Формы выписки из егрн: Обновлены формы выписок из ЕГРН, состав содержащихся в них сведений и порядок их заполнения, требования к формату документов, содержащих сведения ЕГРН и предоставляемых в электронном виде

Содержание

Обновлены формы выписок из ЕГРН, состав содержащихся в них сведений и порядок их заполнения, требования к формату документов, содержащих сведения ЕГРН и предоставляемых в электронном виде

  • Главная
  • Правовые ресурсы
  • "Горячие" документы
  • Приказ Росреестра от 04.09.2020 N П/0329 "Об утверждении форм выписок из Единого государственного реестра недвижимости, состава содержащихся в них сведений и порядка их заполнения, требований к формату документов, содержащих сведения Единого государственного реестра недвижимости и предоставляемых в электронном виде, а также об установлении иных видов предоставления сведений, содержащихся в Едином государственном реестре недвижимости"

 

Приказ Росреестра от 04.09.2020 N П/0329 "Об утверждении форм выписок из Единого государственного реестра недвижимости, состава содержащихся в них сведений и порядка их заполнения, требований к формату документов, содержащих сведения Единого государственного реестра недвижимости и предоставляемых в электронном виде, а также об установлении иных видов предоставления сведений, содержащихся в Едином государственном реестре недвижимости"

Утверждены в том числе формы выписки из ЕГРН об объекте недвижимости, об основных характеристиках и зарегистрированных правах на объект недвижимости, о переходе прав на объект недвижимости, о правах отдельного лица на имевшиеся (имеющиеся) у него объекты недвижимости и др.

Установлены также иные виды предоставления сведений, содержащихся в Едином государственном реестре недвижимости.

Настоящий приказ вступает в силу с момента признания утратившими силу приказов Минэкономразвития России от 25.12.2015 N 975, от 20.06.2016 N 378.

 

Перейти в текст документа »

Больше документов и разъяснений по коронавирусу и антикризисным мерам - в системе КонсультантПлюс.

Зарегистрируйся и получи пробный доступ

Дата публикации на сайте: 18.09.2020

Поделиться ссылкой:

Утверждены формы выписок из ЕГРН, состав содержащихся в них сведений и порядок их заполнения, а также требования к формату документов, содержащих сведения из ЕГРН и предоставляемых в электронном виде

  • Главная
  • Правовые ресурсы
  • "Горячие" документы
  • Приказ Минэкономразвития России от 25.12.2015 N 975 "Об утверждении форм выписок из Единого государственного реестра недвижимости, состава содержащихся в них сведений и порядка их заполнения, а также требований к формату документов, содержащих сведения Единого государственного реестра недвижимости и предоставляемых в электронном виде"

 

Приказ Минэкономразвития России от 25.12.2015 N 975 "Об утверждении форм выписок из Единого государственного реестра недвижимости, состава содержащихся в них сведений и порядка их заполнения, а также требований к формату документов, содержащих сведения Единого государственного реестра недвижимости и предоставляемых в электронном виде"

Документом, в частности, утверждены:

- форма выписки из ЕГРН об объекте недвижимости;

- форма выписки из ЕГРН о признании правообладателя недееспособным или ограниченно дееспособным;

- форма выписки из ЕГРН о кадастровой стоимости объекта недвижимости;

- форма выписки о содержании правоустанавливающих документов;

- форма выписки о зарегистрированных договорах участия в долевом строительстве.

Кроме того, определены Правила заполнения выписок из ЕГРН, состав содержащихся в них сведений, а также требования к формату документов, содержащих сведения ЕГРН и предоставляемых в электронном виде.

Приказ вступает в силу с 1 января 2017 года.

 

Перейти в текст документа »

Больше документов и разъяснений по коронавирусу и антикризисным мерам - в системе КонсультантПлюс.

Зарегистрируйся и получи пробный доступ

Дата публикации на сайте: 29.02.2016

Поделиться ссылкой:

Росреестр

Выписка из Единого государственного реестра недвижимости (ЕГРН) — это одна из форм предоставления сведений, содержащихся в ЕГРН. Существует несколько видов выписок из ЕГРН, формы которых утверждены приказами Минэкономразвития от 25.12.2015 № 975, от 20.06.2016 № 378. Сведения, содержащиеся в ЕГРН, за исключением сведений, доступ к которым ограничен федеральным законом, предоставляются органом регистрации прав по запросам любых лиц.
К общедоступным сведениям относятся следующие виды выписок из ЕГРН:
- об объекте недвижимости;
- о кадастровой стоимости объекта недвижимости;

- о зарегистрированных договорах участия в долевом строительстве;
- об основных характеристиках и зарегистрированных правах на объект недвижимости;
- о переходе прав на объект недвижимости;
- о зоне с особыми условиями использования территорий, территориальной зоне, территории объекта культурного наследия, территории опережающего социально-экономического развития, зоне территориального развития в Российской Федерации, игорной зоне, лесничестве, лесопарке, особо охраняемой природной территории, особой экономической зоне, охотничьем угодье, береговой линии (границе водного объекта), проекте межевания территории;
- о границе между субъектами Российской Федерации, границе муниципального образования и границе населенного пункта.
Выписки из ЕГРН, предоставление которых допустимо только ограниченному кругу лиц:
- о признании правообладателя недееспособным или ограниченно дееспособным;
- о содержании правоустанавливающих документов;
- о правах отдельного лица на имевшиеся (имеющиеся) у него объекты недвижимости;
- о дате получения органом регистрации прав заявления о государственном кадастровом учете и (или) государственной регистрации прав и прилагаемых к нему документов.
Все виды выписок из ЕГРН не только содержат разную информацию, но и имеют разное целевое назначение. В целом же, они будут полезны для лиц, которые планируют заключать сделку с недвижимостью и хотят проверить, всё ли в порядке с юридической стороны, а также для граждан, которые по тем или иным причинам оказались втянуты в спорные процессы.

Порядок предоставления сведений, содержащихся в ЕГРН, утвержден приказом Минэкономразвития от 25.12.2015 № 968. Сведения, содержащиеся в ЕГРН, аналитическая и иная информация по запросам о предоставлении сведений лиц, не указанных в части 1 статьи 63 Федерального закона от 13.07.2015 № 218-ФЗ «О государственной регистрации недвижимости», предоставляются за плату. Размер такой платы, порядок ее взимания и возврата устанавливаются органом нормативно-правового регулирования.

Росреестр утвердит новые формы выписок из ЕГРН

На портале проектов нормативно-правых актов размещен проект приказа Росреестра «Об утверждении форм выписок из ЕГРН, состава содержащихся в них сведений и порядка их заполнения, требований к формату документов, содержащих сведения ЕГРН и предоставляемых в электронном виде, а также об определении видов предоставления сведений, содержащихся в ЕГРН».

       

Фото: www.inovaco.ru

        

Проектом приказа утверждаются новые формы выписок из Единого государственного реестра недвижимости (ЕГРН):

● об объекте недвижимости;

● о правах отдельного лица на имевшиеся (имеющиеся) у него объекты недвижимости;

● о содержании правоустанавливающих документов;

● о дате получения органом регистрации прав заявления о государственном кадастровом учете и (или) государственной регистрации прав и прилагаемых к нему документов;

       

     

● о зоне с особыми условиями использования территорий, территориальной зоне, публичном сервитуте, территории объекта культурного наследия, территории опережающего социально-экономического развития, зоне территориального развития в РФ, игорной зоне, лесничестве, особо охраняемой природной территории, особой экономической зоне, охотничьем угодье, Байкальской природной территории и ее экологических зонах, береговой линии (границе водного объекта), проекте межевания территории;

● о границе между субъектами Российской Федерации, границе муниципального образования и границе населенного пункта;

● о кадастровой стоимости объекта недвижимости.

     

      

  

Приказом также будут утверждены порядок заполнения выписок из ЕГРН и состав содержащихся в них сведений, требования к формату документов, содержащих сведения ЕГРН и предоставляемых в электронном виде.

Сведения, содержащиеся в Едином государственном реестре недвижимости, предоставляются в виде:

● кадастрового плана территории;

● уведомления об отсутствии сведений о лицах, получивших сведения
‎об объекте недвижимости;

● справки о лицах, получивших сведения об объекте недвижимости;

● уведомления об отсутствии в Едином государственном реестре недвижимости запрашиваемых сведений;

● решения об отказе в предоставлении запрашиваемых сведений

‎из Единого государственного реестра недвижимости.

     

Фото: www.egrnn.ru

    

Ранее портал ЕРЗ.РФ информировал о принятом Госдумой в первом чтении законопроекте №962484-7 «О внесении изменений в Федеральный закон «О государственной регистрации недвижимости»…», упрощающем порядок подачи электронного заявления о государственной регистрации права и кадастровом учете объекта недвижимости.

Общественное обсуждение проекта постановления продлится до 2 сентября 2020 года. В случае его утверждения приказ вступит в силу не ранее 1 мая 2021 года.

      

Фото: www.grozny-inform.ru

     

   

   

   

    

Другие публикации по теме:

Дистанционное оформление прав на недвижимость будет происходить без оформления электронной подписи

Как изменятся процедуры кадастрового учета и государственной регистрации

Законопроект, сокращающий сроки регистрации ДДУ, внесен в Госдуму

Как упростится процедура регистрации недвижимости

Эксперимент по созданию единого информационного ресурса о земле и недвижимости охватит три региона

Росреестр установит порядок уведомления заявителей

Росреестр: выписку по ДДУ теперь можно получить практически мгновенно

Росреестр: проверять подлинность выписок из ЕГРН лучше с помощью QR кода

В ноябре выписки Росреестра о ДДУ начнут выдаваться за 1 рубль

Формы и образцы выписки из Единого государственного реестра прав

Рынок недвижимости — это один из самых сложных и оборотоспособных сегментов народного хозяйства. Поэтому уже давно назревала необходимость упорядочить сведения обо всех имеющихся на территории РФ объектах недвижимости. В связи с этим в 1998 году был создан Единый гос. реестр прав на недвижимое имущество, который и стал местом хранения всей информации, связанной с правами собственников на имущество. Сегодня любая сделка, происходящая в рамках данного рынка, подтверждается сведениями из Госреестра. Итак, что такое выписка из ЕГРП, как выглядит данный документ?

Формы выписки из ЕГРП

Существует несколько видов и форм данной справки. Для разных целей требуется различная информация, поэтому в представительстве ЕГРП можно заказать:

  • Информационную (простую) выписку (форма № 1) — такие ЕГРП выписки необходимы для проведения сделок (купля-продажа, обмен и т.д), для оформления наследства, получения ипотечного кредита и прочее. Такая справка содержит сведения о расположении помещения, его подробное описание, имя владельца и информацию о правомочности передачи прав собственности.
  • Расширенная информационная справка — как и простая выписка, эта форма запроса в ЕГРП востребована преимущественно при оформлении сделок с недвижимостью. Запросить ее может только сам владелец помещения или его доверенное лицо. Иногда, в случае спорных вопросов, такая выписка может быть выдана представителю гос. структур (круг таких лиц четко ограничен законом №122 РФ). Такая выписка содержит полную информацию о собственнике, его дату рождения, прописку, паспортные данные, существующие и прекращенные обременения, аресты, данные о предыдущих собственниках и на основании чего были зарегистрированы договора купли-продажи.
  • Выписка о составе правоустанавливающих документов (форма №2) — данный
    бланк выписки из ЕГРП
    содержит полный перечень правоустанавливающих документов, относящихся к объекту недвижимости. Используется эта выписка для восстановления потерянных документов при оформлении права наследования, ипотеки и некоторых других случаях.
  • Справка о правах отдельного лица (форма №3) — такая форма выписки из ЕГРП содержит наиболее полную информацию о собственнике, в том числе о том, какие еще объекты недвижимости имеются у него. Эта справка может быть затребована жилищным комитетом или банком в случае оформления льготных условий ипотеки или предоставления льготного жилья. Данный образец выписки из ЕГРП выдается как по запросу собственника, так и заинтересованных в получении информации гос. структур.

Как заказать бланк выписки из ЕГРП?

Проще всего выписку из ЕГРП получить с помощью специализированной фирмы, предоставляющей такие услуги. Для этого нужно всего лишь оставить заявку на сайте юридической фирмы, все остальное сделают специалисты.

Росреестр утвердит новые формы выписок из ЕГРН — Рамблер/финансы

На портале проектов нормативно-правых актов размещен проект приказа Росреестра «Об утверждении форм выписок из ЕГРН, состава содержащихся в них сведений и порядка их заполнения, требований к формату документов, содержащих сведения ЕГРН и предоставляемых в электронном виде, а также об определении видов предоставления сведений, содержащихся в ЕГРН». Фото: www.inovaco.ru Проектом приказа утверждаются новые формы выписок из Единого государственного реестра недвижимости (ЕГРН): об объекте недвижимости; о правах отдельного лица на имевшиеся (имеющиеся) у него объекты недвижимости; о содержании правоустанавливающих документов; о дате получения органом регистрации прав заявления о государственном кадастровом учете и (или) государственной регистрации прав и прилагаемых к нему документов; о зоне с особыми условиями использования территорий, территориальной зоне, публичном сервитуте, территории объекта культурного наследия, территории опережающего социально-экономического развития, зоне территориального развития в РФ, игорной зоне, лесничестве, особо охраняемой природной территории, особой экономической зоне, охотничьем угодье, Байкальской природной территории и ее экологических зонах, береговой линии (границе водного объекта), проекте межевания территории; о границе между субъектами Российской Федерации, границе муниципального образования и границе населенного пункта; о кадастровой стоимости объекта недвижимости. Приказом также будут утверждены порядок заполнения выписок из ЕГРН и состав содержащихся в них сведений, требования к формату документов, содержащих сведения ЕГРН и предоставляемых в электронном виде. Сведения, содержащиеся в Едином государственном реестре недвижимости, предоставляются в виде: кадастрового плана территории; уведомления об отсутствии сведений о лицах, получивших сведения об объекте недвижимости; справки о лицах, получивших сведения об объекте недвижимости; уведомления об отсутствии в Едином государственном реестре недвижимости запрашиваемых сведений; решения об отказе в предоставлении запрашиваемых сведений из Единого государственного реестра недвижимости. Фото: www.egrnn.ru Ранее портал ЕРЗ.РФ информировал о принятом Госдумой в первом чтении законопроекте 962484-7 «О внесении изменений в Федеральный закон «О государственной регистрации недвижимости» », упрощающем порядок подачи электронного заявления о государственной регистрации права и кадастровом учете объекта недвижимости. Общественное обсуждение проекта постановления продлится до 2 сентября 2020 года. В случае его утверждения приказ вступит в силу не ранее 1 мая 2021 года. Фото: www.grozny-inform.ru

Особенности выписки из единого государственного реестра недвижимости об объекте недвижимости

Особенности выписки из единого государственного реестра недвижимости об объекте недвижимости

Одной из самых востребованных услуг Кадастровой палаты является предоставление сведений из Единого государственного реестра недвижимости (ЕГРН). Учитывая разнообразие целей получения сведений, заявитель может выбрать конкретный вид выписки из ЕГРН и получить именно те сведения, которые ему необходимы. Однако нередко у граждан встречаются ситуации - получили выписку из ЕГРН, а нужных сведений в ней не оказалось. Это связано с многообразием форм выписок. Рассмотрим самую распространенную из форм - выписку из ЕГРН об объекте недвижимости.

В прошлом столетии, когда началась приватизация земель, участки стали предоставлять гражданам и организациям. Права собственности, постоянного бессрочного пользования, пожизненного наследуемого владения на такие земельные участки возникали на основании постановлений администраций районов, согласно которым выдавались документы на земельные участки, такие как: государственные акты на право собственности на землю, пожизненного наследуемого владения, постоянного (бессрочного) пользования землей; свидетельства о праве собственности на землю; свидетельства на право собственности на землю или право постоянного (бессрочного) пользования на землю. Такие документы признаются юридически действующими, а права, возникшие на основании таких документов действительными.

Сведения о правах на такие участки отражаются только в графе "Особые отметки" выписки из ЕГРН об объекте недвижимости. Чаще всего данные сведения необходимы при вступлении в наследство для подтверждения прав умершего родственника на имущество.

Еще одна распространенная ситуация - план объекта недвижимости есть, а координат нет. Если требуется получить информацию о координатах объекта, то опять же следует заказать выписку из ЕГРН об объекте недвижимости, т.к. необходимые сведения содержатся именно в данной форме выписки.

Помимо вышеуказанной формы сведения могут быть предоставлены в виде выписки из ЕГРН:

- о переходе прав на объект недвижимости;

- о правах отдельного лица на имевшиеся (имеющиеся) у него объекты недвижимости;

- о признании правообладателя недееспособным или ограниченно дееспособным;

- о кадастровой стоимости объекта недвижимости;

- о зарегистрированных договорах участия в долевом строительстве;

- о содержании правоустанавливающих документов;

- о дате получения органом регистрации прав заявления о государственном кадастровом учете и (или) государственной регистрации прав и прилагаемых к нему документов.

Обратиться за получением сведений из ЕГРН можно несколькими способами.

Первый способ - обратиться лично в офис МФЦ.

Второй способ - обратиться посредством почтового отправления в Кадастровую палату, направив документы по адресу г.Волгоград, ул.Тимирязева д. 9.

Третий способ - обратиться в электронном виде, с помощью официального сайта Росреестра www.rosreestr.ru.

Следует отметить, что согласно действующего законодательства сведения предоставляются за плату за исключением выписки из ЕГРН о кадастровой стоимости объекта недвижимости.

