: 655-663. 10.1084/ем.186.5.655.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 27.

    O’Keeffe M, Grumont RJ, Hochrein H, Fuchsberger M, Gugasyan R, Vremec D, Shortman K, Gerondakis S: Различные роли транскрипционных факторов NF-kappaB1 и c-Rel в дифференцировке и выживании плазмоцитоидных и обычных дендритных клетки, активированные сигналами TLR-9. Кровь. 2005, 106: 3457-3464. 10.1182/кровь-2004-12-4965.

    Артикул пабмед Google Scholar

  • 28.

    Baggiolini M: Хемокины и движение лейкоцитов.Природа. 1998, 392: 565-568. 10.1038/33340.

    КАС Статья пабмед Google Scholar

  • 29.

    Piqueras B, Connolly J, Freitas H, Palucka AK, Banchereau J: При воздействии вируса миелоидные и плазмоцитоидные дендритные клетки продуцируют три волны различных хемокинов для рекрутирования иммунных эффекторов1. Кровь. 2005,

    Google Scholar

  • 30.

    Scimone ML, Lutzky VP, Zittermann SI, Maffia P, Jancic C, Buzzola F, Issekutz AC, Chuluyan HE: На миграцию полиморфноядерных лейкоцитов влияют дендритные клетки.Иммунология. 2005, 114: 375-385. 10.1111/j.1365-2567.2005.02104.х.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 31.

    D’Cunha J, Ramanujam S, Wagner RJ, Witt PL, Jr KE, Borden EC: In vitro и in vivo секреция человеческого ISG15, IFN-индуцированного иммуномодулирующего цитокина. Дж Иммунол. 1996, 157: 4100-4108.

    ПабМед Google Scholar

  • 32.

    Цудзи Н.М., Цуцуи Х., Секи Э., Куида К., Окамура Х., Наканиши К., Флавелл Р.А. Роль каспазы-1 в листериозной инфекции у мышей. Инт Иммунол. 2004, 16: 335-343. 10.1093/интимм/dxh041.

    КАС Статья пабмед Google Scholar

  • 33.

    Taub DD, Turcovski-Corrales SM, Key ML, Longo DL, Murphy WJ: Хемокины и активация Т-лимфоцитов: I. Бета-хемокины костимулируют активацию Т-лимфоцитов человека in vitro. Дж Иммунол. 1996, 156: 2095-2103.

    КАС пабмед Google Scholar

  • 34.

    Okunishi K, Dohi M, Nakagome K, Tanaka R, Yamamoto K: Новая роль цистеиниллейкотриенов в стимулировании активации дендритных клеток в антиген-индуцированных иммунных реакциях в легких. Дж Иммунол. 2004, 173: 6393-6402.

    КАС Статья пабмед Google Scholar

  • 35.

    Каягаки Н., Ямагути Н., Накаяма М., Такеда К., Акиба Х., Цуцуи Х., Окамура Х., Наканиши К., Окумура К., Ягита Х. Экспрессия и функция TNF-родственного лиганда, индуцирующего апоптоз, на активированных мышах NK-клетки 1.Дж Иммунол. 1999, 163: 1906-1913.

    КАС пабмед Google Scholar

  • 36.

    Пардо Дж., Балкоу С., Анель А., Саймон М.М.: Гранзимы необходимы для контроля над опухолями, опосредованного естественными клетками-киллерами и стимулируемого перфорацией1. Евр Дж Иммунол. 2002, 32: 2881-2887. 10.1002/1521-4141(2002010)32:10<2881::AID-IMMU2881>3.0.CO;2-K.

    КАС Статья пабмед Google Scholar

  • 37.

    Royer PJ, Tanguy-Royer S, Ebstein F, Sapede C, Simon T, Barbieux I, Oger R, Gregoire M: Культуральная среда и белковые добавки для образования и созревания дендритных клеток. Сканд Дж. Иммунол. 2006, 63: 401-409. 10.1111/j.1365-3083.2006.001757.х.

    КАС Статья пабмед Google Scholar

  • 38.

    Lapenta C, Santini SM, Spada M, Donati S, Urbani F, Accapezzato D, Franceschini D, Andreotti M, Barnaba V, Belardelli F: Кондиционированные IFN-альфа дендритные клетки очень эффективно вызывают праймирование CD8(+) Т-клеток против экзогенных вирусных антигенов1.Евр Дж Иммунол. 2006, 36: 2046-2060. 10.1002/eji.200535579.

    КАС Статья пабмед Google Scholar

  • 39.

    Figdor CG, De Vries IJ, Lesterhuis WJ, Melief CJ: Иммунотерапия дендритными клетками: картирование пути1. Нат Мед. 2004, 10: 475-480. 10,1038/нм1039.

    КАС Статья пабмед Google Scholar

  • 40.

    Barnes BJ, Richards J, Mancl M, Hanash S, Beretta L, Pitha PM: Глобальные и отдельные мишени IRF-5 и IRF-7 во время врожденного ответа на вирусную инфекцию1.Дж. Биол. Хим. 2004, 279: 45194-45207. 10.1074/jbc.M400726200.

    КАС Статья пабмед Google Scholar

  • 41.

    Izaguirre A, Barnes BJ, Amrute S, Yeow WS, Megjugorac N, Dai J, Feng D, Chung E, Pitha PM, Fitzgerald-Bocarsly P: Сравнительный анализ экспрессии IRF и IFN-альфа в плазмоцитоиде человека и дендритные клетки моноцитного происхождения1. Дж. Лейкок Биол. 2003, 74: 1125-1138. 10.1189/jlb.0603255.

    КАС Статья пабмед Google Scholar

  • 42.

    Макдональд К.П., Мюнстер Д.Дж., Кларк Г.Дж., Дзионек А., Шмитц Дж., Харт Д.Н.: Характеристика подмножеств дендритных клеток крови человека. Кровь. 2002, 100: 4512-4520. 10.1182/кровь-2001-11-0097.

    КАС Статья пабмед Google Scholar

  • 43.

    Takauji R, Iho S, Takatsuka H, ​​Yamamoto S, Takahashi T, Kitagawa H, Iwasaki H, Iida R, Yokochi T, Matsuki T: CpG-ДНК-индуцированная продукция IFN-альфа включает p38 MAPK-зависимую Фосфорилирование STAT1 в предшественниках плазмоцитоидных дендритных клеток человека1.Дж. Лейкок Биол. 2002, 72: 1011-1019.

    КАС пабмед Google Scholar

  • 44.

    Liu YJ: IPC: профессиональные клетки, продуцирующие интерферон 1 типа, и предшественники плазмоцитоидных дендритных клеток. Анну Рев Иммунол. 2005, 23: 275-306. 10.1146/аннурев.иммунол.23.021704.115633.

    КАС Статья пабмед Google Scholar

  • 45.

    Mohty M, Vialle-Castellano A, Nunes JA, Isnardon D, Olive D, Gaugler B: IFN-альфа искажает дифференцировку моноцитов в дендритные клетки, экспрессирующие Toll-подобный рецептор 7, с мощной функциональной активностью1.Дж Иммунол. 2003, 171: 3385-3393.

    КАС Статья пабмед Google Scholar

  • 46.

    Bryceson YT, March ME, Ljunggren HG, Long EO: Синергизм между рецепторами покоящихся NK-клеток для активации естественной цитотоксичности и секреции цитокинов1. Кровь. 2006, 107: 159-166. 10.1182/кровь-2005-04-1351.

    Центральный пабмед КАС Статья пабмед Google Scholar

  • 47.

    Моретта А., Боттино С., Витале М., Пенде Д., Кантони С., Мингари М.С., Биассони Р., Моретта Л.: Активация рецепторов и корецепторов, участвующих в цитолизе человека, опосредованном естественными клетками-киллерами3. Анну Рев Иммунол. 2001, 19: 197-223. 10.1146/аннурев.иммунол.19.1.197.

    КАС Статья пабмед Google Scholar

  • 48.

    Shi J, Ikeda K, Fujii N, Kondo E, Shinagawa K, Ishimaru F, Kaneda K, Tanimoto M, Li X, Pu Q: Активированные дендритные клетки пуповинной крови человека убивают опухолевые клетки, не повреждая нормальные гематологические клетки-предшественники 24.Онкологические науки. 2005, 96: 127-133. 10.1111/j.1349-7006.2005.00017.х.

    КАС Статья пабмед Google Scholar

  • 49.

    Chan CW, Crafton E, Fan HN, Flook J, Yoshimura K, Skarica M, Brockstedt D, Dubensky TW, Stins MF, Lanier LL, Pardoll DM, Housseau F: Дендритные клетки-убийцы, продуцирующие интерферон, обеспечивают связь между врожденным и адаптивным иммунитетом 1. Нат Мед. 2006, 12: 207-213. 10,1038/нм1352.

    КАС Статья пабмед Google Scholar

  • 50.

    Taieb J, Chaput N, Menard C, Apetoh L, Ullrich E, Bonmort M, Pequignot M, Casares N, Terme M, Flament C, Opolon P, Lecluse Y, Metivier D, Tomasello E, Vivier E, Ghiringhelli F, Martin F, Klatzmann D, Poynard T, Tursz T, Raposo G, Yagita H, Ryffel B, Kroemer G, Zitvogel L: Новое подмножество дендритных клеток, участвующих в иммунологическом надзоре за опухолью1. Нат Мед. 2006, 12: 214-219. 10,1038/нм1356.

  • Оставить комментарий

    Ваш адрес email не будет опубликован.