«Обращаем внимание, что при получении сведений в электронном виде выписки заверяются электронной цифровой подписью уполномоченного лица Кадастровой палаты. Данная выписка имеет такую же юридическую силу, что и документ, выданный на бумаге. Однако, некоторые заявители, получив документ в электронном виде и распечатав его на бумаге, обращаются в Кадастровую палату для его заверения. Повторное заверение такой выписки законодательством не предусмотрено. Поэтому лучше сразу заказать выписку из ЕГРН в нужном виде - на бумаге. Также стоит отметить необходимость правильного указания адреса электронной почты, при желании получить выписку из ЕГРН электронно»,- отмечает и.о. директора филиала Кадастровой палаты по Волгоградской области Наталья Бирюлькина.

 

 

 

бланков: финансовая помощь | Университет Акрона, Огайо,

При подаче этих документов убедитесь, что вы указали свое имя и номер студенческого билета UA вверху каждой страницы.

  • Копия карты социального обеспечения - отправьте копию своей карты социального обеспечения
  • Период ожидания DHS - Служба гражданства и иммиграции Министерства внутренней безопасности США (DHS) еще не подтвердила, что вы имеете право на получение федеральной финансовой помощи.DHS продолжит проверку своих записей, и вы получите уведомление о результате.
  • Бланк ответа на нарушение закона о наркотиках - Вы не ответили на Q23 в своем FAFSA. В результате вы не имеете права на получение федеральной помощи студентам. Пожалуйста, войдите в свой FAFSA, чтобы исправить ошибку. Судимость за наркотики не обязательно лишает вас права на получение федеральной помощи студентам.
  • Задержка в связи с нарушением закона о наркотиках - В вашем FAFSA вы сообщили, что ваша судимость за наркотики заканчивается 1 июля 201X года или после этой даты.Пожалуйста, свяжитесь с нами через Центр поддержки после 7/1 / 1X, чтобы можно было определить ваше право на получение федеральной помощи студентам.
  • Документ для неграждан, отвечающих критериям - Предоставьте копии обеих сторон вашей карты постоянного жителя, карты условного постоянного жителя или записи об отбытии по прибытии I-94.
  • Статус иммигранта-негражданина - Вы указали статус негражданина / иммигранта в своем FAFSA. Пожалуйста, предоставьте копии обеих сторон вашей карты постоянного жителя, карты условного постоянного жителя или записи об отбытии по прибытии I-94.
  • Официальная форма DD-214 - отправьте копию вашей официальной формы DD214 (участник 4)
  • Подтверждение регистрации иностранца № - предоставьте копию своего регистрационного номера иностранца
  • Доказательство гражданства - Администрация социального обеспечения не смогла подтвердить ваше гражданство. Предоставьте копию свидетельства о рождении, подписанного / действующего паспорта США, свидетельства о гражданстве или свидетельства о натурализации.
  • Подтверждение даты рождения - Дата рождения, указанная вами в FAFSA, не совпадает с данными Администрации социального обеспечения.Проверьте в FAFSA правильный SSN и дату рождения. Исправьте все ошибки в вашем FAFSA. Кроме того, предоставьте в наш офис подтверждение вашего имени, даты рождения и SSN.
  • Подтверждение об окончании средней школы - предоставьте копию аттестата об окончании средней школы, итоговую стенограмму средней школы или сертификат GED
  • Подтверждение имени / изменения имени - Имя, указанное вами в FAFSA, не совпадает с именем в записях Администрации социального обеспечения. Проверьте правильность имени в FAFSA.Исправьте все ошибки. Кроме того, предоставьте копию документации о смене имени - свидетельство о браке, постановление суда и т. Д.
  • Доказательство гражданства США - Администрация социального обеспечения не смогла подтвердить ваше гражданство. Предоставьте копию свидетельства о рождении, подписанного / действующего паспорта США, свидетельства о гражданстве или свидетельства о натурализации.
  • Регистрационный номер избирательной службы - Зарегистрируйтесь онлайн.
  • Selective Service Registration - Selective Service сообщил, что вы не регистрировались в них.Если вы женщина, войдите в свой FAFSA и исправьте свой ответ на Q21. Если вы мужчина, родившийся до 1960 года, отправьте в наш офис документацию о дате вашего рождения. Если вы мужчина 18-25 лет, вы должны зарегистрироваться онлайн. Если вам не удалось зарегистрироваться в Selective Service по какой-либо причине, отправьте письмо в наш офис с описанием ваших обстоятельств.
  • Номер социального страхования Выпуск - Отдел финансовой помощи студентам будет работать над решением этой проблемы от вашего имени. Если от вас потребуется что-то еще, мы свяжемся с вами.

Необходимые дополнительные формы

Необходимые дополнительные формы


для подачи в дополнение к единому заявлению о регистрации (URS)

Арканзас

* Безотзывное согласие на оказание услуг: благотворительная организация (1 стр.)

Калифорния

* Годовой отчет о плате за продление регистрации (1 стр.)

Округ Колумбия

* Базовая информация о лицензировании для бизнеса (3 стр.)

* Заявление на получение базовой бизнес-лицензии (2 стр.)

Грузия

* Грузия Приложение к URS (1 стр.)

Мэн

* Специальная титульная страница штата Мэн для первоначальной регистрации (5 стр.)

* Специальная титульная страница штата Мэн для продления регистрации (6 стр.)

Миннесота

* Приложение Миннесоты к URS (4 стр.)

Миссисипи

* Приложение к УРС (4 стр.)

Северная Каролина

* Инструкции по форме раскрытия информации о сборе средств (4 стр.)

* Форма раскрытия информации о сборе средств (1 стр.)

Северная Дакота

* Инструкции по форме раскрытия информации о сборе средств (4 стр.)

* Форма раскрытия информации о сборе средств (1 стр.)

Теннесси

* Приложение Теннесси к URS (1 стр.)

* Обзор финансовой деятельности (2 стр.)

Юта

* Дополнение к URS, штат Юта (4 стр.)

* Инструкции по составлению отчета о функциональных расходах, штат Юта (5 страниц)

* Финансовый отчет / Отчет о функциональных расходах штата Юта (1 стр.)

Вашингтон

* Дополнение к URS Вашингтона (3 стр.)

Западная Вирджиния

* Приложение Западной Вирджинии к URS (1 стр.)

Висконсин

* Висконсин Приложение к Финансовому отчету по форме, отличной от 308 (5 стр.)


© 2014 ПРОЕКТ МНОГОГОСУДАРСТВЕННОГО ФИЛЬТРА

предыдущая страница | дом | следующая страница

Рецептор NOD2

имеет решающее значение для защиты от пищеварительной формы болезни Шагаса.

PLoS Negl Trop Dis.2020 сен; 14 (9): e0008667.

, Концептуализация, Курирование данных, Формальный анализ, Исследование, Методология, Программное обеспечение, Написание - первоначальный проект, Написание - обзор и редактирование, 1, 2 , Формальный анализ, Исследование, Методология, Написание - обзор и редактирование, 3 , Формальный анализ, Исследование, Методология, Написание - просмотр и редактирование, 3 , Написание - оригинальный черновик, Написание - просмотр и редактирование, 3 , Формальный анализ, Исследование, Методология, Написание - просмотр и редактирование, 4 , Написание - просмотр и редактирование, 3 , Курирование данных, Формальный анализ, Исследование, Методология, Программное обеспечение, Написание - обзор и редактирование, 5 , Получение финансирования, Ресурсы, Написание - обзор и редактирование, 5 , Получение финансирования , Ресурсы, Написание - просмотр и редактирование, 6 , Получение финансирования, Администрирование проекта, Ресурсы, Надзор, Написание - обзор и редактирование, 1 , Получение финансирования, Ресурсы, Надзор, Проверка, Написание - просмотр и редактирование, 7 , концептуализация, получение финансирования, ресурсы, надзор, проверка, написание - проверка и редактирование, 1, 7 и, концептуализация, курирование данных, формальный анализ, получение финансирования, администрирование проекта, Ресурсы, программное обеспечение, надзор, проверка, написание - первоначальный черновик, написание - просмотр и редактирование 3, *

Натали де Сена Перейра

1 Департамент паразитологии Федерального университета Минас-Жерайс, Белу-Оризонти, Бразилия

2 Университет Потигуар, Натал, Бразилия

Tamyres Bernadete Dantas Queiroga

3 Кафедра микробиологии и паразитологии, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

Дени Дантас да Силва

3 Кафедра микробиологии и паразитологии, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

Мануэла Салес Лима Насименто

3 Кафедра микробиологии и паразитологии, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

Cléber Mesquita de Andrade

4 Департамент биомедицинских наук, Университет штата Риу-Гранди-ду-Норти, Мосоро, Бразилия

Janeusa Trindade de Souto

3 Кафедра микробиологии и паразитологии, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

Майра Фернанда Риччи

5 Кафедра патологии, Федеральный университет Минас-Жерайс, Белу-Оризонти, Бразилия

Роза Мария Эстевес Арантес

5 Кафедра патологии, Федеральный университет Минас-Жерайс, Белу-Оризонти, Бразилия

Дарио Симойнс Замбони

6 Кафедра клеточной и молекулярной биологии и патогенных биоагентов, Медицинская школа Рибейран-Прету, Университет Сан-Паулу, Рибейран-Прету, Бразилия

Эглер Киари

1 Департамент паразитологии, Федеральный университет Минас-Жерайс, Белу-Оризонти, Бразилия

Антония Клаудиа Жакоме да Камара

7 Департамент клинических и токсикологических анализов, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

Лусиа Мария да Кунья Гальвао

1 Департамент паразитологии, Федеральный университет Минас-Жерайс, Белу-Оризонти, Бразилия

7 Кафедра клинических и токсикологических анализов, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

Паулу Маркос Матта Гуэдес

3 Кафедра микробиологии и паразитологии, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

Игорь К.Алмейда, редактор

1 Департамент паразитологии Федерального университета Минас-Жерайс, Белу-Оризонти, Бразилия

2 Университет Потигуар, Натал, Бразилия

3 Кафедра микробиологии и паразитологии, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

4 Департамент биомедицинских наук, Университет штата Риу-Гранди-ду-Норти, Мосоро, Бразилия

5 Кафедра патологии, Федеральный университет Минас-Жерайс, Белу-Оризонти, Бразилия

6 Кафедра клеточной и молекулярной биологии и патогенных биоагентов, Медицинская школа Рибейран-Прету, Университет Сан-Паулу, Рибейран-Прету, Бразилия

7 Департамент клинических и токсикологических анализов, Федеральный университет Риу-Гранди-ду-Норти, Натал, Бразилия

Техасский университет в Эль-Пасо, СОЕДИНЕННЫЕ ШТАТЫ

Авторы заявили об отсутствии конкурирующих интересов.

Поступило 18.03.2020 г .; Принято 3 августа 2020 г.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника. другими статьями в PMC.

Abstract

Пищеварительная и кардиодигестивная формы болезни Шагаса наблюдаются у 2–27% пациентов, в зависимости от их географического положения, штамма Trypanosoma cruzi и иммунопатологических реакций.Целью данной работы было оценить роль рецептора врожденного иммунитета NOD2 в патогенезе пищеварительной системы при болезни Шагаса. Пациенты с пищеварительной формой заболевания показали более низкую экспрессию мРНК NOD2, более высокую экспрессию RIP2 и α-дефенсина 6 по сравнению с неопределенной формой, обнаруженной с помощью ПЦР в реальном времени в мононуклеарных клетках периферической крови. Кроме того, у этих пациентов наблюдалась отрицательная корреляция между экспрессией NOD2 и степенью расширения пищевода, сигмовидной и прямой кишки.Инфицирование мышей NOD2 - / - с помощью T . Штамм cruzi , выделенный от пациента с пищеварением, вызывал снижение перистальтики кишечника. Гистопатологический анализ толстой кишки и тощей кишки животных NOD2 - / - и C57BL / 6 дикого типа выявил дискретные воспалительные очаги во время острой фазы инфекции. Интересно, что во время хронической фазы инфекции воспаление и гипертрофия продольного и кругового мышечного слоя более выражены в толстой и тощей кишке у животных NOD2 - / - по сравнению с мышами C57BL / 6 дикого типа.В совокупности наши результаты предполагают, что NOD2 играет защитную роль против развития пищеварительной формы болезни Шагаса.

Об авторе

Болезнь Шагаса вызывается простейшими Trypanosoma cruzi , во время хронической фазы инфекции у 2–27% пациентов развивается пищеварительная форма болезни (мегаэзофагус и мегаколон), что способствует заболеваемости и смертности пациентов, вызывая расходы на услуги общественного здравоохранения, особенно сильно влияющие на качество жизни пациентов.Хотя известно, что многие факторы, присущие паразиту (тропизм, генетика, вирулентность и антигенность), хозяину (возраст, пол, статус питания, генетика и иммунный ответ) и географическое распространение, могут влиять на развитие различных клинических форм болезни Шагаса, точный механизм, который приводит к развитию мегаколона и мегаэзофагуса, неизвестен. Здесь мы показали, что пациенты с пищеварительной формой болезни Шагаса не экспрессируют рецептор врожденного иммунитета NOD2. Путем изоляции паразита от пациента с пищеварением и заражения мышей с дефицитом NOD2 мы наблюдали снижение перистальтики кишечника, хроническое развитие толщины стенки толстой кишки и тощей кишки, связанное с увеличением воспалительных медиаторов в органе, по сравнению с животными дикого типа.Наши результаты показывают, что рецептор NOD2 защищает от развития пищеварительной формы болезни Шагаса и может использоваться в качестве биомаркера развития желудочно-кишечных изменений во время T . cruzi инфекции у пациентов.

Введение

Болезнь Шагаса вызывается Trypanosoma cruzi и поражает 6–7 миллионов человек, главным образом в Латинской Америке [1]. Хронически инфицированные пациенты могут протекать бессимптомно (39–78%), что характеризует неопределенную хроническую форму заболевания, или развивать сердечную (17–50%), пищеварительную (3–27%) или кардиодигестивную (2–11%) формы.При пищеварительной форме заболевания в основном поражаются пищевод и толстая кишка, вследствие поражений интрамуральной кишечной нервной системы, тканевого паразитизма и хронического воспаления, приводящих к появлению мегаэзофагуса и мегаколона соответственно [2–13].

Патологические изменения мегаколона и мегаэзофагуса включают гипертрофию циркулярного мышечного слоя, очаговые воспалительные реакции в области миэнтериального сплетения и в мышечном слое, а также фиброз кишечного сплетения [14].Мегаэзофагус и мегаколон образуются, когда денервация миэнтериального сплетения превышает критический уровень, по крайней мере, 85% и 50% соответственно [15-17]. Предполагается, что гладкие мышцы чувствительны к различным раздражителям, и отсутствие сдерживающего действия мышечно-кишечного сплетения сделало бы гладкие мышцы гиперактивными, беспорядочно сокращаясь, что также могло бы привести к гипертрофии стенки, изменяющей моторику нескольких сегментов пищеварительного тракта, в том числе особенно пищевод и толстую кишку [18–20].В моделях мышей провоспалительные цитокины, такие как IL-12, IFN-γ и TNF-α, ответственны за индукцию экспрессии индуцибельной синтазы оксида азота (iNOS) и выработку оксида азота (NO) макрофагами, что способствует нейротоксическим эффектам заболевания. [21–25]. Денервация происходит нерегулярно и с переменной интенсивностью из-за факторов, связанных с паразитом и хозяином, которые еще полностью не выяснены [26, 27].

В нашей группе было продемонстрировано повышение экспрессии TLR8 и IFN-β в мононуклеарных клетках периферической крови пациентов с пищеварительной и кардиодигестивной формой заболевания [28].Активация TLR приводит к активации NF-κB и продукции медиаторов воспаления, таких как про-IL1β, про-IL-18, IL-6, IL-12 и TNF-α [29]. Этот воспалительный процесс вносит свой вклад в механизм сокращения нейронов тонкой кишки, приводящий к образованию мегаколонов и мегаэзофагов [30]. При болезни Крона и язвенном колите повышается экспрессия TLR8 и воспалительных цитокинов, таких как интерферон I типа, IL-1β, IL-6, IL-12 и TNF-α [31–34]. Более того, несколько исследований продемонстрировали, что предрасположенность к воспалительным заболеваниям кишечника связана с дефицитом NOD2 [35–39], что привело нас к исследованию роли NOD2 в развитии морфологических воспалительных изменений пищеварительной системы при болезни Шагаса. .

Молекула NOD2 является рецептором врожденного иммунитета, экспрессируется в цитоплазме макрофагов, дендритных клеток и клеток Панета, где она поддерживает гомеостаз кишечника, связывая в основном мурамилдипептид (MDP), присутствующий во всех типах бактерий [37, 38], и индуцирование продукции антимикробных пептидов, таких как α-дефенсины (5 и 6), посредством передачи сигналов RIP2. Фактически, отсутствие NOD2 у мышей и пациентов ведет к присутствию потенциально инвазивных бактерий, вызывая более частые поражения в пищеварительном эпителиальном тракте, чем те, которые имеют нормальную экспрессию NOD2 [40–43].

Хотя исследования продемонстрировали важность воспаления и присутствия паразита в пищеводе и толстой кишке в патофизиологическом процессе образования мегаколона и мегаэзофагуса у пациентов с хронической чагазовой болезнью [14, 44–46], механизм, с помощью которого у некоторых пациентов развивается анатомопатологические изменения неясны. В этом исследовании мы продемонстрировали важность рецептора NOD2 в защите от воспалительного компонента пищеварительной формы болезни Шагаса.Лучшее понимание патофизиологических механизмов, вовлеченных в генез мегаэзофагуса и мегаколона, может привести к снижению заболеваемости и смертности, связанных с пищеварительной формой болезни Шагаса.

Методы

Заявление об этике

Все пациенты, включенные в это исследование, подписали письменную форму информированного согласия. Исследование проводилось в соответствии с руководящими принципами проведения экспериментов на людях Министерства здравоохранения Бразилии (резолюция 466/12-CNS / MS) и Хельсинкской декларацией.Это исследование было одобрено Комитетом по этике и исследованиям Государственного университета Риу-Гранди-ду-Норти (UERN) протоколом № 027.2011 и Сертификатом Национальной системы этики в исследованиях (CAEE-SISNEP) с номером протокола 0021.0.428.000–11. .

Все процедуры и протоколы экспериментов с животными были проведены в соответствии с директивами Бразильского колледжа экспериментов на животных (COBEA). Протокол экспериментов на животных был одобрен Комитетом по этике использования животных (CEUA) Федерального университета Риу-Гранди-ду-Норти (UFRN), протокол No.23/2015.

Популяция пациентов

Популяция состояла из 80 человек в возрасте от 18 до 79 лет. Население было выбрано из 10 муниципалитетов в штате Риу-Гранди-ду-Норти в Бразилии: Александрия, Аподи, Караубас, Говернадор Дикс-Септ Росадо, Ипангуасу, Мосоро, Пенденсиас, Родольфо Фернандес, Серра-ду-Мел и Севериано Мело. Все пациенты прошли серологический скрининг на T . cruzi анализ на инфекцию. Непрямая гемагглютинация (Chagatest), рекомбинантный ELISA (Wiener Lab, Росарио, Аргентина) и реакция непрямой иммунофлуоресценции в доме с эпимастиготами T . cruzi штамм Y [47]. Образцы с неубедительными результатами были отправлены на подтверждающую серологию вестерн-блоттинга (TESAcruzi, BioMérieux, Бразилия) [48]. В соответствии с рекомендациями Всемирной организации здравоохранения и Бразильским консенсусом по болезни Шагаса [5] результаты считались положительными, если образец был реактивным по крайней мере в двух из выбранных методов.

Положительные пациенты были клинически оценены, и клинические формы были охарактеризованы с помощью электрокардиограммы (ЭКГ), двумерной трансторакальной эхокардиографии, рентгенографии грудной клетки и контрастирования пищевода и толстой кишки (непрозрачная клизма).Контрастная рентгенография пищевода выполнялась в правом переднем косом положении с использованием сульфата бария (Bariogel, Cristália Laboratory, Бразилия). Изменения пищевода были классифицированы по четырем уровням: I) неизменный калибр, незаметная задержка контраста; II) небольшое / умеренное увеличение калибра, сохранения контраста и третичных волн; III) увеличение калибра, гипотония, плохая двигательная активность и сильное сохранение рентгенологического контраста; IV) удлиненный пищевод, лежащий над диафрагмой с большим сохранением рентгенологического контраста - долико-мегаэзофагус [49].Рентгенограммы толстой кишки с контрастированием выполнялись в положении лежа на спине, вентрально и справа на боковой поверхности с использованием раствора сульфата бария через прямую кишку без предварительной подготовки кишечника или двойного контрастирования [50]. Диаметр прямой кишки измеряли в правом боковом положении лежа, а сигмовидную кишку измеряли в положении лежа на спине или, при необходимости, в положении вентрального положения лежа [7, 51].

Пациенты с электрокардиографическими и / или эхокардиографическими изменениями, свидетельствующими о шагасовой кардиомиопатии, были обследованы Холтером 24 часа.Таким образом, бессимптомные пациенты с сахарным диабетом, которые представили электрокардиограммы, рентгенограммы грудной клетки и нормальные контрасты пищевода и толстой кишки, были отнесены к категории с неопределенной клинической формой (IND, n = 18). Пациенты, у которых были выявлены электрокардиографические аномалии, указывающие на поражение сердца, симптоматические или нет, и / или кардиомегалию на рентгенограмме грудной клетки, были классифицированы как кардиологические (CARD, n = 17). Пациенты с измененными изображениями пищевода и / или толстой кишки (DIG, n = 15) и пациенты с кардиомиопатией, связанной с мегаколоном и / или мегаэзофагусом, с кардиодигестивной формой (CARDIG, n = 15).В качестве контроля использовали пятнадцать здоровых лиц аналогичного возраста. Данные, характеризующие чагасскую популяцию, представлены в.

Таблица 1

Клинические характеристики пациентов с хроническим чагасом из штата Риу-Гранди-ду-Норти, включенных в это исследование.

9028 905 905 905 905 905 905 905 (44.4%) 905 5 ​​ 905 0/17 Echocard 905 индекс (г / м 2 поверхность тела ± стандартное отклонение) 5,8
Неопределенный Сердечный Пищеварительный Кардиодигестивный Всего
Пол 6/17 (35,2%) 10/15 (67,7%) 5/15 (33,3%) 29/65 (40%)
Мужской 10/18 ( 55,5%) 11/17 (64,8%) 55/15 (33,3%) 10/15 (67,7%) 36/65 (60%)
Возраст (лет ± стандартное отклонение) 41,4 ± 10,7 49,7 ± 11,8 57,6 ± 8,9 65,9 ± 10,6 53,3 ± 10,2
Рентгенография грудной клетки 0/18 (0%) 5/17 (29.4%) 0/15 (0%) 5/15 (33,4%) 10/65 (15,4%)
Кардиоторакальный индекс (боковой диаметр сердца / боковой диаметр грудной клетки ± SD) 0,43 ± 0,05 0,48 ± 0,05 0,50 ± 0,05 0,42 ± 0,03 NA
Контрастная рентгенография
15/8 9 (53.3%) 9/15 (60%) 17/65 (26,1%)
Мегаэзофаг 0/18 0/17 3/15 (20%) 3/15 (20%) 6/65 (9,3%)
Мегаклон + Мегаэзофагус 0/18 0/17 3/15 (20%) 4/15 (26,6%) 7/65 (10,7%)
Размер сигмовидной кишки (см ± стандартное отклонение) 4,41 ± 0,57 4,5 ± 0,71 7,72 ± 4,6 7.96 ± 2,87 NA
Размер прямой кишки (см ± стандартное отклонение) 4,89 ± 0,81 5,72 ± 0,89 7,5 ± 31 6,36 ± 1,89 NA
Фракция выброса левого желудочка (% ± SD) 64,6 ± 3,42 55,8 ± 14,96 56,2 ± 13,84 65,0 ± 6,420 NA 97.6 ± 21,6 100,6 ± 19,8 126,5 ± 54,4 95,9 ± 16,8 NA
Диастолический диаметр левого желудочка (мм ± SD) 49,4 ± 2,9 50,6 ± 6,8 47,6 ± 3,6 NA
Аневризма левого желудочка 0/18 (0%) 3/17 (17,7%) 1/15 (6,7%) 4/15 (26,7%) 8/65 (12,3%)
Электрокардиограмма
Блок правой ветви 0/18 (0%)5%) 4/15 (26,8%) 0/15 (0%) NA
Блок левой ветви 0/18 (0%) 1/17 (5,9%) 1/15 (6,7%) 0/15 (0%) NA
Передневерхний отделенный блок 0/18 (0%) 4/17 (23,6%) 3/15 (20,1%) 0/15 (0%) NA
Атриовентрикулярная блокада 1/18 (5,6%) 3/17 (17.7%) 2/15 (13,4%) 1/15 (6,7%) NA
Наджелудочковые экстрасистолы 1/18 (5,6%) 1/17 (5,9%) 1/15 (6,7%) 0/15 (0%) NA
Желудочковые экстрасистолы 0/18 (0%) 3/17 (17,7%) 4/15 (26,8 %) 0/15 (0%) NA
Изменение реполяризации желудочков 1/18 (5,6%) 3/17 (17.7%) 1/15 (6,7%) 1/15 (6,7%) NA
Низкое напряжение QRS 0/18 (0%) 8/17 (47,2%) ) 1/15 (6,7%) 2/15 (13,4%) NA

Экспериментальная инфекция паразитов и мышей

Изолят RN25 T . cruzi , получен из гемокультуры проф. Antonia C.J. Câmara в 2013 г. от 65-летнего пациента с хронической пищеварительной формой из города Серра-Негра-ду-Норти, штат Риу-Гранди-ду-Норти, Бразилия [52].Это та же область, где мы набирали пациентов, включенных в это исследование. К сожалению, этот пациент умер из-за осложнений во время операции по удалению части толстой кишки в 2013 году, до начала этого исследования.

Нокауты по специфическим свободным от патогенов NOD2 (NOD2 - / - ) [53] и их контрольные самки дикого типа C57BL / 6 (WT) в возрасте шести недель и массой 20-25 г были получены из Центра специального разведения мышей. в Медицинской школе Рибейран-Прету (FMRP-USP). Мышей содержали в экспериментальной биотерии Центра медицинских наук Федерального университета Риу-Гранди-ду-Норти, содержали в той же комнате при контролируемой температуре (25 ° C) и с 12-часовым циклом свет / темнота.Животных содержали в отдельных клетках, но в одних и тех же вентилируемых стойках с фильтрованным воздухом, стерильной водой и кормом ad libitum . Эти животные были подвергнуты воздействию тех же бактерий окружающей среды.

Животных внутрибрюшинно инокулировали 1 × 10 3 трипомастигот изолята RN25 (TcII) [52]. Мышей умерщвляли в острой фазе (19 день после заражения, пик паразитемии) или в хронической фазе (через 12 месяцев после заражения).

Паразитемия, выживаемость и перистальтика желудочно-кишечного тракта

Паразитемия определялась методом, описанным Пицци [54] в модификации Бренера [55]. Пять микролитров крови были собраны с кончика хвоста, и подсчет проводился под оптическим микроскопом (400 ×) с использованием пластинок (22 × 22 мм) в 50 случайных полях. Смертность оценивали ежедневно. Периодичность кишечника животных анализировали через 0, 15, 30, 90, 180 и 360 дней после заражения. Вкратце, через три часа после голодания 0.3 мл 10% водной суспензии древесного угля в воде вводили перорально через желудочный зонд. За животными наблюдали с 5-минутными интервалами до удаления фекалий с древесным углем (максимальное время наблюдения 450 минут) [56, 57]. Для этих экспериментов использовали десять животных из каждой группы, результаты были рассчитаны на основе времени эвакуации и выражены как среднее значение ± стандартное отклонение (SD).

Количественная оценка медиаторов воспаления с помощью ПЦР в реальном времени.

РНК экстрагировали из мононуклеарных клеток периферической крови (PBMC) пациентов и контрольной группы.У мышей РНК экстрагировали из толстой кишки в острой и хронической фазах (19 день и 12 месяцев после заражения, соответственно). РНК очищали с использованием набора Total RNA Isolation System (Promega, США), Trizol Reagent (Invitrogen, США) и обработки ДНКазой. Очищенную РНК хранили при -80 ° C. Концентрацию и качество РНК анализировали с помощью Nanodrop 2000 (Thermo Scientific, США). кДНК синтезировали из 2 мкг тотальной РНК с использованием набора для обратной транскрипции кДНК High Capacity (Applied Biosystems, США).Циклы реакции составляли 10 минут при 25 ° C, 120 минут при 37 ° C, 5 минут при 85 ° C и бесконечные при 4 ° C. ПЦР-реакции проводили с использованием системы SYBR Green в термоциклере 7500 Fast Real time (Applied Biosystems, США). Стандартные условия ПЦР в реальном времени были следующими: 50 ° C (2 мин) и 95 ° C (10 мин), затем 40 циклов 94 ° C (30 с), переменная температура праймера отжига () (30 с) и 72 ° C (1 мин). Праймеры, специфичные для человека (NOD1, NOD2, RIP2, α-дефенсин 5 и α-дефенсин 6) и мыши (TLR2, TLR4, IL-10, IL-17, T-bet, TNF-α, IFN-γ, iNOS, дефенсин-A) описаны в.Уровни экспрессии мРНК определяли с использованием средних значений Ct из трех измерений для расчета относительных уровней экспрессии генов-мишеней у больных сахарным диабетом или инфицированных мышей по сравнению с уровнями экспрессии у здоровых субъектов или неинфицированных мышей, соответственно, и нормализовали по домашнему хозяйству. ген β-актина (человека) и GAPDH (мышь) с использованием формулы 2 –ΔΔCt . Протокол эксперимента кПЦР был описан в предыдущей работе [28].

Таблица 2

Последовательности праймеров, используемых для реакций RT-PCR.

Мишени Смысловые и антисмысловые последовательности Температура отжига праймеров
Hu- β-actin 1 TGACTCAGGATTTAAGAGODGATTTAA

9027 CACTCAGGATTTAAAGAACTGATTTTAA 9027 9027

9027 CGATTAAGAACTGA

GTGGACAACTTGCTGAAGAATGAC
CTGTACCAGGTCCAGAATTTTGC
60,2 ° C
NOD2 1 GCCACGGTGAAAGCAGAT 9097AGAC 59GAC5.6
RIP2 1 TGCCACCTGAAAACT-ATGAACCT
ACACTTCCCATGTGATAACTGCAT
58,4
α-дефензин 5 1 GCCATCCTTGCTGCCATT
GCTTCTGGGTTGTAGCCTCATC
59,6
α-дефензин 6 1 CCACTCCAAGCTGAGGAT
CTCTGCAAAGGAGACGGC
58,4
GAPDH 2 TGCAGTGGCAAAGTGGAAGAT
CGTCGAGTG5GAG 28.8
TLR2 2 CGAGTGGTGCAAGTACG
GGTAGGTCTTGGTGTTCATTATC
57,7
TLR4 2 CCTCTGCCTTCACTACAGAGACTTT
GGATCATTTCCGATAAGGCT
60,9
ИЛ-10 2 TGGACAACATACTGCTAACC
GGATCATTTCCGATAAGGCT
55,7
IL-17 2 AGTTTGGGACCCCTTTACAC
TCTCATCCAGCAAGAGATCC
57.8
Т-бет 2 CCCACAAGCCATTACAGGATG
TATAAGCGGTTCCCTGGCATG
59,9
ФНО-α 2 TGTGCTCAGAGCTTTCAACAA
CTTGATGGTGGTGCATGAGA
56,9
ИФН-γ 2 GCATCTTGGCTTTGCAGCT
CCTTTTTCGCCTTGCTGTTG
57,6
iNOS 2 CGAAACGCTTCACTTCCAA
TGAGCCTATATTGCTGTGGCT
56.7
Дефенсин A 2 GGTGATCAGCATACCCCAGCATCAGT
AAGAGAAAACTACTGAGGAGCAGC
57,5 ​​
Гистопатологический анализ содержимого кишечника в кишечнике животных был помещен в кишечный тракт и подвергнут гистопатологическому анализу . в течение 10 минут для предварительной фиксации, как описано Arantes & Nogueira [58]. Кусочки скатывали и фиксировали в 10% -ном формоле, разбавленном PBS, в течение 24 часов.Рулоны обычно обрабатывали и заливали парафином. Срезы размером 4 мкм получали микротомией и помещали на предметные стекла для окрашивания гематоксилином и эозином (HE). Слайды были проанализированы и изображения сфотографированы с использованием оптического микроскопа (Olympus BX 51), оснащенного программным обеспечением Image-Pro Express 4.0 (Media Cybernetics, MO, USA). Изображения анализировали в программе KS300 (Zeiss, Jena, Germany) для определения толщины тощей кишки и мышечного слоя толстой кишки (мкм). Мы получили среднее значение трех измерений для каждого из 15 изображений, полученных с объективом 20 × от каждого животного.Полуколичественный анализ был проведен для определения воспаления и паразитизма в ткани толстой кишки C57BL / 6 и NOD2 - / - в острой (19 дней после заражения) и хронической (через 12 месяцев после заражения) фазах. Общее количество воспалительных очагов (характеризуемых наличием не менее 10 воспалительных клеток) и гнезд амастигот в слое кишечных мышц количественно оценивали в 30 полях (увеличение 200 ×) от каждого животного с помощью оптического микроскопа (Olympus BX51). Шесть животных из каждой группы были использованы для гистопатологии и экспериментов ПЦР.

Статистический анализ

Все анализы были выполнены с использованием программного обеспечения PRISM 9.0 (GraphPad, Сан-Диего, Калифорния, США). Для проверки распределения данных использовались тесты Агостино-Пирсона и Колмогорова-Смирнова. Для проверки различий между группами с нормальным распределением были выполнены тесты ANOVA и Tukey-Kramer, в выборках с непараметрическим распределением использовался тест Краскалла-Уоллиса и Даннса. Корреляции анализируемых параметров у пациентов определяли с помощью теста Спирмена.Различия считались достоверными при р <0,05.

Результаты

Пищеварительная форма болезни Шагаса коррелирует с недостаточной экспрессией NOD2 у пациентов

Пациенты с болезнью Шагаса (n = 65) были классифицированы как неопределенные (n = 18), сердечные (n = 17), пищеварительные (n = 15) и кардиодигестивные (n = 15) клинические формы по данным электрокардиограммы (ЭКГ), двумерной трансторакальной эхокардиографии, рентгенографии грудной клетки и контрастированного анализа пищевода и толстой кишки (непрозрачная клизма) ().С целью анализа уровня экспрессии внутриклеточных рецепторов NOD1 e NOD2, его адапторной молекулы и индуцированных продуктов была проведена ПЦР в реальном времени в образцах PBMC от всех групп пациентов. Пациенты с болезнью Шагаса с неопределенными, сердечными, пищеварительными и кардиодигестивными клиническими формами заболевания имели сходную экспрессию мРНК NOD1 (). С другой стороны, пациенты с пищеварительной и кардиодигестивной формами показали отсутствие или резко сниженную экспрессию мРНК NOD2 по сравнению с пациентами с неопределенной и сердечной формами (2).Любопытно, что эти же пациенты экспрессировали более высокие уровни мРНК RIP2 по сравнению с неопределенными пациентами и пациентами с сердечной болезнью Шагаса (). Кроме того, экспрессия мРНК α-дефенсина 6 выше у пациентов с пищеварительной системой, чем у пациентов с неопределенным диагнозом, у которых наблюдались те же уровни, что и у пациентов с сердечными и кардиодиагестивными заболеваниями (2). Все проанализированные группы имели сходную экспрессию транскриптов α-дефенсина 5 ().

Пациенты с пищеварительной формой болезни Шагаса показали низкую экспрессию NOD2 и высокую экспрессию RIP2 и α-дефенсина 6.

Уровни экспрессии мРНК NOD1 (A), NOD2 (B), RIP2 (C), α-дефенсина 6 (D) и α-дефенсина 5 (E) определяли с помощью ПЦР в реальном времени в мононуклеарных клетках периферической крови пациенты с неопределенными (n = 18), сердечными (n = 17), кардиодигестивными (n = 15) и пищеварительными (n = 15) клиническими формами болезни Шагаса.Уровни экспрессии были нормализованы до уровня экспрессии β-актина. Результаты выражаются как среднее значение ± стандартная ошибка. * р <0,05; ** р <0,01. Пунктирные линии представляют неинфицированных контрольных лиц (UCI, n = 15).

Пациенты с пищеварительной и кардиодигестивной системой имели расширение пищевода, размер сигмовидной кишки и размер прямой кишки, измеренные с помощью контрастирования пищевода и толстой кишки (непрозрачная клизма). Отрицательная корреляция наблюдалась между экспрессией мРНК NOD2 и степенью дилатации пищевода (R = -0.7978; p = 0,0044) (), размер сигмовидной кишки (R = -0,6109; p = 0,0177) () и размер прямой кишки (R = -0,6365; p = 0,0166) () у этих пациентов. В совокупности данные указывают на то, что дефицит экспрессии NOD2 обнаруживается у пациентов с сахарным диабетом с расширением пищевода, толстой и прямой кишки.

Экспрессия NOD2 отрицательно коррелирует со степенью дилатации пищевода, сигмовидной и прямой кишки.

Уровни экспрессии мРНК NOD2 определяли с помощью ПЦР в реальном времени в мононуклеарных клетках периферической крови пациентов с пищеварительной и кардиодигестивной клиническими формами болезни Шагаса и коррелировали со степенью мегаэзофагуса (n = 13) (A), сигмоид. размер (n = 17) (B) и размер прямой кишки (n = 17) (C). Уровни экспрессии мРНК были нормализованы до уровня экспрессии β-актина. Использовался тест Спирмена.

NOD2

- / - мышей имеет сниженную перистальтику кишечника и гипертрофию тощей и толстой кишки во время хронической фазы T . cruzi инфекция

Для анализа роли рецептора NOD2 в развитии поражения желудочно-кишечного тракта во время T . cruzi , мы воспользовались экспериментальной моделью на трансгенных мышах.РН25 Т . cruzi , выделенный от пациента с пищеварительной формой болезни Шагаса в предыдущей работе [52], был инокулирован мышам с дефицитом NOD2 в попытке воспроизвести желудочно-кишечные изменения, наблюдаемые у пациентов с пищеварительной клинической формой. Мышей C57BL / 6 использовали в качестве контроля дикого типа (WT). Оценивались паразитемия, выживаемость и перистальтика желудочно-кишечного тракта. У мышей NOD2 - / - паразитемия была выше, чем у животных C57BL / 6, между 21 и 30 днем ​​после заражения ().Патентная паразитемия наблюдалась до 40 и 50 дней у мышей, инфицированных C57BL / 6 и NOD2 - / - , соответственно (). Однако 100% выживаемости наблюдали как у мышей NOD2 - / - , так и у мышей C57BL / 6, инфицированных T . Крузи . У мышей NOD2 - / - наблюдалось снижение перистальтики кишечника через 15, 180 и 360 дней после заражения по сравнению с животными C57BL / 6 (), что указывает на кишечные изменения.

NOD2 - / - мышей, инфицированных Trypanosoma cruzi , показали снижение перистальтики кишечника в острой и хронической фазах инфекции.

Паразитемия (A) и выживаемость (B) самок, мышей C57BL / 6 и NOD2 - / - , инфицированных внутрибрюшинным путем 10 3 трипомастиготных форм крови изолята RN25 (Tc-II) Trypanosoma cruzi . Подвижность желудочно-кишечного тракта оценивали по среднему времени выведения активированного угля у инфицированных и неинфицированных мышей C57BL / 6 и NOD2 - / - . Данные представляют 2 независимых эксперимента с n = 10; * р <0,05.

В попытке оценить тканевой паразитизм, воспаление и гипертрофию желудочно-кишечного тракта, гистопатологический анализ был проведен в WT и NOD2 - / - в острой (19 дней) и хронической (12 месяцев) фазах инфекции (рис. ).Инфекция у животных NOD2 - / - вызвала интенсивное очаговое воспаление в толстой кишке во время хронической фазы () по сравнению с мышами C57BL / 6 (). Тощая кишка была наиболее пораженной областью кишечника с интенсивным воспалением у мышей NOD2 - / - () по сравнению с мышами C57BL / 6 (). Воспалительный инфильтрат представляет собой преобладание мононуклеарных клеток, достигающих всей толщины мышечных слоев, иногда образующих клеточные тяжи между мышечными слоями и покрывающих ганглиозные элементы кишечной нервной системы.Толщина толстой кишки животных, инфицированных NOD2 - / - и C57BL / 6, была увеличена по сравнению с неинфицированными животными. Однако у мышей, инфицированных NOD2 - / - , наблюдалось более заметное увеличение толщины толстой кишки собственной мышцы, чем у инфицированных C57BL / 6 животных (). У неинфицированных мышей NOD2 - / - наблюдалось дискретное увеличение толщины стенки толстой кишки по сравнению с неинфицированными животными C57BL / 6 (). Инфицирование мышей паразитом, изолированным от пациента с пищеварительной формой заболевания, привело к увеличению толщины стенки тощей кишки у инфицированных мышей NOD2 - / - и C57BL / 6 по сравнению с неинфицированными контрольными мышами (), но толщина стенки jejunum у инфицированных NOD2 - / - животных была больше по сравнению с мышами, инфицированными C57BL / 6 ().Мыши C57BL / 6 и NOD2 - / - обнаруживают сходный паразитизм во время острой и хронической фаз инфекции (). В обеих группах паразитизм был выше в острой, чем в хронической фазе (). Полуколичественный анализ воспалительных очагов в фрагментах толстой кишки Т . cruzi -инфицированные мыши продемонстрировали, что у животных с дефицитом NOD2 наблюдается сильное воспаление в толстой кишке во время острой и хронической фаз по сравнению с животными C57BL / 6 (). Эти данные подчеркивают важность рецептора NOD2 в предотвращении развития изменений желудочно-кишечного тракта у T . cruzi -инфицированных мышей.

NOD2 - / - животных демонстрируют умеренное воспаление и увеличенную толщину продольного и циркулярного мышечного слоя в толстой кишке и тощей кишке во время хронической фазы инфекции.

Гистопатология толстой кишки (A, B, C, D, E, F) и тощей кишки (G, H, I, J, K, L) C57BL / 6 (A, B, C, G, H, I) и NOD2 - / - (D, E, F, J, K, L) самок мышей, не инфицированных и инфицированных внутрибрюшинно 10 3 трипомастиготными формами крови RN 25 (Tc-II) штамма Trypanosoma cruzi , являются изображение с увеличением 200 × (левый и средний столбец) и 400 × (правый столбец).Количественную оценку толщины толстой кишки (M) и толщины стенки тощей кишки (N) проводили у шести животных из каждой группы, умерщвленных через 12 месяцев. Масштабная линейка = 50 мкм. Стрелки = воспалительные очаги. Пунктирными линиями обозначена толщина мышечной стенки. Данные представляют два независимых эксперимента. Гистограммы представлены как среднее ± стандартное отклонение * p <0,05; ** р <0,01; *** р <0,001.

NOD2 - / - животных показали сходный паразитизм и усиление воспаления в толстой кишке в острой и хронической фазах.

Количественную оценку гнезд амастигот (A) и очагов воспаления (B) проводили путем подсчета 30 полей (200-кратное увеличение в оптическом микроскопе) на слайдах H&E толстой кишки инфицированных мышей C57BL / 6 и NOD2 - / - . Показаны острая (19 дней) и хроническая (12 месяцев) фазы. n = 6 для каждой группы. Данные представляют два независимых эксперимента и выражены как среднее ± стандартное отклонение. * р <0,05; ** р <0,01.

Снижение перистальтики кишечника и гипертрофия кишечника NOD2

- / - коррелирует с повышенными воспалительными маркерами в толстой кишке во время острой и хронической фаз

Иммунопатогенные механизмы, которые приводят к изменениям в желудочно-кишечном тракте, формировании мегаколонов и мегаэзофагов, зависят от наличие паразита, воспаление и денервация.Таким образом, экспрессия воспалительных маркеров, которые могут способствовать этому процессу, оценивалась во время острой и хронической фаз после T . cruzi инфекция. Оценка острой фазы показала повышенную экспрессию TLR-2, TLR-4, T-Bet, IFN-γ, iNOS, IL-10, TNF-α () и снижение экспрессии мРНК IL-17 и дефенсина-A () в толстая кишка Т . cruzi инфицированных животных по сравнению с неинфицированными мышами. Более того, мыши, инфицированные NOD2 - / - , показали более высокие уровни TLR-2, TLR-4, T-Bet, IFN-γ и iNOS (), чем животные C57BL / 6.Сходные уровни экспрессии мРНК IL-17 и дефенсина-A наблюдались у животных, инфицированных NOD2 - / - и C57BL / 6, во время острой фазы инфекции (). Во время хронической фазы мы наблюдали сходную экспрессию мРНК TLR2 и IL-10 () в толстой кишке NOD2 - / - и C57BL / 6 T . cruzi -инфицированных мышей. С другой стороны, наблюдалась повышенная экспрессия мРНК TLR-4, T-Bet, TNF-α, IFN-γ, IL-17, iNOS и дефенсина-A () в толстой кишке NOD2 - / - , когда по сравнению с мышами WT.Повышенная экспрессия медиаторов воспаления у мышей с дефицитом NOD2 и снижение уровня IL-10, возможно, способствует увеличению мускулатуры и появлению повреждений в толстой кишке. Мыши

NOD2 - / - показали высокую экспрессию воспалительных маркеров в толстой кишке во время острой фазы инфекции Trypanosoma cruzi .

Экспрессия TLR2 (A), TLR4 (B), T-bet (C), IFN-γ (D), iNOS (E), IL-10 (F), TNF-α (G), IL- 17 (H) и дефенсин-A (I) определяли с помощью ПЦР в реальном времени в толстой кишке мышей, инфицированных C57BL / 6 и NOD2 - / - , и умерщвляли через 19 дней после заражения.Данные представляют два независимых эксперимента и выражены как среднее ± стандартное отклонение. * р <0,05. Пунктирные линии представляют неинфицированных контрольных мышей (UCM). n = 6 для каждой группы. Мыши

NOD2 - / - показали высокую экспрессию воспалительных маркеров в толстой кишке во время хронической фазы инфекции Trypanosoma cruzi .

Экспрессия TLR2 (A), IL-10 (B), TLR4 (C), T-bet (D), TNF- (E), IFN-γ (F), IL-17 (G), iNOS (H) и дефенсин-A (I) определяли с помощью ПЦР в реальном времени в толстой кишке мышей, инфицированных C57BL / 6 и NOD2 - / - , и умерщвляли через 12 месяцев после заражения.Данные представляют два независимых эксперимента и выражены как среднее ± стандартное отклонение. * р <0,05. Пунктирные линии представляют неинфицированных контрольных мышей (UCM). n = 6 для каждой группы.

Обсуждение

Мы оценили роль рецептора NOD2 в генезе поражения желудочно-кишечного тракта во время экспериментальной инфекции с помощью T . cruzi и его участие в развитии пищеварительной клинической формы у пациентов с болезнью Шагаса. Результаты показывают, что дефицит экспрессии рецептора NOD2 коррелирует с появлением изменений в желудочно-кишечном тракте во время экспериментальной инфекции у мышей, а также с развитием пищеварительной клинической формы болезни Шагаса у пациентов.

Здесь мы наблюдали, что у пациентов с пищеварительной и кардиодигестивной формами болезни Шагаса наблюдается отсутствие или пониженная экспрессия мРНК NOD2. Мы также продемонстрировали отрицательную корреляцию между экспрессией мРНК NOD2 со степенью дилатации пищевода, размерами сигмовидной и прямой кишки. Эти результаты показывают, что молекула NOD2 играет защитную роль против развития поражений желудочно-кишечного тракта у пациентов с болезнью Шагаса. Рецептор NOD2 высоко экспрессируется в клетках Панета и отвечает за регуляцию кишечной микробиоты за счет продукции антимикробных компонентов, таких как дефенсины [29, 59].Недостаточная экспрессия NOD2 влияет на состав микробиоты, поскольку ее отсутствие приводит к увеличению количества патогенных бактерий в желудочно-кишечном тракте [60], а также участвует в развитии воспалительных заболеваний кишечника. У пациентов с болезнью Крона наблюдается изменение микробиоты кишечника с увеличением на Bacteroidetes , Proteobacteria и уменьшением на Firmicutes [61]. У пациентов с болезнью Шагаса с мегаэзофагусом и мегаколоном наблюдается повышенный рост бактерий в желудочно-кишечном тракте по сравнению с микробиотой здоровых людей [62, 63].Кроме того, у больных чагасом с пищеварительной формой больше бактерий с патогенным потенциалом, что положительно коррелирует с дилатацией пищевода [63].

В настоящем исследовании повышенная экспрессия α-дефенсина 6 наблюдалась у пациентов с пищеварительной формой по сравнению с неопределенными пациентами и пациентами с сердечными заболеваниями. Производство дефенсина стимулируется после контакта бактерий с эпителием пищеварительного тракта. Помимо пути NOD2, продукция α-дефенсина также может быть индуцирована с помощью Toll-подобных рецепторов (TLR) [64–69] в клетках Панета.Фактически, мы ранее продемонстрировали, что те же самые пациенты имеют интактную экспрессию транскриптов семейства TLR, сверхэкспрессию TLR8 у пациентов с пищеварением [28]. Дисбиоз микробиоты, наблюдаемый у пищеварительных больных с сахарным диабетом [62, 63, 70], может иметь решающее значение для повышенных уровней α-дефенсина в попытке сыграть свою роль за счет образования нанофибрилл, которые защищают слизистую оболочку кишечника от бактериальной инвазии [71–73]. Даже при отсутствии или пониженной экспрессии NOD2 у пациентов с пищеварением и кардиодигестацией мы показали, что его адапторная молекула RIP2 была сверхэкспрессирована у этих пациентов.Это может быть связано с компенсирующим механизмом или как следствие активации передачи сигналов NOD1 в попытке индуцировать продукцию цитокинов и NO для контроля T . cruzi [74]. Повышенная экспрессия RIP2 у пациентов с пищеварительной и кардиодигестивной процессами может усугубить этот путь, чтобы вызвать большую продукцию цитокинов и, следовательно, воспаление, которое способствует формированию мега-синдрома.

Другой особенностью, которая может способствовать образованию мегаколонов и мегаэзофагов, является тропизм паразитов к желудочно-кишечному тракту.Вместе с нарушением регуляции микробиоты и дефицитом NOD2 присутствие паразитов вызывает еще большее повреждение тканей и воспаление в эпителии кишечника и пищевода, что приводит к денервации и способствует развитию патологии органов. Таким образом, наши данные позволяют предположить, что рецептор NOD2 играет важную роль в защите от поражений пищеварительного тракта у больных чагасией. Важно отметить, что, как описано другими [7, 75–79], мы также наблюдали, что присутствие мегаколона более часто, чем наличие мегаэзофагуса у этих хронических больных с чагазом.На этот аспект влияет анатомия органа, потому что в пищеводе пищевое содержимое легче проходит под действием силы тяжести, тогда как в толстой и прямой кишке наблюдается естественная тенденция к застою. Кроме того, толстая и прямая кишки представляют большее количество и разнообразие бактерий, чем пищевод [80], что может способствовать усилению воспаления, денервации и дилатации, наблюдаемых в толстой и прямой кишке.

Чтобы подтвердить важность рецептора NOD2 в генезе поражений пищеварительного тракта при болезни Шагаса, развитие поражений желудочно-кишечного тракта оценивали на мышах с нокаутом NOD2, инфицированных Т . cruzi , полученный от пациента с пищеварением. Снижение перистальтики кишечника наблюдалось у мышей NOD2 - / - , что указывает на изменения в желудочно-кишечном тракте. Гистопатологический анализ толстой кишки продемонстрировал умеренное воспалительное поражение в субсерозном и мышечном слое, более выраженное у животных NOD2 - / - , чем у C57BL / 6, во время острой фазы инфекции. Повреждения в толстой кишке, вызванные T . cruzi во время экспериментального заражения в острой фазе включают паразитизм, дегенерацию и некроз мышечных волокон.За ними следуют внутримышечный фиброз, денервация и увеличение стенки толстой кишки при стойком очаговом и умеренном воспалении собственной мышечной ткани через 15 месяцев после инфицирования в хронической фазе [30]. NOD2 - / - животные показали более интенсивное очаговое воспаление в толстой кишке и стенке тощей кишки во время острой и хронической фаз инфекции, поражающее толщу мышечных слоев и ганглиозные элементы кишечной нервной системы. Эти результаты показывают, что заражение паразитом, изолированным от пациента с пищеварительной формой, вызывает прогрессирующее воспаление, распространяющееся очагами по всему желудочно-кишечному тракту, которые в целом вносят значительный вклад в процесс денервации в течение болезни.

Активация TLR2 и TLR4 с помощью GPI-якорей и гликоинозитолфосфолипидов, полученных из T . cruzi , соответственно, ведет активацию NFκβ, IL-12, IFN-γ, TNF-α, продукцию IL-17 и активацию iNOS [81–83]. Помимо того, что они важны для уничтожения паразита, когда их избыток, TNF-α, IFN-γ и iNOS способствуют дегенерации мышечно-кишечного сплетения во время T . cruzi экспериментальная инфекция [24]. Здесь мы продемонстрировали, что мышей с дефицитом NOD2 инфицированы T . cruzi , которые имеют увеличенный размер толстой кишки, продуцируют более высокие уровни этих медиаторов воспаления in situ по сравнению с животными WT. Интересно, что NOD2 является негативным регулятором передачи сигналов TLR2, и тогда дефицит NOD2 может приводить к продукции Th2-связанных цитокинов в среде, богатой TLR, такой как кишечник [84]. Фактически, мы наблюдали, что у мышей с дефицитом NOD2 наблюдалась высокая экспрессия TLR2 и медиаторов воспаления во время острой фазы инфекции.Эти характеристики указывают на центральную роль рецептора NOD2 в контроле кишечного гомеостаза и могут объяснить усиление длительного воспаления, которое является субстратом денервации миентерального сплетения и обострения мышечной гипертрофии, вызванной T . В исследовании использован штамм cruzi с тропизмом желудочно-кишечного тракта. Скорее всего, и паразитарный тропизм, и хроническое воспаление влияют на повреждение желудочно-кишечного тракта.

В совокупности наши результаты показывают, что дефицит экспрессии NOD2 связан с T .Штамм cruzi , вызывающий стойкое воспаление кишечника, способствует нарушению гомеостаза пищеварительной системы, делая пациентов более восприимчивыми к развитию пищеварительной формы болезни Шагаса. Таким образом, можно предположить, что бактерии, присутствующие в микробиоте, способны преодолевать барьеры слизи и IgA, вступая в контакт с эпителиальным слоем пищеварительного тракта и вызывая или усиливая воспаление, вызванное паразитом, у пациентов с дефицитом NOD2. .Воспаление вызывает денервацию кишечного тракта, что приводит к нарушению моторики, нарушению координации движений и постепенной потере перистальтики [14, 46]. Кишечный тракт будет расширяться, и содержимое просвета инициирует сжатие внутренних органов, вызывая также ишемические патологии, которые усиливают процесс образования мегаэзофага и мегаколона [4, 15, 20, 45, 85]. Наконец, NOD2 является защитным фактором против развития пищеварительной формы болезни Шагаса, влияя на контроль паразитарно-индуцированного воспаления и гомеостаза микробиоты.

Отчет о финансировании

Эта работа была поддержана Conselho Nacional de Desenvolvimento Científico e Tecnológico (грант CNPq / MS / SCTIE / DECIT № 466698 / 2014-3, MCT / CNPq) и частично профинансирована Coordenação de Aperfei. Pessoal de Nível Superior - Бразилия (CAPES) - Финансовый кодекс 001. Автор (PMMG) получает стипендию от Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Доступность данных

Все соответствующие данные находятся в рукописи и ее файлах с вспомогательной информацией.

Список литературы

2. Андраде З. Патология да доэнса де Шагас В: Brener Z; Андраде З.А. Trypanosoma cruzi e doença de Chagas. Рио-де-Жанейро: Гуанабара Куган; 2000: 31. [Google Scholar] 3. Rezende JMH. Forma digestiva da doença de Chagas In: Brener Z; Андраде З. Trypanosoma cruzi e doença de Chagas. Гуанабара Куган; 2000: 47. [Google Scholar] 4. Расси А. мл., Расси А., Марин-Нето Я.Болезнь Шагаса. Ланцет. 2010. 375 (9723): 1388–402. Epub 2010/04/20. 10.1016 / S0140-6736 (10) 60061-X. [PubMed] [CrossRef] [Google Scholar] 5. Диас Дж. К., Рамос А. Н. мл., Гонтиджо Э. Д., Лукетти А., Шиканаи-Ясуда М. А., Коура Дж. Р. и др. 2-й Бразильский консенсус по болезни Шагаса, 2015 г. Rev Soc Bras Med Trop. 2016; 49Приложение 1 (Дополнение 1): 3–60. Epub 2016/12/17. 10.1590 / 0037-8682-0505-2016. [PubMed] [CrossRef] [Google Scholar] 6. Бренье С.Ф., Карраско Р., Револло С., Апарисио Г., Дежо П., Тибайренк М. Болезнь Шагаса в Боливии: клинические и эпидемиологические особенности и вариабельность зимодемы штаммов Trypanosoma cruzi, выделенных от пациентов.Am J Trop Med Hyg. 1989. 41 (5): 521–9. Epub 1989/11/01. 10.4269 / ajtmh.1989.41.521. [PubMed] [CrossRef] [Google Scholar] 7. de Andrade CM, Camara AC, Nunes DF, Guedes PM, Pereira WO, Chiari E, et al. Болезнь Шагаса: профиль заболеваемости в эндемичном районе северо-востока Бразилии. Rev Soc Bras Med Trop. 2015; 48 (6): 706–15. Epub 2015/12/18. 10.1590 / 0037-8682-0235-2015. [PubMed] [CrossRef] [Google Scholar] 8. Перес-Аяла А., Перес-Молина Дж. А., Норман Ф., Наварро М., Монж-Майо Б., Диас-Менендес М. и др. Болезнь Шагаса у мигрантов из Латинской Америки: проблема Испании.Clin Microbiol Infect. 2011. 17 (7): 1108–13. Epub 2010/11/16. 10.1111 / j.1469-0691.2010.03423.x. [PubMed] [CrossRef] [Google Scholar] 9. Сальвадор Ф., Тревино Б., Суллейро Э., Поу Д., Санчес-Монтальва А., Кабесос Дж. И др. Инфекция Trypanosoma cruzi в неэндемичной стране: эпидемиологический и клинический профиль. Clin Microbiol Infect. 2014. 20 (7): 706–12. Epub 2013/12/18. 10.1111 / 1469-0691.12443. [PubMed] [CrossRef] [Google Scholar] 10. del Sanchez-Guillen MC, Lopez-Colombo A, Ordonez-Toquero G, Gomez-Albino I, Ramos-Jimenez J, Torres-Rasgado E, et al.Клинические формы людей, инфицированных Trypanosoma cruzi, в хронической фазе болезни Шагаса в Пуэбла, Мексика. Mem Inst Oswaldo Cruz. 2006. 101 (7): 733–40. Epub 2006/12/13. 10.1590 / s0074-02762006000700005. [PubMed] [CrossRef] [Google Scholar] 11. Санчес-Монтальва А., Морис М., Мего М., Сальвадор Ф., Аккарино А., Рамирес К. и др. Манометрия пищевода высокого разрешения у пациентов с болезнью Шагаса: кросс-секционная оценка. PLoS Negl Trop Dis. 2016; 10 (2): e0004416 Epub 2016/02/06. 10.1371 / журнал.pntd.0004416. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 12. Муньос Дж., Гомес-и-Прат Дж., Гальего М., Гимено Ф., Тревино Б., Лопес-Чеджаде П. и др. Клинический профиль инфекции Trypanosoma cruzi в неэндемичных условиях: иммиграция и болезнь Шагаса в Барселоне (Испания). Acta Trop. 2009. 111 (1): 51–5. Epub 2009/05/12. 10.1016 / j.actatropica.2009.02.005. [PubMed] [CrossRef] [Google Scholar] 13. Coura JR, Anunziato N, Willcox HP. [Заболеваемость болезнью Шагаса. I - Изучение случаев, происходящих в различных штатах Бразилии, наблюдаемых в Рио-де-Жанейро].Mem Inst Oswaldo Cruz. 1983; 78 (3): 363–72. Epub 1983/07/01. 10.1590 / s0074-02761983000300012. [PubMed] [CrossRef] [Google Scholar] 14. Koberle F, De AF. [Механизм разрушения нейронов периферической нервной системы при болезни Чангаса]. Больница (Рио-Дж.). 1960; 57: 1057–62. Epub 1960/06/01. . [PubMed] [Google Scholar] 16. Koeberle G, Penha PD. [Мега-пищевод Шагаса. (Количественные исследования интрамуральной нервной системы пищевода). Z Tropenmed Parasitol. 1959; 10: 291–5. Epub 1959/11/01.. [PubMed] [Google Scholar] 17. Джабари С., да Силвейра А.Б., де Оливейра Э.С., Нето С.Г., Квинт К., Нойхубер В. и др. Частичное избирательное выживание нитрергических нейронов в шагасовом мегаколоне. Histochem Cell Biol. 2011. 135 (1): 47–57. Epub 2010/12/25. 10.1007 / s00418-010-0774-у. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Amorim MC-NA. Histopathologia e pathogenese do megaesôfago e megareto. Рассмотрим их торно де ум касо де «мал до engasgo». Анаис да Faculdade de Medicina da Universidade de São Paulo.1932; 8:27. [Google Scholar] 19. Koberle FNE. Etiologia e patogenia do megaesôfago no Brasil. Revista Paulista Medicina. 1955; 47: 18. [PubMed] [Google Scholar] 20. Тафури В.Л., Мария Т.А., Лопес ER. [Поражения миентерального сплетения пищевода, тощей кишки и толстой кишки у пациентов с хронической чагасией. Электронно-микроскопические исследования. Rev Inst Med Trop Сан-Паулу. 1971. 13 (2): 76–91. Epub 1971/03/01. . [PubMed] [Google Scholar] 21. Gazzinelli RT, Oswald IP, Hieny S, James SL, Sher A. Микробицидная активность макрофагов, обработанных интерфероном гамма, против Trypanosoma cruzi включает L-аргинин-зависимый, опосредованный оксидом азота механизм, ингибируемый интерлейкином-10 и трансформирующим фактором роста. -бета.Eur J Immunol. 1992. 22 (10): 2501–6. Epub 1992/10/01. 10.1002 / eji.1830221006. [PubMed] [CrossRef] [Google Scholar] 22. Pinto NX, Торрес-Хиллера MA, Mendoza E, Leon-Sarmiento FE. Иммунный ответ, оксид азота, вегетативная дисфункция и инсульт: загадочная связь с инфекцией Trypanosoma cruzi. Мед-гипотезы. 2002. 58 (5): 374–7. Epub 2002/06/12. 10.1054 / mehy.2001.1401. [PubMed] [CrossRef] [Google Scholar] 23. Гарсия С.Б., Паула Дж. С., Джованнетти Г. С., Зенха Ф., Рамальо Е. М., Зуколото С. и др. Оксид азота участвует в поражениях периферических вегетативных нейронов, наблюдаемых в острой фазе экспериментальной инфекции Trypanosoma cruzi.Exp Parasitol. 1999; 93 (4): 191–7. Epub 1999/12/22. 10.1006 / expr.1999.4451. [PubMed] [CrossRef] [Google Scholar] 24. Арантес Р.М., Марке Х.Х., Баия МТ, Кунья Ф.К., Росси М.А., Сильва Дж.С. Оксид азота, индуцированный гамма-интерфероном, вызывает внутреннюю денервацию кишечника у мышей, инфицированных Trypanosoma cruzi. Am J Pathol. 2004. 164 (4): 1361–8. Epub 2004/03/25. 10.1016 / с0002-9440 (10) 63222-1. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Алиберти Дж. К., Кардосо М. А., Мартинс Г. А., Газзинелли Р. Т., Виейра Л. К., Сильва Дж. С..Интерлейкин-12 опосредует устойчивость к Trypanosoma cruzi у мышей и продуцируется мышиными макрофагами в ответ на живые трипомастиготы. Infect Immun. 1996. 64 (6): 1961-7. Epub 1996/06/01. 10.1128 / IAI.64.6.1961-1967.1996. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 26. Тейшейра М.Л., Резенде Филхо Дж., Фигередо Ф., Тейшейра А.Р. Болезнь Шагаса: избирательное сродство и цитотоксичность трипаносомы cruzi-иммунных лимфоцитов к парасимпатическим ганглиозным клеткам. Mem Inst Oswaldo Cruz. 1980. 75 (3–4): 33–45.Epub 1980/07/01. 10.1590 / s0074-02761980000200004. [PubMed] [CrossRef] [Google Scholar] 27. Ribeiro dos S, Hudson L. Денервация и иммунный ответ у мышей, инфицированных Trypanosoma cruzi. Clin Exp Immunol. 1981; 44 (2): 349–54. Epub 1981/05/01. . [Бесплатная статья PMC] [PubMed] [Google Scholar] 28. Pereira NS, Queiroga TBD, Nunes DF, Andrade CM, Nascimento MSL, Do-Valle-Matta MA, et al. Избыточная экспрессия врожденных иммунных рецепторов коррелирует с хронической чаговой кардиомиопатией и повреждением пищеварительной системы у пациентов.PLoS Negl Trop Dis. 2018; 12 (7): e0006589 Epub 2018/07/26. 10.1371 / journal.pntd.0006589. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29. Франки Л., Уорнер Н., Виани К., Нуньес Г. Функция Nod-подобных рецепторов в распознавании микробов и защите хозяина. Immunol Rev.2009; 227 (1): 106–28. Epub 2009/01/06. 10.1111 / j.1600-065X.2008.00734.x. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30. Campos CF, Cangussu SD, Duz AL, Cartelle CT, de Noviello ML, Veloso VM, et al. Кишечное повреждение нейронов, внутримышечная денервация и изменения фенотипа гладких мышц как механизмы шагасного мегаколона: данные долгосрочной модели инфекции Trypanosoma cruzi на мышах.PLoS One. 2016; 11 (4): e0153038 Epub 2016/04/06. 10.1371 / journal.pone.0153038. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Сарута М., Тарган С.Р., Мей Л., Ипполити А.Ф., Тейлор К.Д., Роттер Д.И. Высокочастотные гаплотипы в локусе Х-хромосомы TLR8 связаны как с CD, так и с UC у женщин. Воспаление кишечника. 2009. 15 (3): 321–7. Epub 2008/10/24. 10.1002 / ibd.20754. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Steenholdt C, Andresen L, Pedersen G, Hansen A, Brynskov J. Экспрессия и функция toll-подобного рецептора 8 и Tollip в эпителиальных клетках толстой кишки у пациентов с воспалительным заболеванием кишечника.Сканд Дж Гастроэнтерол. 2009. 44 (2): 195–204. Epub 2008/11/06. 10.1080 / 00365520802495529. [PubMed] [CrossRef] [Google Scholar] 33. Санчес-Муньос Ф., Фонсека-Камарильо Г., Виледа-Рамирес М.А., Миранда-Перес Э., Мендивил Э. Дж., Баррето-Зунига Р. и др. Уровни транскрипции Toll-подобных рецепторов 5, 8 и 9 коррелируют с воспалительной активностью при язвенном колите. BMC Gastroenterol. 2011; 11: 138 Epub 2011/12/22. 10.1186 / 1471-230Х-11-138. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Ортис-Фернандес Л., Гарсия-Лозано-младший, Монтес-Кано М.А., Конде-Джалдон М., Лео Э., Ортего-Сентено Н. и др.Ассоциация гаплотипов локуса TLR8 с восприимчивостью к болезням Крона и Бехчета. Clin Exp Rheumatol. 2015; 33 (6 Suppl 94): S117–22. Epub 2015/10/22. . [PubMed] [Google Scholar] 35. Wehkamp J, Harder J, Weichenthal M, Schwab M, Schaffeler E, Schlee M и др. Мутации NOD2 (CARD15) при болезни Крона связаны со снижением экспрессии альфа-дефенсина слизистой оболочки. Кишечник. 2004. 53 (11): 1658–64. Epub 2004/10/14. 10.1136 / gut.2003.032805. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 36.Ганц Т, Лерер Р. Дефенсинс. Curr Opin Immunol. 1994. 6 (4): 584–9. Epub 1994/08/01. 10.1016 / 0952-7915 (94) -7. [PubMed] [CrossRef] [Google Scholar] 37. Огура Ю., Бонен Д.К., Инохара Н., Николае Д.Л., Чен Ф.Ф., Рамос Р. и др. Мутация сдвига рамки считывания в NOD2, связанная с восприимчивостью к болезни Крона. Природа. 2001. 411 (6837): 603–6. Epub 2001/06/01. 10.1038 / 35079114. [PubMed] [CrossRef] [Google Scholar] 38. Макдональд С., Инохара Н., Нуньес Г. Передача сигналов пептидогликана при врожденном иммунитете и воспалительных заболеваниях.J Biol Chem. 2005; 280 (21): 20177–80. Epub 2005/04/02. 10.1074 / jbc.R500001200. [PubMed] [CrossRef] [Google Scholar] 39. Хисамацу Т., Сузуки М., Райнекер Х.С., Надо В.Дж., Маккормик Б.А., Подольский Д.К. CARD15 / NOD2 действует как антибактериальный фактор в эпителиальных клетках кишечника человека. Гастроэнтерология. 2003. 124 (4): 993–1000. Epub 2003/04/03. 10.1053 / gast.2003.50153. [PubMed] [CrossRef] [Google Scholar] 40. Petnicki-Ocwieja T, Hrncir T, Liu YJ, Biswas A., Hudcovic T., Tlaskalova-Hogenova H, et al. Nod2 необходим для регуляции комменсальной микробиоты в кишечнике.Proc Natl Acad Sci U S. A. 2009; 106 (37): 15813–8. Epub 2009/10/07. 10.1073 / pnas.02106. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. de Souza PR, Guimaraes FR, Sales-Campos H, Bonfa G, Nardini V, Chica JEL и др. Отсутствие рецептора NOD2 предрасполагает к воспалению кишечника из-за нарушения регуляции иммунного ответа у хозяев, которые не могут контролировать дисбактериоз кишечника. Иммунобиология. 2018; 223 (10): 577–85. Epub 2018/07/26. 10.1016 / j.imbio.2018.07.003. [PubMed] [CrossRef] [Google Scholar] 42.Барних Н., Дарфей-Мишо А. Адгезивно-инвазивная кишечная палочка и болезнь Крона. Курр Опин Гастроэнтерол. 2007. 23 (1): 16–20. Epub 2006/11/30. 10.1097 / MOG.0b013e3280105a38. [PubMed] [CrossRef] [Google Scholar] 43. Sartor RB. Влияние микробов при воспалительных заболеваниях кишечника. Гастроэнтерология. 2008. 134 (2): 577–94. Epub 2008/02/05. 10.1053 / j.gastro.2007.11.059. [PubMed] [CrossRef] [Google Scholar] 44. Ваго А.Р., Андраде Л.О., Лейте А.А., д’Авила Рейс Д., Маседо А.М., Адад С.Дж. и др. Генетическая характеристика Trypanosoma cruzi непосредственно из тканей пациентов с хронической болезнью Шагаса: дифференциальное распределение генетических типов в различных органах.Am J Pathol. 2000. 156 (5): 1805–1809. Epub 2000/05/04. 10.1016 / с0002-9440 (10) 65052-3. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 45. Adad SJ, Andrade DCS, Lopes ER, Chapadeiro E. Contribuição ao estudo da anatomia patológica do megaesôfago chagásico. Rev Inst Med Trop Сан-Паулу 1991; 33: 8. [PubMed] [Google Scholar] 46. Коберле Ф. Болезнь Шагаса и синдромы Шагаса: патология американского трипаносомоза. Adv Parasitol. 1968; 6: 63–116. Epub 1968/01/01. 10.1016 / s0065-308x (08) 60472-8. [PubMed] [CrossRef] [Google Scholar] 47.Camargo ME. Флуоресцентный тест на антитела для серодиагностики американского трипаносомоза. Техническая модификация с использованием консервированных культурных форм Trypanosoma cruzi в тесте на слайде. Rev Inst Med Trop Сан-Паулу. 1966. 8 (5): 227–35. Epub 1966/09/01. . [PubMed] [Google Scholar] 48. Umezawa ES, Nascimento MS, Kesper N, Jr., Coura JR, Borges-Pereira J, Junqueira AC, et al. Иммуноблоттинг с использованием секретируемых из организма антигенов Trypanosoma cruzi в серодиагностике врожденной, острой и хронической болезни Шагаса.J Clin Microbiol. 1996. 34 (9): 2143–7. Epub 1996/09/01. 10.1128 / JCM.34.9.2143-2147.1996. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 49. де Р.Дж., Лауар К.М., де О.А. [Клинико-рентгенологические аспекты аперистальтики пищевода]. Rev Bras Gastroenterol. 1960; 12: 247–62. Epub 1960/09/01. . [PubMed] [Google Scholar] 50. Ximenes CA, Rezende JM, Moreira H, Vaz MGM. Упрощенная техника для радиологической диагностики в Megacolon chagásico. Revista da Sociedade Brasileira de Medicina Tropical.1984; 17 (23). [Google Scholar] 51. Кастро С., Эрнандес Э.Б., Резенде Дж., Прата А. [Радиологическое исследование случаев мегаколона в эндемичных для болезни Шагаса районах]. Rev Soc Bras Med Trop. 2010. 43 (5): 562–6. Epub 2010/11/19. 10.1590 / s0037-86822010000500018. [PubMed] [CrossRef] [Google Scholar] 52. Сантана СО. Susceptibilidade do Triatoma brasiliensis (hemiptera: reduviidae triatominae) на изоляты Trypanosoma cruzi (kinetoplastida, trypanosomatidae) на Estado do Rio Grande do Norte. Dissertação de Mestrado Programa de Pós Graduação em Ciências Farmacêuticas, Федеральный университет до Риу-Гранди-ду-Норти.2017: 69. [Google Scholar] 53. Кобаяши К.С., Шамайяр М., Огура Ю., Хенегариу О, Инохара Н., Нуньес Г. и др. Nod2-зависимая регуляция врожденного и адаптивного иммунитета в кишечном тракте. Наука. 2005. 307 (5710): 731–4. Epub 2005/02/05. 10.1126 / science.1104911. [PubMed] [CrossRef] [Google Scholar] 54. Pizzi TAM; Christen R; Hoecker G; Негме А Estudios sobre inmunobiología de la enfermedades parasitarias: Я влияю на генетическую конституцию на резистентность лас лаухас а ла экспериментальную инфекцию у Trypanosoma cruzi.Бол Инф Паразит Чили. 1949; 4: 3. [Google Scholar] 55. Brener Z. Atividade terapeutica делает 5-нитро-фуральдеидо-семикарбазона (нитрофуразона) em esquemas de duração пролонгация на экспериментальную инфекцию camundongo pelo Trypanosoma cruzi. Revista do Instituto de Medicina Tropical de São Paulo. 1961; 3 (1): 7. [Google Scholar] 56. Марона HR, Луччези МБ. Протокол для уточнения теста перистальтики кишечника у мышей. Lab Anim. 2004. 38 (3): 257–60. Epub 2004/06/23. 10.1258 / 002367704323133637. [PubMed] [CrossRef] [Google Scholar] 57.de Oliveira GM, de Melo Medeiros M, da Silva Batista W, Santana R, Araujo-Jorge TC, de Souza AP. Применимость использования древесного угля для оценки перистальтики кишечника на мышиной модели инфекции Trypanosoma cruzi. Parasitol Res. 2008. 102 (4): 747–50. Epub 2007/12/29. 10.1007 / s00436-007-0829-8. [PubMed] [CrossRef] [Google Scholar] 58. Арантес RM, Ногейра AM. Распределение энтероглюкагон- и пептидных YY-иммунореактивных клеток в слизистой оболочке кишечника стерильных и обычных мышей. Cell Tissue Res.1997. 290 (1): 61–9. Epub 1997/09/11. 10.1007 / s004410050908. [PubMed] [CrossRef] [Google Scholar] 59. Бисвас А., Петницки-Оквейя Т., Кобаяши К.С. Nod2: ключевой регулятор, связывающий микробиоту с иммунитетом слизистой оболочки кишечника. J Mol Med (Берл). 2012; 90 (1): 15–24. Epub 24.08.2011. 10.1007 / s00109-011-0802-у. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 60. Рехман А., Сина С., Гаврилова О., Хаслер Р., Отт С., Бейнс Дж. Ф. и др. Nod2 необходим для временного развития кишечных микробных сообществ.Кишечник. 2011. 60 (10): 1354–62. Epub 23.03.2011. 10.1136 / gut.2010.216259. [PubMed] [CrossRef] [Google Scholar] 61. Seksik P, Rigottier-Gois L, Gramet G, Sutren M, Pochart P, Marteau P и др. Изменения доминирующих фекальных бактериальных групп у пациентов с болезнью Крона толстой кишки. Кишечник. 2003. 52 (2): 237–42. Epub 2003/01/14. 10.1136 / gut.52.2.237. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 62. Guimaraes Quintanilha AG, Azevedo dos Santos MA, Avila-Campos MJ, Saad WA, Pinotti HW, Zilberstein B.Микробиота шагасового мегаколона и проксимального отдела тощей кишки. Сканд Дж Гастроэнтерол. 2000. 35 (6): 632–6. Epub 2000/07/27. 10.1080 / 003655200750023606. [PubMed] [CrossRef] [Google Scholar] 63. Pajecki D, Zilberstein B, dos Santos MA, Ubriaco JA, Quintanilha AG, Cecconello I, et al. Микробиота Megaesophagus: качественный и количественный анализ. J Gastrointest Surg. 2002. 6 (5): 723–9. Epub 2002/10/26. 10.1016 / s1091-255x (02) 00028-8. [PubMed] [CrossRef] [Google Scholar] 64. Сантамария MH, Перес Кабальеро E, Corral RS.Неметилированные мотивы CpG в ДНК Toxoplasma gondii индуцируют TLR9- и IFN-бета-зависимую экспрессию альфа-дефенсина-5 в эпителиальных клетках кишечника. Паразитология. 2016; 143 (1): 60–8. Epub 2015/11/03. 10.1017 / S0031182015001456. [PubMed] [CrossRef] [Google Scholar] 65. Foureau DM, Mielcarz DW, Menard LC, Schulthess J, Werts C, Vasseur V и др. TLR9-зависимая индукция кишечных альфа-дефенсинов Toxoplasma gondii. J Immunol. 2010. 184 (12): 7022–9. Epub 2010/05/22. 10.4049 / jimmunol.0

2. [PubMed] [CrossRef] [Google Scholar] 66.Румио С., Соммарива М., Сфондрини Л., Палаццо М., Морелли Д., Вигано Л. и др. Индукция дегрануляции клеток Панета пероральным введением лигандов Toll-подобных рецепторов. J. Cell Physiol. 2012. 227 (3): 1107–13. Epub 2011/05/14. 10.1002 / jcp.22830. [PubMed] [CrossRef] [Google Scholar] 67. Muniz LR, Knosp C, Yeretssian G. Кишечные антимикробные пептиды во время гомеостаза, инфекции и болезни. Фронт Иммунол. 2012; 3: 310 Epub 23.10.2012. 10.3389 / fimmu.2012.00310. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 68.Ayabe T, Satchell DP, Wilson CL, Parks WC, Selsted ME, Ouellette AJ. Секреция микробицидных альфа-дефенсинов кишечными клетками Панета в ответ на бактерии. Nat Immunol. 2000. 1 (2): 113–8. Epub 2001/03/15. 10.1038 / 77783. [PubMed] [CrossRef] [Google Scholar] 69. Киннебрю М.А., Убеда С., Зеневич Л.А., Смит Н., Флавелл Р.А., Памер Э.Г. Бактериальный флагеллин стимулирует Toll-подобный рецептор 5-зависимую защиту от устойчивой к ванкомицину инфекции Enterococcus. J Infect Dis. 2010. 201 (4): 534–43. Epub 2010/01/13.10.1086 / 650203. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 70. Робелло С., Мальдонадо Д.П., Хевиа А., Хоаши М., Фраттароли П., Монтакутти В. и др. Микробиота кала, полости рта и кожи детей с болезнью Шагаса, получавших бензнидазол. PLoS One. 2019; 14 (2): e0212593 Epub 2019/02/27. 10.1371 / journal.pone.0212593 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 71. Bevins CL. Врожденные иммунные функции альфа-дефенсинов в тонком кишечнике. Dig Dis. 2013. 31 (3–4): 299–304. Epub 2013/11/20.10.1159 / 000354681. [PubMed] [CrossRef] [Google Scholar] 72. Накамура К., Сакураги Н., Такакува А., Аябе Т. Альфа-дефензины клеток Панета и кишечная микробиота в здоровье и болезнях. Здоровье продуктов питания Biosci Microbiota. 2016; 35 (2): 57–67. Epub 2016/05/21. 10.12938 / bmfh.2015-019. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 73. Чайратана П., Нолан Э.М. Человеческий альфа-дефенсин 6: небольшой пептид, который самособирается и защищает хозяина, запутывая микробы. Acc Chem Res. 2017; 50 (4): 960–7. Epub 2017/03/16.10.1021 / acs.accounts.6b00653. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 74. Сильва Г.К., Гутьеррес Ф.Р., Гуэдес П.М., Орта К.В., Кунья Л.Д., Минео Т.В. и др. Передний край: нуклеотид-связывающие ответы, зависимые от домена 1 олигомеризации, определяют устойчивость мышей к инфекции Trypanosoma cruzi. J Immunol. 2010. 184 (3): 1148–52. Epub 2010/01/01. 10.4049 / jimmunol.0

4. [PubMed] [CrossRef] [Google Scholar] 75. Lopes ER, Rocha A, Meneses AC, Lopes MA, Fatureto MC, Lopes GP, et al. [Распространенность висцеромегалий при вскрытии трупов, проведенных в Триангуло Минейро с 1954 по 1988 год].Rev Soc Bras Med Trop. 1989. 22 (4): 211–5. Epub 1989/10/01. 10.1590 / s0037-868219800008. [PubMed] [CrossRef] [Google Scholar] 76. Атиас А. [Желудочно-кишечная болезнь Шагаса в Чили]. Bol Chil Parasitol. 1969; 24 (1): 70–4. Epub 1969/01/01. . [PubMed] [Google Scholar] 77. Ласерна К. Compromiso digestivo en la enfermidad de Chagas. Gac Med Boliviana. 1991; 15: 4. [Google Scholar] 78. Франка Родригес М. Энфермедад де Шагас и мегаколон в Уругвае. Rev Uruguaya Pat Clin y Microbiol. 1971; 9: 7. [Google Scholar] 79.Атиас А. Энфермедад де Шагас в жизни в Чили. Experiencia de 20 anos. Bol Hosp S Juan de Dios. 1980; 27: 7. [Google Scholar] 80. Сундин О.Х., Мендоза-Ладд А., Зенг М., Диас-Аревало Д., Моралес Э., Фаган Б.М. и др. Тощая кишка человека имеет эндогенную микробиоту, отличную от микробиоты полости рта и толстой кишки. BMC Microbiol. 2017; 17 (1): 160 Epub 19.07.2017. 10.1186 / s12866-017-1059-6. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 81. Кампос М.А., Алмейда И.С., Такеучи О., Акира С., Валенте Е.П., Прокопио Д.О. и др.Активация Toll-подобного рецептора-2 гликозилфосфатидилинозитолом закрепляется у простейших паразитов. J Immunol. 2001. 167 (1): 416–23. Epub 2001/06/22. 10.4049 / jimmunol.167.1.416. [PubMed] [CrossRef] [Google Scholar] 82. Bafica A, Santiago HC, Goldszmid R, Ropert C, Gazzinelli RT, Sher A. Передний край: передача сигналов TLR9 и TLR2 вместе составляет MyD88-зависимый контроль паразитемии при инфекции Trypanosoma cruzi. J Immunol. 2006. 177 (6): 3515–9. Epub 2006/09/05. 10.4049 / jimmunol.177.6.3515. [PubMed] [CrossRef] [Google Scholar] 83.Oliveira AC, Peixoto JR, de Arruda LB, Campos MA, Gazzinelli RT, Golenbock DT, et al. Экспрессия функционального TLR4 придает провоспалительную реакцию на гликоинозитолфосфолипиды Trypanosoma cruzi и более высокую устойчивость к инфекции T. cruzi. J Immunol. 2004. 173 (9): 5688–96. Epub 2004/10/21. 10.4049 / jimmunol.173.9.5688. [PubMed] [CrossRef] [Google Scholar] 84. Ватанабе Т., Китани А., Мюррей П.Дж., Стробер В. NOD2 является негативным регулятором опосредованных Toll-подобным рецептором 2 ответов Т-хелперов 1 типа.Nat Immunol. 2004. 5 (8): 800–8. Epub 2004/06/29. 10.1038 / ni1092. [PubMed] [CrossRef] [Google Scholar] 85. Тафури В.Л., де Мария Т.А. [О поведении нейросекреторного везикулярного компонента мегаэзофага при трипаносомозе cruzi человека]. Rev Inst Med Trop Сан-Паулу. 1970. 12 (5): 298–309. Epub 1970/09/01. . [PubMed] [Google Scholar]

Совместное заявление Конгрессу Бразилии: Отказаться от счетов

за опасные киберпреступления

Мы, нижеподписавшиеся, собравшиеся на RightCon Silicon Valley 2016, хотели бы выразить нашу обеспокоенность недавними попытками бразильских законодателей подорвать права, гарантированные Marco Civil da Internet (Рамки гражданских прав для Интернета), и наше возражение против серьезного и неприемлемые неудачи, предлагаемые парламентской комиссией по расследованию киберпреступлений.Предлагаемые правила не только влияют на права граждан, но и напрямую влияют на экономическую свободу компаний, работающих в Интернете и телекоммуникационных отраслях.

Бразилия стала мировым лидером в области защиты прав и свобод в Интернете с принятием закона Марко Сивил да Интернет. Пользователи Интернета, ученые, технологи, представители бизнеса и правительства - все внесли свой вклад в его развитие в ходе длительного процесса консультаций. Его окончательная форма содержит строгие меры защиты свободы выражения в Интернете, сетевой нейтралитет, конфиденциальность пользователей и доступ к информации.Подписанный в апреле 2014 года закон стал исторической победой для позитивного сотрудничества в Интернете. Сейчас этот процесс подрывается.

31 марта Конгресс Бразилии представил окончательный отчет парламентской комиссии по расследованию киберпреступлений (CPI dos Crimes Cibernéticos). В отчете предлагается принять 8 новых законодательных актов. Если этот отчет будет одобрен, эти законопроекты будут обсуждены на бразильском конгрессе.

Эти счета содержат несколько тревожных политик, например:

  • Позволяет правоохранительным органам получать доступ к IP-адресам без постановления суда.
  • Интернет-провайдеры (ISP) будут обязаны удалить контент, который считается «вредным для личной чести», после уведомления в течение 48 часов под страхом уголовной и гражданской ответственности. Это предложение неоднозначно и может позволить отдельным лицам, потенциальным жертвам и их законным представителям запрашивать удаление контента непосредственно на платформах. Это порождает приватизацию правоприменения, отсутствие надлежащей правовой процедуры и «сдерживающее воздействие» на свободу выражения мнений.
  • Вопреки всем международным руководящим принципам в области прав человека, интернет-провайдеры (ISP) будут обязаны активно контролировать пользовательский контент, чтобы препятствовать будущим загрузкам того же материала, который был удален как «вредный для личной чести», а также всего, что потенциально связано к нему.
  • Он расширяет определение того, что составляет преступление вторжения в электронные устройства, до случаев, когда нет доказанного вреда и независимо от намерения. Он, возможно, криминализирует такие действия, как разоблачение или обход технических средств защиты (TPM), которые препятствуют личному использованию контента, защищенного авторским правом.
  • Он создает для судов пустой чек, чтобы заблокировать использование приложений и услуг на уровне инфраструктуры Интернета, что создает негативные последствия для свободы выражения мнений.Помимо потенциально негативного воздействия на свободу конкретных компаний и / или бизнес-моделей, меры блокировки и фильтрации не соответствуют принципу соразмерности, не соблюдают принцип сетевой нейтральности и могут иметь побочный эффект для других юрисдикций, вызывая побочный ущерб стабильности Интернета.

С учетом сказанного, законопроекты в этом отчете и сам отчет криминализируют действия обычных пользователей Интернета под предлогом предотвращения киберпреступлений.Мы призываем Бразильский Конгресс и впредь выступать за свободу Интернета. Конгрессу следует отказаться от законопроектов, предложенных парламентской комиссией по расследованию киберпреступлений (CPI dos Crimes Cibernéticos), и продолжить работу по продвижению открытого и бесплатного Интернета.

Сан-Франциско, 1 апреля 2016 г.

Доступ сейчас

Acceso Libre

ACI-Participa

Актанты

Статья 19

Asociación por los Derechos Civiles (ADC)

Associação Ganesha de Cultura Digital

Ассоциация прогрессивных коммуникаций (APC)

Barão de Itararé

Casa da Cultura Digital Porto Alegre (Бразильский коллектив цифровой культуры в Порту-Алегри / Бразилия)

Центр технологий и общества при юридической школе FGV (CTSFGV)

Изменить.орг

Ciranda Internacional da Comunicação Compartilhada

Clube de Engenharia

Права на кодирование

COLAB - Co: Лаборатория развития и участия

Coletivo Digital

Coletivo Puraqué

Derechos Digitales

Фонд электронных границ (EFF)

Enjambre Digital

Фонд Фантусам

Fundación Acceso

Fundacion Karisma

Grupo de Estudos de Direito da Internet (GEDI), Федеральный университет Риу-Гранди-ду-Норти (UFRN)

Grupo de Pesquisa em Políticas Públicas para o Acesso à Informação / GPoPAI da Universidade de São Paulo / USP

Hiperderecho

Часы ICT

Институт исследований Интернета и общества (IRIS)

Институт технологий и общества (ITS), Рио-де-Жанейро

Instituto Bem Estar Brasil

Instituto Brasileiro de Defesa do Consumidor - Idec

Instituto Beta: Internet e Democracia

Instituto Igarapé

Интервью коллективной связи Бразилии

Центр исследований права и технологий InternetLab

Интернет без границ

LuluzinhaCamp

Movimento Mega

OpenMedia International

Projeto Saúde & Alegria

PROTESTE - Ассоциация потребителей

Общественные знания

SIG Observatório da Juventude / Молодежная обсерватория SIG

SonTusDatos - Мексика

Sursiendo, Comunicación y Cultura Digital

ТЕДИК

ULEPICC-Br (União Latina de Economia Política da Informação, da Comunicação e da Cultura - Capítulo Brasil)

Usuarios Digitales

Если ваша организация заинтересована в подписании этой декларации, напишите нам по адресу [email protected]

Бразильский студент-химик победил в конкурсе Honeywell Unisim Design Challenge 2014

САН-АНТОНИО, Техас, 4 июня 2014 г. - Бразильский студент-химик, который использовал программное обеспечение для моделирования, чтобы показать, как выбросы можно преобразовать в электрическую энергию, был назван победителем Honeywell ( NYSE: HON ) Ежегодный конкурс UniSim® Design Challenge для Process Solutions.

Герберт Сензано Лопес, магистрант Федерального университета Риу-Гранди-ду-Норти (UFRN), работал с профессором Ваня Мария де Франса Безерра над разработкой решения, показывающего, как сжигаемый газ из трубопроводов может быть повторно использован для выработки энергии.


«Поддержание производства при одновременном сокращении экологических отходов и соблюдении нормативных требований является реальной проблемой для многих наших клиентов, и этот проект показал, как моделирование может напрямую решить эту проблему», - сказал Вимал Капур, президент Honeywell Process Solutions."Мистер. Сенцано и профессор Франса показали, что программное обеспечение для моделирования может не только создавать производственные процессы - оно может создавать инновационные решения, снижающие воздействие этих процессов на окружающую среду ».

С помощью UniSim Design Сензано и Франса определили, как кислород можно использовать для увеличения электрического заряда летучих органических соединений, выбрасываемых в воздух при сжигании газовых факелов в трубопроводах. Их моделирование создало 2,126 мегаватт электрического заряда и показало, что они могут помочь уменьшить выбросы оксидов органических отходов в атмосферу.

Сенцано и Франса представили победившую работу «Утилизация факельного газа для выработки электроэнергии» на этой неделе во время ежегодного симпозиума Honeywell Users Group (HUG) в Америке, крупнейшего собрания клиентов компании в сфере непрерывного производства. UniSim Design Challenge позволяет студентам-инженерам предлагать решения реальных проблем, с которыми сталкиваются производители технологических процессов, с помощью программного обеспечения Honeywell UniSim Design Suite, которое используется для проектирования и моделирования процессов на производственных предприятиях по всему миру.

«Дизайн UniSim имел важное значение для нашего проекта, потому что с помощью этого пакета мы могли смоделировать проблему на основе реальной ситуации и успешно протестировать наше решение», - сказал Сенцано. «Благодаря программному обеспечению Honeywell стало возможным построить блок-схему процесса, аналогичную к реальности и смоделировать динамические кейсы для академического и производственного секторов », - добавила Франса.

UniSim Design Suite предоставляет интерактивную модель процесса, которая позволяет инженерам создавать стационарные и динамические модели и широко используется для проектирования завода, мониторинга производительности, устранения неполадок, улучшения работы, бизнес-планирования и управления активами по всему миру.Модели UniSim Design можно использовать в решениях для расширенного обучения и оптимизации, предоставляемых пакетами UniSim Operations и UniSim Optimization.

Для получения дополнительной информации о конкурсе Honeywell UniSim Design Challenge посетите: https://www.honeywellprocess.com/en-US/news-and-events/student-competition/Pages/default.aspx

# #

Honeywell Process Solutions (www.honeywellprocess.com) является пионером в области автоматизации управления, контрольно-измерительной аппаратуры и услуг для нефтегазовой отрасли; рафинирование; целлюлозно-бумажная промышленность; промышленная энергетика; химия и нефтехимия; биотопливо; естественные науки; и металлургическая, горнодобывающая и горнодобывающая промышленность.Process Solutions является частью стратегической бизнес-группы Honeywell Performance Materials and Technologies, в которую также входит UOP, ведущий международный поставщик и лицензиар технологических процессов, катализаторов, адсорбентов, оборудования и консультационных услуг для нефтеперерабатывающей, нефтехимической и газоперерабатывающей отраслей.

Honeywell (www.honeywell.com) - лидер в области диверсифицированных технологий и производства из списка Fortune 100, обслуживающий клиентов по всему миру с помощью аэрокосмической продукции и услуг; технологии управления для зданий, домов и промышленности; турбокомпрессоры; и материалы для исполнения.Акции компании Honeywell, расположенной в городе Моррис, штат Нью-Джерси, торгуются на фондовых биржах Нью-Йорка, Лондона и Чикаго. Для получения дополнительных новостей и информации о компании Honeywell посетите сайт www.honeywellnow.com.

Этот релиз содержит определенные заявления, которые могут считаться «прогнозными заявлениями» по смыслу раздела 21E Закона о фондовых биржах 1934 года. Все заявления, кроме заявлений об исторических фактах, которые касаются действий, событий или разработок, которые мы или наше руководство намеревается, ожидает, проектирует, верит или ожидает, что произойдет или может произойти в будущем, являются прогнозными заявлениями.Такие заявления основаны на определенных предположениях и оценках, сделанных нашим руководством в свете их опыта и их восприятия исторических тенденций, текущих экономических и отраслевых условий, ожидаемых будущих событий и других факторов, которые они считают уместными. Прогнозные заявления, включенные в этот выпуск, также подвержены ряду существенных рисков и неопределенностей, включая, помимо прочего, экономические, конкурентные, правительственные и технологические факторы, влияющие на нашу деятельность, рынки, продукты, услуги и цены.Такие прогнозные заявления не являются гарантией будущих результатов, и фактические результаты, развитие событий и бизнес-решения могут отличаться от тех, которые предполагаются в таких прогнозных заявлениях. Мы определяем основные риски и неопределенности, которые влияют на нашу работу, в нашей Форме 10-K и других документах, поданных в Комиссию по ценным бумагам и биржам.

# #

Хлорохин в качестве многообещающей адъювантной терапии сахарного диабета 1 типа

Приготовление CQ NPs

CQ был коммерчески приобретен (Sigma-Aldrich Co.cat # C1386, lote # 081M1611V) и CQ, включенный в PLA NP, получали в соответствии с методами Lima et al. 40 .

Вкратце, CQ NP получали с использованием метода испарения эмульсии с растворителем. Процедуру выполняли путем смешивания 0,4 мл 0,5 М водного NaHCO 3 (pH = 8,4), содержащего 1,25% об. / Об., С 10 мл дихлорметана органической фазы, содержащего PLA (0,25% об. / Об.), Для получения соотношения CQ: PLA. 1: 5 об. / об. Затем флакон встряхивали в течение трех циклов по 10 с с интервалами 1 мин.После этого супернатант (раствор NaHCO 3 ) удаляли и 4 мл органической фазы, содержащей CQ и PLA, вводили со скоростью 1,0 мл / мин в водную фазу (16 мл), содержащую поверхностно-активное вещество, полоксамер 407 (0,75% об. / v) при перемешивании магнитной мешалкой. Фазы фильтровали и эмульгирование производили при встряхивании на оборудовании Ultra-turrax (IKA Labortechnik, Staufen, Германия) с упариванием в течение ночи. Образцы хранили при 8 ° C, и размер и дзета-потенциал были измерены через 24 часа 41 .

Исследуемая популяция

В целом, 25 пациентов с СД1 в возрасте от 10 до 16 лет (группа СД1) были набраны из отделения детской эндокринологии, Университетской больницы Онофре Лопес Федерального университета Риу-Гранди-ду-Норти (UFRN), Натал, RN , Бразилия. Все пациенты с СД1 постоянно получали инсулин. Диагноз СД1 был поставлен в соответствии с критериями ADA с уровнем глюкозы в крови натощак ≥ 126 мг / дл и HbA1C ≥ 6,5% 1,3 . Гликемический контроль оценивали путем измерения HbA1c в цельной крови, а также концентрации глюкозы в сыворотке.Все тесты проводились с использованием наборов Wiener, в соответствии с инструкциями производителя, с использованием биохимического анализатора CMD-800 (Wiener Laboratories, Росарио, Аргентина).

Кроме того, 25 неродственных субъектов (нормогликемическая группа, NG) без предыдущего диагноза TIDM, с уровнем глюкозы в сыворотке натощак ≤ 99 мг / дл и в том же возрастном диапазоне были набраны из местных государственных школ в Натале, RN, Бразилия. . Исследование было проведено в соответствии с руководящими принципами, установленными Комитетом по этике в исследованиях Федерального университета Риу-Гранди-ду-Норти, который соответствует Хельсинкской декларации, и одобренным Комитетом по этике исследований больницы Онофре Лопес УФРН в соответствии с протоколом номер 704.310. Письменное информированное согласие было получено от всех взрослых субъектов и родителей или законных опекунов несовершеннолетних пациентов и лиц с нормогликемией. Критериями исключения были беременность, артериальная гипертензия, наличие воспалительных заболеваний и недавние инфекции. После оценки истории болезни у всех субъектов были взяты образцы крови натощак для биохимических анализов, выделения клеток, культивирования клеток и выделения общей РНК.

Выделение и культивирование PBMC

PBMC были получены из групп NG и T1DM с помощью градиента плотности, в котором кровь была добавлена ​​к Histopaque ® (Sigma-Aldrich, St Louis, MO, USA; градиент плотности 1.077 г / мл) и центрифугировали до 400 × г в течение 30 мин. После центрифугирования клетки ресуспендировали в 2 мл среды RPMI 1,640 с добавлением 0,29 г / л L-глутамина, 2 г / л бикарбоната натрия, 25 мМ / л HEPES, 1% антибиотик-антимикотика и 10% сыворотки. Клетки подсчитывали в камере Нойбауэра и проверяли на жизнеспособность с помощью красителя трипанового синего. После подсчета клетки разбавляли до получения необходимого количества для экспериментов.

Жизнеспособность PBMC после обработки CQ и CQ NP.

Жизнеспособность PBMC в группе T1DM оценивали с помощью MTT (Sigma-Aldrich, St Louis, MO, USA).Клетки культивировали в 96-луночных планшетах с 1 × 10 4 клеток / лунку, подвергали воздействию CQ и CQ NP концентраций 5, 10, 25, 50, 100 и 200 мкМ и поддерживали в печи CO 2 . (5%) при 37 ° C в течение 48 часов. Затем в каждую лунку добавляли 5 мг / мл МТТ и планшет инкубировали в печи с CO 2 (5%) при 37 ° C в течение 4 часов. После этого добавляли 100 мкл 10% додецилсульфата натрия в 0,001 н. Соляной кислоте для растворения кристаллов. Затем планшет считывали на спектрофотометре для микропланшетов при 540 нм (Biotek ® , Epoch model, Winooski, Vermont, USA).Эксперимент проводили в трех повторностях. Жизнеспособность клеток определяли по сравнению с необработанными контролями. Относительную жизнеспособность клеток (%) в лунках, обработанных образцом, по сравнению с контрольными лунками оценивали по формуле. 1:

$$ {\ text {\% Cell Viability =}} \ frac {{{\ text {(Tested)}} \ times {100}}} {{\ text {(Control)}}} $$

В котором тестируемая и контрольная оптическая плотность обработанного образца и контрольного образца соответственно.

Для определения значений CC50 была определена нелинейная регрессия кривых концентрация – ответ.СС50 определяли как концентрацию, которая снижает жизнеспособность клеток на 50% по сравнению с необработанными контролями.

Обработка PBMC T1DM CQ и CQ NPs

Суспензии T1DM PBMC (1 × 10 5 клеток / лунка) высевали в 24-луночные планшеты с плоским дном для культивирования (Corning Incorporated, Корнинг, Нью-Йорк, США). Клетки подвергались трем различным условиям; отсутствие лечения (NT), лечение CQ (CQ) и лечение CQ NP (CQ NP). Клетки группы NG обрабатывали только культуральной средой.Планшеты выдерживали в инкубаторе CO 2 (5%) при 37 ° C в течение 24 и 48 часов. Затем клетки ресуспендировали и собирали в конце каждого периода инкубации, затем центрифугировали при 500 × g в течение 3 минут для получения клеток, и осадок использовали для получения общей РНК.

Анализ количественной полимеразной цепной реакции (кПЦР) в реальном времени

Общую РНК экстрагировали из осадка клеток, полученных из групп T1DM и NG, с использованием системы выделения общей РНК Promega SV (Promega Corporation, Мэдисон, Висконсин, США), согласно согласно инструкции производителя.Концентрацию и чистоту общей РНК измеряли с помощью спектрофотометра с нанокаплями (NanoDrop ND-1000, Montchanin, DE, USA) при 260 нм.

Целостность РНК определяли электрофорезом в агарозном геле (2% агароза / 3- [N-морфолино] пропансульфоновая кислота) с использованием аликвот общей РНК (приблизительно 10 мкл). Гель агарозы окрашивали GelRed ™ (Uniscience, São Paulo, SP, Brazil), обнаруживая наличие двух острых полос примерно 5 и 1,8 т.п.н., которые соответствуют рибосомной РНК 28S и 18S соответственно.

Уровни экспрессии IL1B , IL12 , IFNG , TNFA и IL10 оценивали с помощью кПЦР в реальном времени. Нормализующим эталонным геном был бета-актин (ACTB), который показал наибольшую стабильность среди генов глицеральдегид-3-фосфатдегидрогеназы, гипоксантинфосфорибозилтрансферазы 1 и бета-2-микроглобулина после анализа с помощью GENORM ™ (v.3.44) и программного обеспечения NORMFINDER. 42 .

Все анализы экспрессии генов проводили в системе 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA).Реакции проводили в двух экземплярах с использованием набора SuperScript ® III Platinum ® SYBR ® Green One-Step qRT-PCR kit (Life Technologies Corporation, Карлсбад, Калифорния, США) с общим объемом 12 мкл, содержащим приблизительно 10 нг общей РНК. Условия цикла ПЦР в реальном времени были следующими: 55 ° C в течение 30 минут, 95 ° C в течение 10 минут, затем 40 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 1 минуты.

Относительное выражение было рассчитано с использованием метода 2 - ΔΔCt 43 .Значимость определялась путем сравнения значений ΔCt для каждого целевого гена, и результаты представлены как кратное изменение средних значений группы NG, нормализованных до ACTB .

Статистический анализ

Все данные выражены как среднее ± стандартное отклонение. Распределение переменных анализировалось с помощью критерия Колмогорова – Смирнова. Переменные с нормальным распределением были подвергнуты t-критерию Стьюдента и анализу ANOVA с последующим сравнением с критерием Тьюки.Данные анализировали в GraphPad Prism v.6.0 (GraphPad Software, Inc., Сан-Диего, Калифорния, США). Статистически значимые результаты были получены при p <0,05.

MOVE8 / «Я горжусь тем, что я есть»: заявления о гендере и сексуальности в бразильской феминистской панк-сцене / Карина Моритцен

Концерт Sapataria на фестивале Garotas à Frente. Источник: G1

MOVE: Субкультуры, Движения, Эстетика - это серия документов, критически важный коллективный результат «Последипломного симпозиума по исследованию субкультур и эстетики», который прошел в Национальном университете Голуэя в Ирландии в сентябре 2019 года.Это мероприятие было организовано в рамках серии мероприятий Punk Scholars Network с целью собрать вместе студентов и начинающих исследователей, которые работают над субкультурными движениями и искусством, и предложить пространство для связи социологических исследований сопротивления с более гуманитарными дискуссиями. контркультурная эстетика.

Три эпизодических кластера в сериале призваны отразить пробелы и связи между дисциплинами, чтобы продемонстрировать необходимость переосмысления и того, как каждая статья может восприниматься как специфическая для себя, так и как часть истории, эпизода глава коллективного исследования.Темы варьировались от забытых тем и отказов в литературном мире до политики независимой музыки и панк-субкультуры, от экспериментальных методов кинопроизводства, стирающих границы американского видеоарта и кино, до оккупационных, диаспорических и субкультурных движений в Румынии, Бразилии и Великобритании. .

MOVE будет работать осенью 2020 года, в то время как covid-19 колеблется в разных временных пространствах, указывая на новые способы передвижения в условиях ограничений. Спасибо всем участникам, Moore Institute в NUI Galway и Punk Scholars Network за поддержку и особую благодарность Абраму Фоули, редактору ASAP / J. Здесь вы можете получить доступ ко всем эссе MOVE.

- Теммуз Сюрейя Гюрбюз (редактор)

:;

Введение: политические беспорядки в Бразилии

Бразилия переживает сильный политический кризис. После государственного переворота против Дилмы Руссеф, первой бразильской женщины, избранной президентом в 2014 году, политическая поляризация превратила страну в поле идеологической битвы, которая повлияла на общественную жизнь так же, как на дружбу и семейные узы.После потери значительной части прав рабочих из-за насаждения неолиберальной программы со времен правительства Мишеля Темера, избрание ультраправого Жаира Болсонару ввергло Бразилию в нынешнюю политическую неразбериху.

Сильно привязанный к религиозным ценностям, тяжелая консервативная программа была применена к политике страны, что поставило под угрозу многие прогрессивные достижения, достигнутые за последнее десятилетие, такие как легализация однополых браков и достижения феминистского движения с точки зрения отстаивание прав женщин.Известный своими женоненавистническими, гомофобными и расистскими публичными заявлениями, Болсонару представляет собой сдвиг в стране, которая когда-то имела процветающую экономику и предприняла шаги к социальному равенству. Что же тогда происходит с феминистками и активистами за права ЛГБТК + в этой новой (старой) Бразилии? Чтобы проиллюстрировать форму неповиновения новому истеблишменту в стране, в этом эссе будет выделен пример Sapataria, полностью лесбийской панк / хардкор-группы, которая является частью андеграундной музыкальной сцены Riot Grrrl в Сан-Паулу.

Музыкальные сцены и коммуникативные исследования

В последние годы Уильям Стро стал пионером в изучении музыкальных сцен и их связи с городами, в которых они расположены. В 1991 году Стро опубликовал эссе «Системы артикуляции, логика изменений: сообщества и сцены в популярной музыке», в котором он создал концепцию, которая дистанцировалась от определений музыкального сообщества и субкультуры того времени. Его исследование привлекло внимание к сценам альтернативного рока и танцевальной музыки в Монреале.Его метод исследования музыкальных сцен в области коммуникативных исследований оказался чрезвычайно важным; Многие различные сцены стали предметом исследования, примером чего могут служить работы нескольких бразильских профессоров, таких как Де Са и Джанотти Джуниор (2013), Соареш (2018), Оливейра (2018) и Кейруш (2019).

Согласно этой методологии, процесс исследования начинается в локальной сфере с целью понимания исторических и социологических процессов, вовлеченных в повседневную жизнь города.Он может быть транслокальным, когда эта сцена является зеркалом другого события - одновременно или нет - в дальнейших географических пространствах; или виртуальный, когда эти сцены связаны через медиа и Интернет.

Несмотря на то, что рок был преимущественно музыкальным жанром, связанным с выражением мужской сексуальности, сцены панк-рока с конца 1970-х годов стали важной сценой для усиления женских голосов (Whiteley 2000, Reddington 2007, Leonard 2007). Этика панка «Сделай сам» и девиз «Любой может это сделать» в конечном итоге позволили бы женщинам принимать в нем более активное участие - как в качестве творческих субъектов, так и в качестве активных участников этих музыкальных сцен.Обнадеживает тот факт, что панк «отказался от технической виртуозности и профессионализма в пользу дилетантства, иконоборчества и эстетики« сделай сам »».

Согласно Уайтли (2000, 98), «именно эта идентификация эксцентричности, отклонения от центра, несоблюдения общих правил обеспечивает особую траекторию женского панка». Этот сценарий проложил путь для Riot Grrrl: транслокальная музыкальная сцена, зародившаяся в 1990-х годах, во главе с группами Bikini Kill, Bratmobile и Heavens to Betsy, хотя и происходила из Олимпии, Вашингтон Д.C. сначала распространился на несколько других стран впоследствии. Его трансляция первоначально происходила посредством рассылки фэнзинов и обмена письмами между друзьями по переписке; позже он привлечет интерес основных СМИ и журналов, ориентированных на подростков, и будет представлен в таких изданиях, как USA Today , Newsweek , Spin , The New York Times и даже Playboy (Marcus, 2010 ; Шилт, 2003).

Термин Riot Grrrl был предназначен для того, чтобы избавить слово «девушка» от сексистского употребления в сценах рок-музыки, превратив его в гневное рычание; Впервые он был придуман как название журнала, написанного участниками Bratmobile и Bikini Kill, который раздавался на их концертах.Выставка «Alien She», кураторами которой выступили Астрия Супарак и Сеси Мосс, организованная Miller Gallery в Университете Карнеги-Меллона, включала связанный проект под названием «Карта глав Riot Grrrl», который собирает главы Riot Grrrl в 26 странах и 34 штатах США. между активными и неактивными транслокальными сценами. Большинство из этих стран, как, например, страны Европы и Латинской Америки, находятся в спектре культурного влияния Соединенных Штатов. Например, Бразилия и Россия отмечены на карте.

В 2012 году западный мир впервые услышал название российской феминистской группы активисток Pussy Riot. Артисты дали концерт, который длился около 50 секунд, прежде чем был закрыт в Храме Христа Спасителя, одном из самых известных храмов Москвы. Они исполнили «панковскую молитву» под названием: «Матерь Господа, прогони Путина». Участница Pussy Riot и бывшая заключенная Надя Толоконникова в своей книге Read and Riot: A Pussy Riot Guide to Activism, , впервые опубликованной в 2018 году, заявляет: «Мы создали Pussy Riot, вдохновленные фан-журналами о riot grrrls панк.Как это возможно, что 20-летняя русская девушка, жившая при правительстве Путина в 2010 году, чувствовала себя так глубоко связанной с американским движением riot grrrl, начавшимся в 1990-х годах? » (Толоконникова 2019, 36). Отчет Толоконниковой - один из самых ярких примеров влияния Riot Grrrl в пространстве и времени: почти 30 лет спустя их идеалы все еще вдохновляют молодых женщин восстать и бросить вызов политическому статус-кво.

Однако, несмотря на успешную борьбу с гендерным неравенством внутри музыкальных сцен и субкультур (Gottlieb and Wald 1993), как и сам феминизм (крючки 1990, Carneiro 2019, Hill Collins 2019, Lugones 2019, Gonzalez 2019), первоначальная сцена Riot Grrrl была по-прежнему несут ответственность за плохое отношение к расе, национальности и классу.Ее обычно описывают как преимущественно белую субкультуру среднего класса, которая не смогла включить и поддержать членов из недостаточно представленных слоев общества. Цветные женщины, участвующие в Riot Grrrl, постоянно критиковали отсутствие понимания форм предрассудков и угнетения, которым подвергаются женщины разных рас, этнических групп и классов в американском обществе (Nguyen 2012, Radway, 2016). Если идеалы гендерного равенства Riot Grrrl сохранятся во времени, необходимо будет принять межсекторальную структуру в рамках ее практики.Intersectional Riot Grrrl мог быть эволюцией, которой не хватало первоначальному движению, чтобы стать всеобъемлющим и изменяющим жизнь движением, которым оно было задумано.

Музыкальная сцена «Сапатария и Riot Grrrl» в Сан-Паулу

В городе Сан-Паулу женщины организуют коллективы, чтобы внедрить свои идеалы феминизма в местные сцены панк-музыки. Коллектив Desviantes (португальское слово «девиант») проводит музыкальный фестиваль, который в декабре 2019 года прошел в четвертый раз, на нем представлены составы, составленные в основном женщинами.Такие группы, как Dominatrix - первая бразильская группа, претендующая на лейбл Riot Grrrl (Gelain 2017) - и Cosmogonia, сформированная в 1990-х годах, все еще активны сегодня, к ним присоединились новые группы, такие как Gulabi, Bioma, A Vida Toda um Quase, Hayz и Derrota. . Вопросы гомофобии, расовых предрассудков и женоненавистничества часто затрагиваются в текстах песен этих групп, а на фестивалях, организованных различными коллективами, между концертами звучат политические речи, протестующие против нынешнего истеблишмента.

Здесь я хотел бы сосредоточиться на группе Sapataria, хардкор-панк-группе из Сан-Паулу, составленной женщинами, которые открыто являются лесбиянками, и они постоянно упоминают о своем лесбиянстве в своих песнях.Само название «Sapataria» («обувной магазин») - шутка над словом «Sapatão» («большая обувь»), используемым в бразильском португальском языке для дискриминации лесбиянок. Владея повествованиями о жизни лесбиянок и демистифицируя тяжелый вес этого конкретного оскорбительного слова, группа заявляет, что они не согласны с тем, что их личность принижает их. В их первом EP, выпущенном в 2018 году, песни «Orgulho» («Гордость»), «Carta aos Pais» («Письмо родителям») и «M.S.B. (Movimento das Sem Banheiro) »(« Движение тех, кто не имеет туалета ») напрямую занимается проблемами, с которыми сегодня сталкиваются лесбиянки в Бразилии.Их одноименный EP, выпущенный в 2018 году, открывается песней «Orgulho (Intro)», которая начинается со слов:

Это группа лесбиянок
Это группа лесбиянок
Мы Сапатария
Я горжусь тем, что я лесбиянка
Я горжусь тем, что лесбиянка
Я горжусь тем, что я
И я горжусь тем, как она. (Сапатария, 2018)

Информация, собранная здесь, основана на критическом анализе их первого одноименного EP с 2018 года и качественном интервью, собранном через Skype в январе 2019 года с бас-гитаристкой Даниэлой Маригетти.Дэн - как ее называют ее друзья и товарищи по группе - говорит, что познакомилась с другими членами Sapataria через активизм и протесты LGBTQIA +, и она имела обыкновение следить за музыкальной сценой Riot Grrrl в Сан-Паулу, прежде чем даже узнала о начальном движении Riot Grrrl. в Олимпии, США. Она присоединилась к местной музыкальной сцене Riot Grrrl, когда еще училась в старшей школе, и ее одноклассник познакомил с такими группами, как Dominatrix, Biggies, Lava и Santa Clauss. Позже, в 2013 году, она познакомилась с женщинами, играющими в группе Anti-corpos - еще одном биг-бэнде андеграундной сцены Сан-Паулу, которые в настоящее время базируются в Берлине.Вдохновение для создания группы пришло, когда Дэн увидел живое выступление группы Charlotte Matou um Cara на тематическом мероприятии LGBTQIA + «Queers and Queens» в 2016 году вместе с ее будущей коллегой по группе Мариной, которая сопровождала ее.

Концерты

Sapataria проходят в основном на феминистских мероприятиях, где зрители могут не знать их музыкальный жанр, но в конечном итоге получают удовольствие от выступления, потому что они могут идентифицировать себя с посланием в текстах. Недавно группа стала получать приглашения выступить на смешанных хардкорных фестивалях, что является признаком того, что их музыка принимается во внимание в более широких кругах панка и хардкора.Музыкальный материал группы транслируется в основном в Интернете, так как большинство приглашений на концерты приходит через социальные сети, такие как Instagram и Facebook.

Группа состоит из Зу, Дана, Исы и Марины. Дэн сообщает мне, что все они чувствуют себя искаженными в литературе, кино и искусстве в целом, и что было единогласным решением выбрать «Orgulho» в качестве первой песни EP (см. Текст выше). Дэн слышал от третьих лиц, что определенная аудитория думала, что конкретная тема лесбиянства может ограничить спектр текстов группы.В ответ на эту критику Дэн заявляет, что быть лесбиянкой - это аспект их жизни, который пронизывает весь жизненный опыт, чувство, которое разделяют все участники, что делает размах темы неиссякаемым источником вдохновения. Их цель - посредством написания и выпуска таких песен, как «Orgulho», побудить других лесбиянок писать о своем собственном опыте и, таким образом, расширить видимость движения LGBTQIA +. В 2019 году Сапатария выступила на одной сцене с Pussy Riot.Обе группы выступили на фестивале Garotas à Frente в Сан-Паулу 20 апреля -го годов.

Концерт Sapataria на фестивале Garotas à Frente. Источник: G1

О том, как стать открытой лесбийской группой в Бразилии в 2019 году, Дэн заявляет:

«Эта тяжелая атмосфера порождает большое движение; это вызывает тревогу, страх, но желание как-то сопротивляться. Это время, когда нам нужно объединиться и действовать более стратегически, мы не можем оставить пространство, чтобы они напали на нас.В конце 2018 года мы играли на мероприятии под названием «Хардкор против фашизма», и это был первый раз, когда я боялся играть. Находясь в этой сцене с 2006 года, я был насторожен и обдумывал каждый шаг. Это влияет на нас, и мы много слышали о депрессивных ЛГБТ, о людях, которых избивают, о самоубийствах; он оказывает прямое психологическое влияние на то, как мы действуем. Я бы хотел, чтобы было куда пойти, но я не хочу. Не все могут уехать из Бразилии. Вот почему нам нужно оставаться и сопротивляться ».

В то время как Дамарес Алвес, евангелический пастор, который сегодня занимает пост министра по делам женщин, семьи и прав человека Бразилии при правительстве Болсонару, хвастается против «гендерной идеологии» и поощряет половое воздержание в ответ на подростковые беременности и аборты, феминистские музыкальные сцены продолжаются. противостоять и распространять свои идеалы среди молодых женщин Бразилии.Riot Grrrl, даже со всеми своими недостатками, по-прежнему представляет собой важную веху, когда речь идет об эмансипации женщин и гендерном равенстве в обществе.

Список литературы

Беннет, Энди; Петерсон, Ричард. Музыкальные сцены: местные, виртуальные, транслокальные. Vanderbilt University Press, 2004.

.

Карнейро, Суели. «Enegrecer o Feminismo: a Situação da Mulher Negra na América Latina a Partir de uma Perspectiva de Gênero». Pensamento Feminista : Conceitos Fundamentais.Под редакцией Элоизы Буарк де Холанда, 2019.

Фрит, Саймон; МакРобби, Анджела. «Рок и сексуальность». Записано: Рок, поп и письменное слово. Под редакцией Саймона Фрита и Эндрю Гудвина. Рутледж: 1990.

Гелайн, Габриэла. «Releituras, Transições e Dissidências da Cultura Riot Grrrl no Brasil». Магистерская работа UNISINOS, 2017.

Гонсалес, Лелия. «Политико-культурная категория от Amefricanidade ». Pensamento Feminista: Conceitos Fundamentais , под редакцией Элоиза Буарк де Холланда, Bazar do Tempo, 2019.

Gottlieb, Joanne; Уолд, Гейл. «Пахнет духом подростков: бунты, революция и женщины в независимом роке». Critical Matrix, 1 января 1993 г.: 7, 2, стр. 11-43.

Хилл Коллинз, Патрисия. «Pensamento feminista negro: o poder da autodefinição». Pensamento Feminista: Conceitos Fundamentais , под редакцией Элоиза Буарк де Холланда, Bazar do Tempo, 2019.

крючки, раструб. Феминистская теория: от маржи к центру , Routledge, 2015.

Леонард, Марион. Гендер в музыкальной индустрии: Рок, дискурс и женская сила. Олдершот: Ашгейт, 2007.

.

Лорд, Одре. «Idade, raça, classe e gênero: mulheres redefinindo a diferença». Pensamento Feminista: Conceitos Fundamentais , под редакцией Элоиза Буарк де Холланда, Bazar do Tempo, 2019.

Лугонес, Мария. «Rumo a um feminismo decolonial». Pensamento Feminista: Conceitos Fundamentais , под редакцией Элоиза Буарк де Холланда, Bazar do Tempo, 2019.

Милан, Марсело. «Oligárquica e Retomada Neoliberal Plena: um Ensaio sobre as origens das crises gêmeas e do golpe de estado em 2016 no Brasil». Revista Brasileira de Estratégia e Relações Internacionais, январь / июнь, 2016: т. 5, н. 9. С. 76-119.

Нгуен, Мими Тхи. «Riot Grrrl, Race, and Revival». Women & Performance: , журнал по теории феминизма, 22: 2-3, 173-196, 2012.

Кейруш, Тобиас. «Valhalla, All Black In e Metal Beer : Repensando a Cena Musical a Partir de Bares do Interior do Nordeste».Кандидатская диссертация Федерального университета Пернамбуку (UFPE).

Радвей, Дженис. «Сети женских журналов, подпольные маршруты и история Riot Grrrl: осмысление борьбы за новые социальные формы в мире и за его пределами». Журнал американских исследований , 50, Vol. 1, 1-31, 2016.

Реддингтон, Хелен. Заблудшие женщины рок-музыки: Женщины-музыканты эпохи панка. Хэмпшир: Ашгейт, 2007.

.

Солома, Уилл. «Системы артикуляции, логика изменений: сообщества и сцены в популярной музыке.” Культурология , 1991, 5 (3): 366-388.

Толоконникова, Надя. Ум Гиа Пусси Риот Пара о Ативизме . Сан-Паулу: Ubu Editora, 2019.

.

Уайтли, Шейла. Женщины и популярная музыка: сексуальность, идентичность и субъективность. Лондон: Рутледж, 2000.

Краткая биография:

Карина Моритцен недавно окончила магистратуру по изучению СМИ в Федеральном университете Риу-Гранди-ду-Норти, Бразилия. Ее магистерская диссертация была посвящена деятельности групп, состоящих только из женщин на независимой рок-сцене Натала.

Оставить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *