Статья тк рф перевод: ТК РФ Статья 72.1. Перевод на другую работу. Перемещение \ КонсультантПлюс

Содержание

Ст. 72.1 ТК РФ. Перевод на другую работу. Перемещение

Перевод на другую работу — постоянное или временное изменение трудовой функции работника и (или) структурного подразделения, в котором работает работник (если структурное подразделение было указано в трудовом договоре), при продолжении работы у того же работодателя, а также перевод на работу в другую местность вместе с работодателем. Перевод на другую работу допускается только с письменного согласия работника, за исключением случаев, предусмотренных частями второй и третьей статьи 72.2 настоящего Кодекса.

По письменной просьбе работника или с его письменного согласия может быть осуществлен перевод работника на постоянную работу к другому работодателю. При этом трудовой договор по прежнему месту работы прекращается (пункт 5 части первой статьи 77 настоящего Кодекса).

Не требует согласия работника перемещение его у того же работодателя на другое рабочее место, в другое структурное подразделение, расположенное в той же местности, поручение ему работы на другом механизме или агрегате, если это не влечет за собой изменения определенных сторонами условий трудового договора.

Запрещается переводить и перемещать работника на работу, противопоказанную ему по состоянию здоровья.

См. все связанные документы >>>

< Статья 72. Изменение определенных сторонами условий трудового договора

Статья 72.2. Временный перевод на другую работу >

1. В ст. 72.1 даны понятия «перевод на другую работу» и «перемещение». Переводом на другую работу в соответствии с комментируемой статьей является постоянное или временное изменение трудовой функции работника и (или) структурного подразделения, в котором работает работник (если структурное подразделение было указано в трудовом договоре), при продолжении работы у того же работодателя, а также перевод на работу в другую местность вместе с работодателем. Как следует из содержания приведенной нормы, изменение других условий, определенных трудовым договором (например, режима работы, оплаты труда), не является переводом на другую работу.

Перевод на другую работу, так же как и изменение других определенных сторонами условий трудового договора, возможен только с письменного согласия работника. Исключение из этого правила допускается лишь в случаях, указанных в ч. ч. 2 и 3 ст. 72.2 (см. коммент. к ней).

Если перевод на другую постоянную или временную работу у того же работодателя осуществлен без письменного согласия работника, но работник не возражал против такого перевода и приступил к выполнению другой работы, такой перевод может считаться законным. Однако выполнение работником другой работы не освобождает работодателя от обязанности получить от работника письменное подтверждение такого согласия на перевод.

В тех случаях, когда переведенный на другую работу у того же работодателя работник приступил к выполнению этой работы, но считает, что перевод осуществлен в нарушение законодательства, он может обжаловать незаконный перевод в органы по рассмотрению трудовых споров.

2. Перевод на другую постоянную работу или временный перевод на другую работу у того же работодателя, а также перевод на постоянную работу в другую местность вместе с работодателем оформляются приказом (распоряжением) работодателя по установленной форме.

При переводе на работу в другую местность работникам выплачиваются соответствующие компенсации: стоимость проезда самого работника и членов его семьи, стоимость провоза багажа, расходы по обустройству на новом месте и др. Конкретные размеры возмещения расходов определяются соглашением сторон трудового договора (см. коммент. к ст. 169).

Под другой местностью следует понимать местность за пределами административно-территориальных границ соответствующего населенного пункта (п. 16 Постановления Пленума ВС РФ от 17.03.2004 N 2).

Перевод на работу из одного населенного пункта в другой даже в пределах одного административного района рассматривается как перевод в другую местность независимо от наличия автобусного или иного регулярного сообщения между этими пунктами.

Отказ работника от перевода в другую местность вместе с работодателем является основанием для прекращения с ним трудового договора по п. 9 ст. 77 ТК. Отказ от перевода в филиал или представительство организации, расположенные в другой местности, не может являться основанием для расторжения трудового договора с работником, если сам работодатель в эту другую местность не перемещается (см. коммент. к ст. 77).

При увольнении работников в связи с отказом от перевода в другую местность вместе с работодателем им выплачивается выходное пособие в размере двухнедельного среднего заработка (ч. 3 ст. 178 ТК).

3. Перевод на работу к другому работодателю может быть осуществлен по просьбе работника, изложенной в письменной форме, или с его письменного согласия, если инициатива в переводе исходит от работодателя.

Перевод на постоянную работу к другому работодателю влечет изменение одной стороны трудового договора, поэтому он рассматривается законодателем как самостоятельное основание прекращения трудового договора (п. 5 ст. 77 ТК). Работнику, письменно приглашенному на работу в порядке перевода от другого работодателя, не может быть отказано в заключении трудового договора в течение одного месяца со дня увольнения с прежнего места работы (см. коммент. к ст. 64). В трудовой книжке работника в этом случае производятся записи об увольнении и о приеме на работу с указанием порядка, в котором осуществлено увольнение в связи с переводом — по просьбе работника или с его согласия (п.

6.1 Инструкции по заполнению трудовых книжек).

4. Перевод на другую постоянную работу или временный перевод на другую работу у того же работодателя возможен по различным обстоятельствам. При этом инициатива в переводе может исходить как от работодателя, так и от самого работника (например, в связи с тем, что он повысил квалификацию).

В ряде случаев у работодателя возникает обязанность перевести работника с его согласия на другую работу, например в случае, когда работник нуждается в соответствии с медицинским заключением в предоставлении другой работы (см. коммент. к ст. 73).

В тех случаях, когда работа, на которую переведен работник в соответствии с медицинским заключением, является нижеоплачиваемой, за работником сохраняется его прежний средний заработок в течение месяца со дня перевода, а при переводе в связи с трудовым увечьем, профессиональным заболеванием или иным повреждением здоровья, связанным с работой, — до установления стойкой утраты трудоспособности либо до выздоровления работника (см.

коммент. к ст. 182).

В отдельных случаях, предусмотренных законодательством, работодатель обязан предложить работнику перевод на другую работу. Такая обязанность может возникнуть, например, при сокращении численности или штата, если у работодателя для работника, подлежащего сокращению, имеется другая работа (см. коммент. к ч. 3 ст. 81). Работодатель обязан предложить другую имеющуюся у него работу лицу, признанному по результатам аттестации не соответствующим занимаемой должности (см. коммент. к ст. 81).

5. От перевода работника на другую работу следует отличать его перемещение у того же работодателя на другое рабочее место, в другое структурное подразделение, расположенное в той же местности, поручение работы на другом механизме или агрегате. Такое перемещение согласно ч. 3 комментируемой статьи не требует согласия работника, если это не влечет изменения определенных сторонами условий трудового договора (см. коммент. к ст. 57).

Иными словами, изменение рабочего места или структурного подразделения можно признать перемещением только в том случае, если при заключении трудового договора это конкретное рабочее место (механизм, агрегат) или структурное подразделение не оговаривалось и в трудовом договоре не предусмотрено. Если же конкретное рабочее место (механизм, агрегат) или структурное подразделение указано в трудовом договоре, то оно является его обязательным условием и, следовательно, может быть изменено только с письменного согласия работника.

Под структурными подразделениями следует понимать как филиалы, представительства, так и отделы, цеха, участки и т.д. (п. 16 Постановления Пленума ВС РФ от 17.03.2004 N 2).

Перевод на другую работу по медицинским показаниям по ст. 73 ТК РФ

Ст. 73 ТК РФ описывает ситуацию, когда определенному специалисту по показаниям врачей более нельзя продолжать трудиться на прежнем месте работы, а следует сменить его. Возможные последствия и действия работника и компании в зависимости от конкретного случая рассматриваются ниже.

Ст. 73 ТК РФ: официальный текст

Скачать ст. 73 ТК РФ

Статья 73 Трудового кодекса РФ с комментариями-2022

Статья 73 ТК РФ предписывает компании, сотрудник которой по результатам медицинского заключения нуждается во временной (постоянной) смене работы, обеспечить такого специалиста иной работой (можно нижеоплачиваемой), которая не будет ему противопоказана. Данное заключение оформляется медорганизацией на бумажном либо электронном носителе в строгом соответствии с указаниями Минздрава РФ (приказ от 14.09.2020 № 972н).

ВАЖНО! Перевести такого сотрудника можно, только если он зафиксирует свое согласие в письменном виде.

При переводе на нижеоплачиваемую работу, согласно ст. 182 ТК РФ, в первый месяц за сотрудником сохраняют его средний заработок на прежней должности. А если болезнь связана с работой, то его сохраняют до тех пор, пока работник не поправится либо пока не установят устойчивую потерю работоспособности.

Можно оформить человека на разрешенные виды работы по совместительству — на период, пока он отстранен по медицинским показаниям от основной. Узнайте больше о данной процедуре из экспертной публикации, размещенной в системе «КонсультантПлюс». Получите пробный доступ к ней бесплатно.

Если специалист не возражает относительно перевода, то достаточно будет приказом, составленным в свободной форме, зафиксировать перевод и оформить дополнительное соглашение к трудовому договору. При этом в трудовой книжке специалиста ничего отмечать не нужно. В нее заносят сведения только о постоянном переводе.

О том, как оформить такой приказ, читайте в материале «Приказ о переводе работника на другую должность — образец».

Временный перевод может стать постоянным при двух условиях:

  1. После окончания срока временного перевода работодатель не предоставил прежнюю работу.
  2. Работник, которого перевели по медицинскому заключению, не потребовал вернуть ему прежнее место работы и продолжает работать на новом.

Сложности возникают, если работник отказывается от перевода. В этом случае последствия будут зависеть от того, на какой именно период врачи рекомендовали ему сменить род занятий. При этом возможны два варианта: временное отстранение с сохранением прежнего места работы или окончательное увольнение, о чем пойдет речь далее.

Кроме того, статья 73 ТК РФ устанавливает, что если противопоказания выносятся руководителю фирмы или ее структурного подразделения либо главбуху, то возможные последствия будут зависеть не от срока рекомендуемого перевода, а от того, какое решение примет фирма.

Если работодатель проигнорирует медицинские противопоказания при трудоустройстве человека, то проверяющие органы применят строгие санкции. Эксперты «КонсультантПлюс» рассказали о порядке привлечения работодателей к ответственности по соответствующему основанию. Получите пробный доступ к публикации на данную тему бесплатно.

Когда нельзя уволить специалиста, которому медики временно запретили трудиться на прежней должности?

Итак, если работник отказывается от рекомендаций врачей о временном переводе на другую должность на срок менее чем четыре месяца, то организация должна просто отстранить его от прежней должности. Уволить отказавшегося работника в данном случае нельзя в силу предписаний ст. 73 ТК РФ, а прежняя должность должна быть за ним сохранена.

Подробнее об иных основаниях для отстранения от работы читайте в материале «Порядок отстранения от работы по ТК РФ (нюансы)».

Однако специалисту, прежде чем отказываться от временной альтернативной должности, следует принять во внимание, что если он будет отстранен, то за этот период не получит вообще никакого заработка (ст.  73 ТК РФ). Кроме того, такой период не будет включаться в отпускной стаж.

Как оформить отстранение от работы по медицинским показаниям, подробно рассказали эксперты «КонсультантПлюс». Если у вас нет доступа к системе К+, получите пробный демодоступ бесплатно.

Подробнее о расчете отпуска смотрите в статье «Ежегодный оплачиваемый отпуск по Трудовому кодексу (нюансы)».

Всё вышеуказанное справедливо и для случаев, если у компании просто нет вакансии, на которую она могла бы перевести отстраненного менее чем на четыре месяца специалиста, чему имеется документальное подтверждение.

В каких случаях по ТК РФ фирма может уволить работника, которому врачи предписали сменить род занятий?

Если врачи рекомендовали работнику поменять работу более чем на четыре месяца (в том числе навсегда) и специалист от такого перевода отказался, компания прекращает с ним трудовые отношения в силу п. 8 ч. 1 ст. 77 ТК РФ.

При этом компании важно соблюсти определенную процедуру: письменно предложить сотруднику перейти на другую должность, а после получения письменного отказа выпустить приказ об увольнении.

Работник же должен понимать, что пытаться оспорить такое увольнение через суд бессмысленно, ведь если все процедурные моменты компанией соблюдены, то суд почти наверняка скажет, что увольнение не носит дискриминационного характера и не ущемляет права специалиста (определение КС РФ от 14.07.2011 № 887-О-О).

Узнайте больше из экспертной публикации, размещенной в системе «КонсультантПлюс», о порядке увольнения работника при наличии медицинских противопоказаний. Получите пробный доступ к ней бесплатно.

Что, если от перевода откажется руководитель?

Если же противопоказание вынесено в отношении специалиста, занимающего руководящую должность, то в случае отказа от перевода компания может также прекратить с ним трудовые отношения вне зависимости от того, на какой именно срок (более или менее четырех месяцев), врачи рекомендовали сменить род деятельности. Аналогичным образом поступить компания вправе, если у нее просто нет вакансии, что подтверждается документально.

Указанное справедливо и в отношении заместителей руководителей и главных бухгалтеров.

Однако здесь есть исключение: если организация желает, а специалист не против, то можно не увольнять, а отстранить работника от руководящей должности до того момента, пока врачи не разрешат ему вернуться. На протяжении всего периода отстранения зарплата начисляться не будет, если только иное не предусмотрено трудовым или коллективным договором либо трудовым и федеральным законодательством.

ОБРАТИТЕ ВНИМАНИЕ! При этом если обычных специалистов фирма может отстранить максимум на четыре месяца, то для руководителей такой лимит не действует, а срок отстранения определяется соглашением сторон.

Увольняемому по п. 8 ст. ч. 1 ст. 77 ТК РФ работнику выплачивают выходное пособие на основании ст. 178 ТК РФ (в ред. ФЗ РФ от 13.07.2020 № 210). Размер этой выплаты равен двухнедельному среднему заработку бывшего работника.

образец заявления, запись в трудовой книжке, статья в трудовом кодексе РФ

Узнали у эксперта, как правильно оформить увольнение переводом в другую организацию в 2022 году, каким должны быть порядок ухода и заявление о нем

Михаил Горюнов

Журналист КП

Татьяна Пузина

Учредитель учебного центра
«Академия бизнеса»

Смена работы бывает разной. Можно уйти по собственному желанию, можно по обоюдному согласию сторон. Еще есть такое понятие, как увольнение переводом в другую организацию. Как оно выглядит в 2022 году, каким должны быть заявление об уходе, расчет компенсации и не только, «Комсомольской правде» рассказала основатель учебного центра «Академия Бизнеса» Татьяна Пузина.

Что нужно знать об увольнении переводом в другую организацию

  • Заявление
  • Издание приказа
  • Запись в трудовой книжке
  • Расчет
  • Прием в новую компанию
  • Вопросы и ответы

Порядок увольнения в другую организацию

Начнем с того, что увольнение в порядке перевода в другую организацию — это возможность для работника перейти на новую работу без обязательной двухнедельной отработки на старой.

Как рассказывает Татьяна, право сотрудника на увольнение переводом в другую организацию закреплено в ст. 72.1 ТК РФ1. Согласно ч. 2 ст. 72.1 перевод возможен в двух ситуациях:

1. По инициативе работника — в этом случае согласия руководства организации не требуется.

2. По инициативе организации, но только при согласии работника.

— Увольнять же работника в этой ситуации требуется на основании подп. 5 ч. 1 ст. 77 ТК РФ2 — перевод сотрудника, а не по собственному желанию либо соглашению сторон, — говорит Пузина.

Процедура перевода в другую компанию начинается с того, что сотрудник должен подтвердить тот факт, что речь идет именно о переводе. На практике таким документом является письмо (приглашение), в котором обозначено согласие нового работодателя принять переводимого сотрудника. Оно составляется в свободной форме.

— Дополнительно к письму от принимающей работника организации требуется заявление об увольнении самого сотрудника. Наличие двух этих документов обязательно для начала процедуры увольнения, — добавляет эксперт.

Если инициатором перевода выступает организация, где трудится работник, то его согласие может быть отмечено на самом письме о переводе. Тогда можно не писать заявление об увольнении.

Заявление

Как уже указано выше, заявление пишется в случае, если от принимающей организации пришло письмо с согласием на перевод. Особой формы у него нет. Татьяна предлагает примерный образец с правильной формулировкой, прописанной в соответствии с подпунктом 5 ч. 1 ст. 77 ТК РФ.

    Генеральному директору ООО «Ромашка»
    Попову А. И.
    от секретаря ООО «Ромашка»
    Маркиной Н. Г.

      Заявление

        Прошу уволить меня с занимаемой должности согласно подп. 5 ч. 1 ст. 77 ТК РФ в связи с переводом на работу в ООО «Лютик» с ________ ____ года.

          __ __ ____ года

          Секретарь ООО «Ромашка» _____________________________Маркина Н. Г.

            Издание приказа

            После получения работодателем заявления работника об увольнении переводом в другую организацию и письма о переходе начинается оформление приказа. Проводят его по общим правилам, предусмотренным ст. 84.1 ТК РФ3.

            — Формулировка в приказе должна точно соответствовать подпункту 5 ч. 1 ст. 77 ТК РФ. То есть в графе «Основание для увольнения» должна быть указана следующая фраза: «перевод по просьбе работника на работу к другому работодателю» со ссылкой на данный подпункт, — объясняет Татьяна Пузина.

            Работник должен быть уведомлен о содержании приказа под расписку. Кроме того, администрация организации может выдать сотруднику, если он того требует, заверенную копию приказа.

            Запись о расторжении контракта в трудовой книжке

              Запись в трудовой книжке при увольнении переводом в другую организацию в 2022 году должна точно повторять формулировку приказала и норму ТК РФ, на основании которой производится расторжение контракта. Запись вносится без каких-либо сокращений.

              — Помимо трудовой книжки, точно такая же запись должна быть сделана в личной карточке сотрудника. С ее содержанием работник знакомится под подпись, — указывают специалисты.

              Если работник не может забрать трудовую книжку, администрация организации обязана направить ему по почте уведомление о необходимости забрать документ. При электронной трудовой книжке сотруднику могут выдать расписку по форме. Соответствующая информация обновится и в Пенсионном фонде.

              Расчет компенсации

                — В день увольнения работнику обязаны полностью выплатить зарплату, компенсацию за отпуск и другие положенные ему суммы, — отмечает наша собеседница.

                Расчет компенсации при увольнении переводом в другую организацию производит бухгалтер компании вместе с кадровым работником. Исполняется он в таком же порядке, как при уходе по собственному желанию. Помимо компенсации за неиспользованный отпуск, это должна быть сумма, которую фактически заработал сотрудник до дня ухода. Также платится премия, если она предусмотрена условиями трудового соглашения.

                Прием в новую компанию

                  Это оговаривается с новым работодателем. Четко установленных правил здесь нет, все индивидуально.

                  — Что касается даты перевода, то она ориентировочная. Практика исходит из того, что сотрудник должен быть трудоустроен в новой компании в разумный срок после увольнения. Таковым принято считать 1 месяц, — делится Пузина.

                  В учреждении, куда вы придете, вам обязаны предоставить ту должность и те условия, которые были оговорены ранее. Доказательства того, что вам предложили именно это место, именно эту зарплату, будут в письме, которое новая организация отправляла на вашу старую работу.

                  Также укажем, что на новом месте право на отпуск в первый год работы появляется у переведенного работника, как и у любого принятого человека, — через 6 месяцев работы.

                  Популярные вопросы и ответы

                  Что делать, если сумма расчета меньше положенной?

                  — Если вы уверены, что это так, обращайтесь с заявлением в прокуратуру и трудовую инспекцию. При возникновении спорных моментов о размерах выплат выплачивается неоспариваемая сумма (ч. 2 ст. 140 ТК РФ4), а остальная — после разбирательства.

                  Могут ли вас не принять на новую работу?

                  — Письмо о переводе обязывает в последующем нового работодателя заключить с переведенным работником трудовой договор и принять его на работу в той должности, которая указана в письме. То есть наличие такого письма является гарантией для сотрудника, что принимающая организация не откажет ему в трудоустройстве.

                  Чем отличается увольнение переводом в другую организацию от увольнения по собственному желанию?

                  — Они похожи, это правда. Но существенными особенностями являются, во-первых, необходимость предоставления старому работодателю подтверждения о дальнейшем трудоустройстве, во-вторых, согласования даты увольнения, в-третьих, отсутствие обязанности работника отрабатывать 2 недели у старого работодателя и, в-четвертых, указание в приказе и трудовой книжке иного основания для увольнения (подп. 5 ч. 1 ст. 77 ТК РФ).

                  Статьи по теме

                  Источники

                  Статья 72.1 Трудового кодекса Российской Федерации. URL: http://tkodeksrf.ru/ch-3/rzd-3/gl-12/st-72-1-tk-rf

                  Статья 77 Трудового кодекса Российской Федерации. URL: http://tkodeksrf.ru/ch-3/rzd-3/gl-13/st-77-tk-rf

                  Статья 84.1 Трудового кодекса Российской Федерации. URL: http://tkodeksrf.ru/ch-3/rzd-3/gl-13/st-84-1-tk-rf

                  Статья 140 Трудового кодекса Российской Федерации. URL: http://tkodeksrf.ru/ch-3/rzd-6/gl-21/st-140-tk-rf

                  Фото на обложке: shutterstock.com

                  Made on

                  Tilda

                  ст. 72.1 Трудового Кодекса РФ в текущей редакции и комментарии к ней

                  Перевод на другую работу — постоянное или временное изменение трудовой функции работника и (или) структурного подразделения, в котором работает работник (если структурное подразделение было указано в трудовом договоре), при продолжении работы у того же работодателя, а также перевод на работу в другую местность вместе с работодателем. Перевод на другую работу допускается только с письменного согласия работника, за исключением случаев, предусмотренных частями второй и третьей статьи 72.2 настоящего Кодекса.

                  По письменной просьбе работника или с его письменного согласия может быть осуществлен перевод работника на постоянную работу к другому работодателю. При этом трудовой договор по прежнему месту работы прекращается (пункт 5 части первой статьи 77 настоящего Кодекса).

                  Не требует согласия работника перемещение его у того же работодателя на другое рабочее место, в другое структурное подразделение, расположенное в той же местности, поручение ему работы на другом механизме или агрегате, если это не влечет за собой изменения определенных сторонами условий трудового договора.

                  Запрещается переводить и перемещать работника на работу, противопоказанную ему по состоянию здоровья.

                  Комментарий к статье 72.1 ТК РФ

                  1. В ст. 72.1 даны понятия «перевод на другую работу» и «перемещение». Переводом на другую работу в соответствии с комментируемой статьей является постоянное или временное изменение трудовой функции работника и (или) структурного подразделения, в котором работает работник (если структурное подразделение было указано в трудовом договоре), при продолжении работы у того же работодателя, а также перевод на работу в другую местность вместе с работодателем. Как следует из содержания приведенной нормы, изменение других условий, определенных трудовым договором (например, режима работы, оплаты труда), не является переводом на другую работу.

                  Перевод на другую работу, так же как и изменение других определенных сторонами условий трудового договора, возможен только с письменного согласия работника. Исключение из этого правила допускается лишь в случаях, указанных в ч. ч. 2 и 3 ст. 72.2 (см. коммент. к ней).

                  Если перевод на другую постоянную или временную работу у того же работодателя осуществлен без письменного согласия работника, но работник не возражал против такого перевода и приступил к выполнению другой работы, такой перевод может считаться законным. Однако выполнение работником другой работы не освобождает работодателя от обязанности получить от работника письменное подтверждение такого согласия на перевод.

                  В тех случаях, когда переведенный на другую работу у того же работодателя работник приступил к выполнению этой работы, но считает, что перевод осуществлен в нарушение законодательства, он может обжаловать незаконный перевод в органы по рассмотрению трудовых споров.

                  2. Перевод на другую постоянную работу или временный перевод на другую работу у того же работодателя, а также перевод на постоянную работу в другую местность вместе с работодателем оформляются приказом (распоряжением) работодателя по установленной форме.

                  При переводе на работу в другую местность работникам выплачиваются соответствующие компенсации: стоимость проезда самого работника и членов его семьи, стоимость провоза багажа, расходы по обустройству на новом месте и др. Конкретные размеры возмещения расходов определяются соглашением сторон трудового договора (см. коммент. к ст. 169).

                  Под другой местностью следует понимать местность за пределами административно-территориальных границ соответствующего населенного пункта (п. 16 Постановления Пленума ВС РФ от 17.03.2004 N 2).

                  Перевод на работу из одного населенного пункта в другой даже в пределах одного административного района рассматривается как перевод в другую местность независимо от наличия автобусного или иного регулярного сообщения между этими пунктами.

                  Отказ работника от перевода в другую местность вместе с работодателем является основанием для прекращения с ним трудового договора по п. 9 ст. 77 ТК. Отказ от перевода в филиал или представительство организации, расположенные в другой местности, не может являться основанием для расторжения трудового договора с работником, если сам работодатель в эту другую местность не перемещается (см. коммент. к ст. 77).

                  При увольнении работников в связи с отказом от перевода в другую местность вместе с работодателем им выплачивается выходное пособие в размере двухнедельного среднего заработка (ч. 3 ст. 178 ТК).

                  3. Перевод на работу к другому работодателю может быть осуществлен по просьбе работника, изложенной в письменной форме, или с его письменного согласия, если инициатива в переводе исходит от работодателя.

                  Перевод на постоянную работу к другому работодателю влечет изменение одной стороны трудового договора, поэтому он рассматривается законодателем как самостоятельное основание прекращения трудового договора (п. 5 ст. 77 ТК). Работнику, письменно приглашенному на работу в порядке перевода от другого работодателя, не может быть отказано в заключении трудового договора в течение одного месяца со дня увольнения с прежнего места работы (см. коммент. к ст. 64). В трудовой книжке работника в этом случае производятся записи об увольнении и о приеме на работу с указанием порядка, в котором осуществлено увольнение в связи с переводом — по просьбе работника или с его согласия (п. 6.1 Инструкции по заполнению трудовых книжек).

                  4. Перевод на другую постоянную работу или временный перевод на другую работу у того же работодателя возможен по различным обстоятельствам. При этом инициатива в переводе может исходить как от работодателя, так и от самого работника (например, в связи с тем, что он повысил квалификацию).

                  В ряде случаев у работодателя возникает обязанность перевести работника с его согласия на другую работу, например в случае, когда работник нуждается в соответствии с медицинским заключением в предоставлении другой работы (см. коммент. к ст. 73).

                  В тех случаях, когда работа, на которую переведен работник в соответствии с медицинским заключением, является нижеоплачиваемой, за работником сохраняется его прежний средний заработок в течение месяца со дня перевода, а при переводе в связи с трудовым увечьем, профессиональным заболеванием или иным повреждением здоровья, связанным с работой, — до установления стойкой утраты трудоспособности либо до выздоровления работника (см. коммент. к ст. 182).

                  В отдельных случаях, предусмотренных законодательством, работодатель обязан предложить работнику перевод на другую работу. Такая обязанность может возникнуть, например, при сокращении численности или штата, если у работодателя для работника, подлежащего сокращению, имеется другая работа (см. коммент. к ч. 3 ст. 81). Работодатель обязан предложить другую имеющуюся у него работу лицу, признанному по результатам аттестации не соответствующим занимаемой должности (см. коммент. к ст. 81).

                  5. От перевода работника на другую работу следует отличать его перемещение у того же работодателя на другое рабочее место, в другое структурное подразделение, расположенное в той же местности, поручение работы на другом механизме или агрегате. Такое перемещение согласно ч. 3 комментируемой статьи не требует согласия работника, если это не влечет изменения определенных сторонами условий трудового договора (см. коммент. к ст. 57).

                  Иными словами, изменение рабочего места или структурного подразделения можно признать перемещением только в том случае, если при заключении трудового договора это конкретное рабочее место (механизм, агрегат) или структурное подразделение не оговаривалось и в трудовом договоре не предусмотрено. Если же конкретное рабочее место (механизм, агрегат) или структурное подразделение указано в трудовом договоре, то оно является его обязательным условием и, следовательно, может быть изменено только с письменного согласия работника.

                  Под структурными подразделениями следует понимать как филиалы, представительства, так и отделы, цеха, участки и т.д. (п. 16 Постановления Пленума ВС РФ от 17.03.2004 N 2).

                  Другой комментарий к статье 72.1 ТК РФ

                  § 1. Одной из форм изменения трудового договора является перевод на другую работу.

                  ТК РФ в отличие от КЗоТа РФ закрепил легально в ст. 72.1 понятие перевода, выработанное наукой, и его отличие от перемещения, не требующего согласия работника.

                  В прежней редакции Трудового кодекса перевод на другую работу определялся как изменение трудовой функции или изменение существенных условий трудового договора.

                  Комментируемая статья (ч. 1) под переводом на другую работу понимает постоянное или временное изменение трудовой функции и (или) структурного подразделения, в котором работник работает, если в трудовом договоре было указано структурное подразделение, где он должен работать, при продолжении работы у того же работодателя, а также перевод работника на работу в другую местность вместе с работодателем.

                  Следует помнить, что без учета перечисленных категорий невозможно отграничить одну работу от другой и, соответственно, решать вопрос о наличии перевода на другую работу или отсутствии его.

                  § 2. Трудовая функция включает в себя должность в соответствии со штатным расписанием, профессию, специальность с указанием квалификации, вид поручаемой работнику работы.

                  Профессия — это постоянный вид трудовой деятельности работника, требующий специальных навыков и соответствующих знаний, приобретаемых в процессе производственно-технического обучения.

                  Специальность — это разновидность профессии, которая устанавливается в результате разделения труда (например, врач-окулист, инженер-механик и т.д.).

                  Квалификация — это степень и вид профессиональной обученности, т.е. уровень подготовки, опыта, знаний по данной специальности, определенный для рабочих разрядами работ, которые они выполняют.

                  Должность предопределяет границы компетенции работника, его права, обязанности и степень ответственности.

                  Следовательно, перевод на другую работу — это другая работа по сравнению с оговоренной в трудовом договоре, если структурное подразделение не было указано в тексте договора.

                  § 3. Законодатель не определяет понятия другой местности. Таковое дается в п. 16 Постановления Пленума Верховного Суда РФ от 17 марта 2004 г. N 2 «О применении судами Российской Федерации Трудового кодекса Российской Федерации» (БВС РФ. 2004. N 6). Под другой местностью следует понимать местность за пределами административно-территориальных границ соответствующего населенного пункта. И далее оно разъясняет, что если в трудовом договоре работника было указано конкретное структурное подразделение как место его работы, то изменение этого структурного подразделения возможно лишь с письменного согласия работника, т.е. это будет перевод, а не перемещение, как если бы трудовой договор не оговаривал конкретное подразделение. Под структурным подразделением организации следует понимать как филиалы, представительства, так и отделы, цеха, участки и т.п.

                  Повышение и понижение в должности также является переводом, требующим согласия работника.

                  § 4. Перевод на другую работу по действующему трудовому законодательству допускается только с письменного согласия работника. Это общее правило, из которого, однако, законодатель устанавливает исключения для случаев, предусмотренных ч. 2 и 3 ст. 72.2 ТК (см. комментарий к ней).

                  Если письменного согласия работника на перевод получено не было, но он добровольно приступил к выполнению другой работы, такой перевод может считаться законным.

                  § 5. На основании ч. 2 ст. 72.1 ТК по письменной просьбе работника или с его письменного согласия может быть осуществлен перевод на другую постоянную работу к другому работодателю.

                  В этом случае трудовой договор по прежнему месту работы прекращается по п. 5 ст. 77 ТК (см. комментарий к ней).

                  § 6. Законодатель дает понятие перемещения, которое следует отличать от перевода на другую работу. Так, ч. 3 ст. 72.1 ТК предусматривает, что не требуется согласия работника на его перемещение у того же работодателя на другое рабочее место, в другое структурное подразделение, но расположенное в той же местности, поручение ему работы на другом механизме или агрегате, если это не влечет за собой изменения определенных сторонами условий трудового договора.

                  § 7. Рассматриваемая статья запрещает переводить и перемещать работника на работу, противопоказанную ему по состоянию здоровья. Во избежание таких случаев работник должен иметь соответствующие документы, что является для него одной из юридических гарантий.

                  Перевод сотрудника в другую организацию без его согласия

                  Содержание статьи

                  Такая процедура, как перевод работника на другую должность либо в иное подразделение предприятия, должна осуществляться в строгом соответствии с существующими требованиями. В противном случае, она будет признана незаконной. Существующая практика знает немало случаев, когда сотрудников практически принуждали переходить на иную работу, которая, в большинстве случаев, имела худшие условия, по сравнению с первоначальным местом исполнения ими профессиональных обязанностей.

                  🔥 Так можно ли осуществить перевод, не спрашивая согласия у сотрудника?

                  Перевод на основании действующих положений ТК РФ

                  Перевод сотрудника всегда представляет собой достаточно серьезную процедуру. Ведь в ходе нее происходит изменение его текущих трудовых функций, обязательств, а иногда даже и навыков, в зависимости от того, насколько новая должность отличается от старой.

                  Если в действующем трудовом договоре с сотрудником указано, что он осуществляет свою деятельность в филиале, внесение соответствующих изменений также должно признаваться полноценным переводом. Сюда также можно отнести и ситуации, когда юридическое лицо меняет адрес своего расположения. Такие изменения также должны быть признаны переводом, ведь нахождение рабочего места сотрудника теперь изменилось.

                  При этом постоянный перевод, в обязательном порядке, предварительно должен быть согласован с сотрудником.

                  Перевод без согласия

                  Осуществление перевода без согласия сотрудника возможно только в исключительных случаях. При этом важнейшим условием будет выступать тот факт, что данный перевод может быть осуществлен только на один календарный месяц и не более.

                  Принудительный перевод может быть осуществлен в исключительных ситуациях, например, в случае катастрофы на производстве, серьезной аварии и иных форс-мажорных обстоятельств, которые препятствуют дальнейшему осуществлению трудовой деятельности в данном месте. Принудительный перевод также может быть исполнен и для того, чтобы все последствия вышеуказанных событий были как можно быстрее устранены.

                  Временный перевод сотрудника без его согласия может быть признан правомерным и в нескольких дополнительных случаях, например:

                  • временное приостановление деятельности на производстве по обоснованным причинам;
                  • в целях предотвращения порчи имущества работодателя, если такая угроза действительно существует;
                  • при появлении срочной необходимости замены временно отсутствующего на работе сотрудника.

                  Во всех остальных случаях принудительный перевод может быть расценен как грубейшее нарушение прав сотрудника. Получение согласия также будет обязательным и в случае, если новая должность характеризуется более низкой квалификацией, чем первоначальная.

                  Таким образом, временный перевод без согласия сотрудника может быть возможен только в самых исключительных и редких случаях.

                  🔥 Может ли работник дать свой отказ в отношении перевода?

                  Любой сотрудник будет иметь законное право на выдачу отказа от перевода в следующих ситуациях:

                  Работаю в одном юридическом лице. Работодатель хочет перевести в другое юрлицо без определенных причин (ротация персонала). Правомерно ли это?

                  Могу ли я отказаться, сохранив прежнее рабочее место?

                  Григорий Арутюнян
                  Консультаций: 640

                  Согласно абз. 1 ч. 2 ст. 57 Трудового кодекса РФ обязательным для включения в трудовой договор является условие о месте работы, а в случае, когда работник принимается для работы в филиале, представительстве или ином обособленном структурном подразделении организации, расположенном в другой местности, – место работы с указанием обособленного структурного подразделения и его местонахождения.

                  Согласно ст. 60 ТК РФ запрещается требовать от работника выполнения работы, не обусловленной трудовым договором, за исключением случаев, предусмотренных ТК РФ и иными федеральными законами.

                  Согласно ст. 72 ТК РФ изменение определенных сторонами условий трудового договора, в том числе перевод на другую работу, допускается только по соглашению сторон трудового договора, за исключением случаев, предусмотренных ТК РФ. Соглашение об изменении определенных сторонами условий трудового договора заключается в письменной форме.

                  Согласно ч. 1 ст. 72.1 ТК РФ перевод на другую работу – постоянное или временное изменение трудовой функции работника и (или) структурного подразделения, в котором работает работник (если структурное подразделение было указано в трудовом договоре), при продолжении работы у того же работодателя, а также перевод на работу в другую местность вместе с работодателем. Перевод на другую работу допускается только с письменного согласия работника.

                  Из приведенных норм следует, что место работы является существенным условием трудового договора, которое изменять в одностороннем порядке, без письменного согласия работника, закон запрещает. Перевод «в другое юрлицо» означает смену работодателя, пусть даже это аффилированная организация.

                  Поэтому описанный в вопросе «перевод» при отсутствии письменного согласия работника является незаконным.

                  Либо работник отстаивает свое право и остается на прежнем месте работы (если оно не ликвидировано), либо обращается за защитой своих прав в Гострудинспекцию в Самарской области или в суд по адресу юрлица (или месту жительства работника).

                  По общему правилу перевод на другую работу осуществляется только с письменного согласия работника, ведь трудовая функция работника, а также место работы являются существенными условиями трудового договора. Вместе с тем, трудовое законодательство разрешает в строго определенных случаях переводить работника без его согласия. Рассмотрим их.

                  Случаи, когда допускается перевод без письменного согласия работника, определены в статье 72.2 Трудового кодекса РФ. Работник может быть переведен без его согласия на не обусловленную трудовым договором работу у того же работодателя для предотвращения или устранения последствий:

                  • катастроф природного или техногенного характера
                  • производственных аварий
                  • несчастных случаев на производстве
                  • пожаров, наводнений, голода, землетрясения, эпидемий или эпизоотий
                  • любых исключительных случаев, ставящих под угрозу жизнь или нормальные жизненные условия всего населения или его части

                  Также допускается без получения согласия работника его перевод на другую работу у того же работодателя в случаях:

                  • простоя (то есть временной приостановки работы по причинам экономического, технологического, технического или организационного характера)
                  • необходимости предотвращения уничтожения или порчи имущества
                  • замещения временно отсутствующего работника

                  Следует отметить, что указанные выше ситуации должны быть вызваны чрезвычайными обстоятельствами. При этом, перевод на работу, требующую более низкой квалификации, допускается только с письменного согласия работника.

                  🔻 На какой срок допускается перевод работника на другую работу без его согласия?

                  Работодатель вправе переводить работника без его согласия на работу, не обусловленную трудовым договором на срок до одного месяца.

                  🔻 Может ли работник отказаться от перевода в вышеуказанных ситуациях?

                  Отказ работника от такого перевода Трудовым кодексом РФ не предусмотрен. Поэтому, если работник отказывается выполнять работу в новых условиях или, вообще, не вышел на работу, его можно привлечь к дисциплинарной ответственности.

                  🔻 Как оплачивается работа при переводе, осуществляемом без согласия работника?

                  При временных переводах, осуществляемых без согласия работника, оплата его труда производится по выполняемой работе, но не ниже среднего заработка по прежней работе.

                  Работодатель по закону может перевести сотрудника на другую работу. В ряде случаев можно это сделать без согласия самого человека. Подобные возможности определяются трудовым законодательством.

                  Содержание

                  🔥 Учет мнения сотрудника

                  Перевод – это изменение трудовых функций, выполняемых сотрудником или его подразделением в организации либо переезд вместе с работодателем в другую местность. Перевод может носить временный либо постоянный характер.

                  Ст. 72 ТК определяет, что перевод может быть осуществлен только по соглашению сторон. Подобное соглашение заключается в письменной форме и подписывается участниками.

                  Согласия работника не требуется, если он перемещается на иное рабочее место, в другой отдел или начинает исполнять свои трудовые функции на другом механизме, агрегате при сохранении прежних условий трудовых отношений между сторонами. То есть за работником сохраняется его должность, его зарплата, он остается проживать по прежнему месту.

                  По закону запрещено переводить человека на иной вид трудовой деятельности, если по состоянию здоровья он не может выполнять подобные обязанности.

                  Переход из одной организации в другую производится на основании письменного заявления сотрудника с его письменным согласием. В этом случае договор по прежнему месту работы расторгается.

                  Временный перевод осуществляется на срок до одного года либо на время отсутствия основного сотрудника. В последнем случае условием окончания пребывания работника на временной должности будет момент выхода на занимаемую им должность основного сотрудника. Если после окончания установленных сроков сотрудник не был возвращен на свою прежнюю позицию, и он не потребовал восстановления в прошлой должности, временный характер перевода утрачивает силу.

                  В этом случае новое место становится постоянным.

                  🔥 Перевод без согласия

                  Переместить сотрудника допускается и без его согласия. Сделать это можно на временной основе. Срок перевода – максимум 1 месяц.

                  Подобное перемещение возможно в следующих случаях, предусмотренных ст. 72.2 ТК:

                  • катастрофа природного, техногенного характера; , наводнение, голод, землетрясение, эпидемии;
                  • авария;
                  • иные критические ситуации, угрожающие благополучию всего населения или его части;
                  • производственная необходимость.

                  При наличии вышеперечисленных условий допускается перевод сотрудника без его согласия на иную должность, требующую выполнения принципиально иных трудовых обязанностей. Эти обязанности могут выражаться в совершении действий, направленных на предотвращение критических ситуаций или устранение их последствий.

                  При переводе на иную работу без согласия человека за ним сохраняется средний заработок, получаемый по прежнему месту.

                  Временный перевод без согласия ограничивается рядом условий:

                  1. Не допускается выполнение на новом месте действий, противопоказанных сотруднику по здоровью. Например, сотрудник бухгалтерии переводится на должность кладовщика, сопряженную с необходимостью периодически поднимать тяжести. При наличии у сотрудника бухгалтерии необходимой справки не допускается его перемещение на неподходящую должность даже при наличии оснований для временного перевода без согласия.
                  2. Перевести можно на срок, не превышающий одного месяца.
                  3. Филиалы организаций относятся к одному юридическому лицу. По этой причине перевод без согласия из одного филиала в другой не запрещен.
                  4. При превышении размера заработной платы на новом месте дохода сотрудника на прежнем месте его труд оплачивается в соответствии с уровнем зарплаты на новой должности.
                  5. При более высоком размере заработной платы на старом месте за сотрудником сохраняется его средний заработок. Не допускается понижение уровня дохода работника в результате его перемещения.
                  6. Сотрудник должен быть уведомлен кадровой службой о принятом в отношении его решении. Для осуществления перемещения создается соответствующий приказ.

                  🔻 Производственная необходимость

                  Чаще всего на практике перевод без согласия происходит вследствие производственной необходимости:

                  • избегание простоя;
                  • предотвращение уничтожения, порчи имущества;
                  • замещение отсутствующего работника.

                  Перевод осуществляется на срок, не превышающий один месяц.

                  🔥 Получение письменного согласия

                  Временный перевод по производственной необходимости либо с целью предотвращения критических ситуаций или устранения их последствий может осуществляться без согласия сотрудника. Исключение – если в результате передвижки происходит назначение на более низкую должность (по уровню квалификации). В этом случае необходимо получение согласия.

                  Во всех остальных случаях, не предусмотренных ст. 72.2 ТК, перевод возможен только на основании письменного согласия.

                  🔥 Пути решения проблемы

                  Нередко у работодателей возникает намерение перевести сотрудника на другое место. Отсутствие согласия со стороны работника ставит его начальство перед необходимостью поиска альтернативных способов осуществления запланированного перемещения в рамках трудового законодательства.

                  Самый распространенный вариант – оформление временного перевода (производственная необходимость). В этом случае согласия не требуется. Подводный камень – ограничение по сроку.

                  Работодатель не может задерживать человека на иной должности более чем на месяц.

                  Статья раскроет основную информацию, касающуюся перевода сотрудника на иную работу.

                  Дорогие читатели! Статья рассказывает о типовых способах решения юридических вопросов, но каждый случай индивидуален. Если вы хотите узнать, как решить именно Вашу проблему — обращайтесь к консультанту:

                  ЗАЯВКИ И ЗВОНКИ ПРИНИМАЮТСЯ КРУГЛОСУТОЧНО и БЕЗ ВЫХОДНЫХ ДНЕЙ.

                  Это быстро и БЕСПЛАТНО!

                  Дорогие читатели! Статья рассказывает о типовых способах решения юридических вопросов, но каждый случай индивидуален. Если вы хотите узнать, как решить именно Вашу проблему — обращайтесь к консультанту:

                  ЗАЯВКИ И ЗВОНКИ ПРИНИМАЮТСЯ КРУГЛОСУТОЧНО и БЕЗ ВЫХОДНЫХ ДНЕЙ.

                  Это быстро и БЕСПЛАТНО!

                  Возможно ли осуществить процесс без его согласия, что для этого понадобится и каковы законные основания перевода – об этом далее.

                  Бывают случаи, когда работодателю необходимо перевести сотрудника на другую должность или в другую организацию. Для этого необходимо уведомлять работника заранее и учитывать его мнение.

                  Содержание

                  Сотрудник должен написать заявление, в котором соглашается с переводом. Что делать в случае, если работник не согласен? Допускается ли перевод без его соглашения?

                  Законно ли это?

                  🔥 Что нужно знать ↑

                  Чтобы осуществить процедуру перевода, необходимо следовать Закону. В противном случае – правонарушение и его можно оспорить в суде.

                  Существует множество вариантов, когда перевод возможен без согласия сотрудника и они законны. Основные причины перевода:

                  Необходимость Вызванная производственными проблемами
                  Приостановка работы организации На определенное время
                  Замещение работника Который временно отсутствует

                  Перевод возможен только при наличии письменного согласия сотрудника. Если работа нанесет вред здоровью, то работодатель не вправе переводить на такую должность.

                  В каких случаях возможен перевод:

                  • работодатели сотрудничают между собой, то есть после смены рабочего места сотрудник продолжает свою деятельность в таких же условиях, только в другой организации;
                  • работодатели являются дочерней и главной компаниями;
                  • между руководителями существуют договорные отношения.

                  Новый работодатель не вправе отказывать сотруднику, и обязан оформить с ним трудовой договор.

                  Документы, которые необходимо оформить при переводе:

                  • приказ о расторжении трудового договора; ;
                  • оформить запись в трудовой книжке об увольнении, указав причину;
                  • выдать сотруднику необходимые документы – ксерокопии приказов, выписку из трудовой книжки, справку о зарплате.

                  Это касается прежнего места работы. На новом рабочем месте сотруднику обязаны предоставить следующую документацию:

                  • новый трудовой договор; ;
                  • завести личную карточку;
                  • ознакомить с нормативными документами и правилами предприятия;
                  • сделать запись в трудовой книжке.

                  Перевод без согласия работника возможен только в тех случаях, если возникает необходимость исправить неполадки в производстве, предотвратить несчастные случаи или заменить другого сотрудника.

                  При этом не играет роли должность работника, его квалификация. Но продолжительность такого перевода не может превышать 1 месяц.

                  Если заработная плата на новом рабочем месте выше, то работодатель не имеет права ее понижать.

                  При переводе без согласия работника важно помнить о следующих особенностях:

                  1. Законодательство допускает такой перевод, но при возникновении определенных обстоятельств.
                  2. Обстоятельства эти указаны в Законах.
                  3. Срок – до одного месяца. То есть, если сотрудника перевели, например, 10 февраля, то срок перевода заканчивается 9 марта. 10 марта он уже обязан вернуться на свое основное место работы. Работодатель не имеет права его задерживать.
                  4. Переводить можно всего один раз в год.

                  Если возникает трудовой спор, то работодатель должен обосновать причины перевода сотрудника без его согласия.

                  🔻 Определения

                  Перевод на другую работу Изменение трудовых обязанностей работника в связи с определенными обстоятельствами. Бывает постоянный и временный. Постоянный разрешен только с согласия сотрудника. Временный перевод длится не больше года
                  Перевод работника на другую работу без согласия работника Это перевод лица на иную должность или в другую организацию по определенным причинам, обычно угрожающим жизни людей
                  Трудовой спор Возникающие между сотрудниками и работодателем разногласия, касающиеся трудовых отношений
                  Комиссия по рудовым спорам Уполномоченный орган, занимающийся разбирательством отношений между работодателем и сотрудником
                  Производственная необходимость Непредвиденная ситуация, возникающая на производстве по определенным причинам, в исключительных случаях
                  Временный перевод Перевод сотрудника на определенный промежуток времени. Возникает в случае аварий на предприятии или для замещения основного работника

                  🔻 Зачем это нужно

                  Перевод на иное рабочее место выполняет множество функций:

                  • является способом перераспределения рабочей силы с целью рационального ее использования;
                  • выполняет функцию поощрения (при повышении) или наказания сотрудников:
                  • считается средством охраны труда и здоровья, например, при переводе на работу с облегченными условиями;
                  • является способом спасения имущества организации – при природных бедствиях, несчастных случаях на производстве.

                  🔻 Нормативное регулирование

                  Трудовое Законодательство гарантирует каждому сотруднику защиту его трудовых отношений и соблюдение тех условий труда, которые устанавливались при заключении договора.

                  Статья 72.1 Трудового Кодекса устанавливает различные типы переводов.

                  Перевод на другую работу без согласия работника допускается в некоторых случаях, вызванных необходимостью на производстве.

                  Образец приказа о переводе на другую должность внутри организации смотрите в статье: приказ о переводе на другую работу работника.

                  Возможен ли перевод на другую должность по ТК РФ, читайте здесь.

                  Законодательство не дает четкого определения данным причинам. Обычно это – потребность в тех случаях, которые возникают внезапно, непредвиденно и их необходимо немедленно устранить.

                  В соответствии со статьей 72.2 ТК, перестановка в кадрах возникает вследствие таких факторов:

                  1. Катастрофа в любом проявлении.
                  2. Авария на производстве.
                  3. Несчастные случаи.
                  4. Природные бедствия – пожар, наводнение и прочие.
                  5. Эпидемия.
                  6. Другие обстоятельства, вызывающие угрозу жизни населения.

                  Можно ли перевести работника без его согласия без проблем? В случае нарушения норм Законодательства грозит ответственностью.

                  Если сотрудника переводят без его согласия, то ущемляются его права, и он может обратиться с жалобой в комиссию по трудовым спорам.

                  Дело может дойти до судебного разбирательства. Об этом говорится в 362 статье Трудового Кодекса Российской Федерации.

                  60 статья Трудового Кодекса запрещает работодателям требовать от сотрудника выполнения той деятельности, которая не предусмотрена трудовым договором.

                  Согласно статье 72.1 Трудового Кодекса перевод сотрудника без его согласия возможен, если не меняется организация.

                  То есть, сотрудник продолжает осуществлять свою деятельность в той же организации, но на другой должности или механизме.

                  2 и 3 части статьи 72.2 Трудового Кодекса устанавливает несколько причин, по которым возможен перевод без согласия сотрудника:

                  В случае природной катастрофы Арии или несчастного случая на производстве, которые несут угрозу населению. Перевод возможен сроком до 1 месяца и только у того же работодателя
                  Если возникла необходимость Приостановить на время производство

                  🔥 Перевод работника на другую работу без его согласия ↑

                  Как упоминалось выше, перевод сотрудника на другую работу без его согласия возможен только в случаях, предусмотренных Законодательством.

                  Если работник отказывается от перевода или не выходит на работу, то его можно привлечь к ответственности дисциплинарного характера.

                  Не требует согласия работника перевод в случаях, когда он остается на том же предприятии. То есть условия договора не меняются, оклад и заработная плата остаются прежними.

                  Могут ли перевести сотрудника на иную должность без его согласия – ответ необходимо искать, ссылаясь на нормы Законодательства.

                  🔻 Основная схема процесса

                  Переводить сотрудника на другую должность разрешено только при написании им письменного заявления.

                  Без согласия работника можно переводить только в случаях возникновения простоя в организации или необходимости, вызванной чрезвычайной ситуацией.

                  Схема действий проста – работодатель оформляет приказ о переводе. Продолжительность перевода не должна превышать одного месяца. В противном случае это считается нарушением прав.

                  Если процесс перевода осуществился, то за сотрудником сохраняется размер его заработной платы и она не должна быть ниже.

                  Если же на новом месте зарплата выше, то работнику обязаны ее начислять. Если данные права будут нарушены, то сотрудник вправе отказаться приступать к работе.

                  Как только месяц истекает, работодатель снова должен принять сотрудника на его основное место. Все действия, связанные с переводом, фиксируются в трудовой книжке.

                  🔻 На другую должность

                  Работника могут перевести на другую должность сроком до 1 года, но только у того же работодателя и при оформлении письменного заявления.

                  Если на производстве возникают непредвиденные обстоятельства, то работника могут перевести на иную должность без его согласия.

                  Но срок не должен превышать 1 месяц. Сотрудник вправе отказаться от перевода, если:

                  Новая должность причинит вред Его здоровью
                  Условия труда тяжелые и опасные Что не предусмотрено трудовым договором

                  Если сотрудника перевели на другую должность без его согласия и тот отказался, то его нельзя привлекать к ответственности. Кроме случаев, описанных выше (непредвиденные обстоятельства).

                  🔻 Если временный перевод

                  Временный перевод без согласования с сотрудником допускается:

                  • для предотвращения или устранения последствий бедствий стихийного характера;
                  • по причине иных обстоятельств, которые угрожают жизни.

                  Временный перевод на иную должность нельзя осуществлять по отношению к беременным женщинам, лиц моложе 18-ти лет – даже без их согласия.

                  При таком переводе может изменяться трудовая деятельность сотрудника, структурное подразделение, но никак не работодатель. Также нельзя устанавливать испытательный срок.

                  Как же оформить такой перевод? Существует несколько шагов:

                  Руководитель организации формирует приказ о временном переводе, форма которого – Т-5 В документе указывается причина перевода, в приказе она имеет название «основание для перевода». К приказу обязательно необходимо приложить документы, подтверждающие необходимость перевода. Это может быть – свидетельства очевидцев аварии, заявление работников предприятия о простое на производстве и прочее
                  Ознакомление сотрудника с техникой безопасности на предприятии Обращением с механизмами и оборудованием. Обязательно под роспись работника

                  Приказ должен иметь свой регистрационный номер, дату составления и подпись руководителя организации.

                  С приказом сотрудник должен быть своевременно осведомлен, на нем он делает отметку «ознакомлен» и подписывает документ.

                  Отказаться от временного перевода на другую должность работник имеет право. В том случае, если это угрожает его жизни или принесет вред здоровью.

                  При этом сотрудник должен написать письменное заявление с указанием причин отказа.

                  Аргументы должны быть четко обоснованы. Также необходимо сделать ксерокопию приказа с подписью сотрудника.

                  Откуда взять справку о наличии судимости при приеме на работу узнайте из статьи: справка о судимости при приеме на работу.

                  Виды договоров при приеме на работу, читайте здесь.

                  Общие условия приема на работу, смотрите здесь.

                  Приказ должен содержать правила перевода и обязательно начало и окончание срока. Если в документе не установлена дата первого дня перевода и сотрудник не явился на работу, то прогулом это не считается.

                  Труд необходимо оплачивать с самого первого дня перевода. Обязательно в документе указать дату окончания перевода. Срок не может превышать один месяц.

                  Таким образом, перевод сотрудника на иную должность возможен в исключительных случаях, предусмотренных Законодательством.

                  Работник вправе отказаться, если определит, что это угрожает его здоровью или жизни. В случае незаконного перевода на другую работу руководителю выдвигают ответственность.

                  Если возникла производственная необходимость, то в приказе о переводе обязательно необходимо это указать.

                  Иначе – это правонарушение. Допускается осуществлять перевод на другую работу не более одного месяца в год.

                  При этом не учитывается квалификация сотрудника, но заработная плата на новом месте не может быть ниже основной.

                  • В связи с частыми изменениями в законодательстве информация порой устаревает быстрее, чем мы успеваем ее обновлять на сайте.
                  • Все случаи очень индивидуальны и зависят от множества факторов. Базовая информация не гарантирует решение именно Ваших проблем.

                  Поэтому для вас круглосуточно работают БЕСПЛАТНЫЕ эксперты-консультанты!

                  ЗАЯВКИ И ЗВОНКИ ПРИНИМАЮТСЯ КРУГЛОСУТОЧНО и БЕЗ ВЫХОДНЫХ ДНЕЙ.

                  Источники информации

                  http://xn—-8sbeh0ahhpccbdsxemcdk5p.xn--p1ai/article/perevod/perevod-sotrudnika-bez-ego-soglasiya.html

                  http://pravo.rg.ru/rubrics/question/20109/

                  http://experto24.ru/pravo/trudovoe-pravo/v-kakikh-sluchajakh-dopuskaetsja-perevod-rabotnika-bez-soglasija-rabotnika.html

                  Возможность перевода сотрудника без его согласия на другую работу в соответствии с Трудовым кодексом РФ

                  http://buhonline24.ru/kadry/perevod/perevod-na-druguju-rabotu-bez-soglasija-rabotnika. html

                  КС указал на недопустимость увольнения работника из-за его несогласия на перевод в другую местность

                  Одна из экспертов отметила, что суды и ранее довольно часто придерживались позиции, что в ситуации, когда обязанности работника передаются в другое подразделение, будет иметь место не изменение условий трудового договора, а сокращение штата. У другого эксперта выводы, изложенные в постановлении, вызвали опасения с точки зрения соблюдения баланса прав сторон трудового договора: по ее мнению, теперь суды будут чаще признавать незаконными изменения условий трудового договора в порядке ст. 74 ТК, а работодателям придется в большем количестве случаев проводить сокращение численности или штата работников.

                  20 января Конституционный Суд РФ вынес Постановление № 3-П по жалобе на неконституционность ряда норм ТК, позволяющих судам, по мнению заявителя, признавать законным изменение работодателем в одностороннем порядке условия трудового договора о месте работы, а работодателю – предлагать работнику вакансии в обособленном структурном подразделении, расположенном в другой местности, а также допускающих увольнение по такому основанию, как отказ от продолжения работы при изменении определенных сторонами условий трудового договора, а не в связи с сокращением численности или штата.

                  Отказ продолжить работу в другой местности и на другой должности повлек увольнение

                  Андрей Пешков с ноября 2015 г. работал по трудовому договору в филиале ФКУ «Центр по обеспечению деятельности Казначейства России» по Мурманской области рабочим по комплексному обслуживанию и ремонту зданий. Трудовые обязанности он фактически выполнял в г. Оленегорске Мурманской области.

                  С 1 июля 2016 г. Андрей Пешков был переведен в отдел № 3 регионального филиала ФКУ «ЦОКР» в г. Санкт-Петербурге. В качестве места исполнения трудовых обязанностей в допсоглашении к договору был указан г. Мурманск, где находилось данное подразделение.

                  В апреле 2017 г. Андрею Пешкову было вручено уведомление об изменении условий трудового договора касательно места работы. Изменение было связано с передачей функционала, ранее выполняемого им, третьему лицу (ИП) по госконтракту. В качестве нового места работы Пешкову были предложены Архангельская область и Республика Карелия. Изменение трудовой функции при этом не предполагалось. Андрей Пешков с изменением условий договора не согласился. Позднее (в апреле, мае и июне 2020 г.) ему были предложены иные вакантные должности в межрегиональном филиале ФКУ «ЦОКР» – в г. Архангельске и г. Петрозаводске, однако Пешков от них также отказался. В итоге в июне 2020 г. он был уволен на основании п. 7 ч. 1 ст. 77 (отказ от продолжения работы в связи с изменением определенных сторонами условий трудового договора) ТК РФ.

                  Не согласившись с основанием увольнения, Андрей Пешков обратился в суд с требованием изменить формулировку на п. 2 ч. 1 ст. 81 (сокращение численности или штата организации) ТК, а также компенсировать моральный вред. Отказывая в удовлетворении исковых требований, суд указал, что изменение условий трудового договора было обусловлено организационными изменениями, в результате которых у работодателя отпала необходимость осуществления эксплуатационно-технического обслуживания зданий силами работников, к категории которых относился истец, что повлекло невозможность сохранения для них прежних условий трудовых договоров. При этом работодателем были соблюдены требования, предусмотренные ст. 74 ТК. Сохранение в штатном расписании на момент увольнения Андрея Пешкова должностей рабочих по комплексному обслуживанию и ремонту зданий, как и невнесение изменений в структуру управления организации, не свидетельствовало, по мнению суда, об отсутствии изменения организационных условий труда, повлекших изменение условий труда заявителя. Решение устояло в апелляции и кассации. В передаче жалобы на рассмотрение Верховного Суда РФ также было отказано.

                  В жалобе в Конституционный Суд Андрей Пешков указал на неконституционность ст. 74 и п. 7 ч. 1 ст. 77 ТК как позволяющих судам признавать законным изменение работодателем в одностороннем порядке условия трудового договора о месте работы, а работодателю – предлагать работнику имеющиеся вакантные должности в обособленном структурном подразделении, расположенном в другой местности, и в случае отказа от предложенных вакантных должностей допускающих увольнение такого работника по такому основанию, как отказ от продолжения работы при изменении определенных сторонами условий трудового договора, а не в связи с сокращением численности или штата работников организации.

                  Оспариваемые нормы ТК признаны конституционными

                  Рассмотрев жалобу, КС со ссылкой на свои ранее высказанные правовые позиции напомнил, что свобода труда проявляется прежде всего в договорном характере труда и свободе трудового договора: именно в рамках трудового договора на основе соглашения работника и работодателя решается вопрос о работе по определенной должности, профессии, специальности и других условиях, включая место работы. При этом в силу общеправовых принципов добросовестного исполнения сторонами договора своих обязательств и стабильности договора условия применения труда работника, согласованные сторонами при заключении договора, должны соблюдаться, а их изменение, по общему правилу, возможно лишь по обоюдному согласию сторон.

                  Наряду с этим, добавил Суд, Конституция гарантирует свободу экономической деятельности, поддержку конкуренции, признание и защиту равным образом частной, государственной, муниципальной и иных форм собственности. Поскольку предпринимательская и иная экономическая деятельность, как правило, предполагает использование наемного труда, работодатель наделяется необходимыми полномочиями на организацию и управление трудом, позволяющими не только определять (в частности, в порядке локального нормотворчества), но и – при наличии объективных причин производственного, экономического или организационного характера – изменять условия труда работников, а также самостоятельно и под свою ответственность принимать необходимые, обусловленные такими изменениями кадровые решения. При этом законодательство должно содержать правовые меры защиты работника как экономически более слабой в трудовом правоотношении стороны от произвольного изменения работодателем условий трудового договора.

                  КС заметил, что когда работник принимается на работу в обособленном структурном подразделении, расположенном в местности за пределами административно-территориальных границ того населенного пункта, в котором находится работодатель, то условие трудового договора о месте работы должно включать указание на конкретное обособленное структурное подразделение и точное место его нахождения. При этом ТК запрещает требовать от работника выполнения работы, не обусловленной трудовым договором, за исключением случаев, предусмотренных Кодексом и иными федеральными законами (ст. 60), а также, по общему правилу, не допускает одностороннего изменения любых условий трудового договора (ст. 72 ТК).

                  Вместе с тем, отмечается в постановлении, из общего правила о взаимном согласии сторон на изменение условий трудового договора предусмотрены исключения, одно из которых связано с объективной невозможностью сохранения прежних условий вследствие изменений организационных или технологических условий труда (ч. 1 ст. 74). При этом работодатель обязан письменно уведомить работника о предстоящих изменениях и их причинах не позднее чем за два месяца (если иной срок не предусмотрен ТК). Если работник не согласен на новые условия, работодатель обязан предложить ему другую имеющуюся работу (как вакантную должность или работу, соответствующую квалификации работника, так и вакантную нижестоящую должность или нижеоплачиваемую работу), которую работник может выполнять с учетом его состояния здоровья. В данном случае работодатель обязан предлагать работнику все отвечающие указанным требованиям вакансии, имеющиеся у него в данной местности. «Предлагать же вакансии в других местностях работодатель обязан лишь при условии, что такая обязанность предусмотрена коллективным договором, соглашениями, трудовым договором», – обратил внимание КС.

                  В этом смысле положения ст. 74 ТК, предоставляя работнику время, достаточное для принятия решения о продолжении работы в новых условиях (но в рамках прежней трудовой функции), а также возлагая на работодателя – в случае отказа работника – обязанность принять меры, направленные на сохранение с ним трудовых отношений, не только согласуются с конституционными предписаниями, но и обеспечивают защиту конституционно значимого интереса работника в стабильной занятости, подчеркивается в постановлении.

                  В свою очередь, ч. 4 ст. 74 Кодекса, предусматривающая прекращение трудового договора при отсутствии у работодателя другой работы, которую работник мог бы выполнять с учетом его квалификации и состояния здоровья, либо при отказе работника от предложенной работы, во взаимосвязи с п. 7 ч. 1 ст. 77, закрепляющим соответствующее основание увольнения, призвана учитывать объективную невозможность сохранения трудовых отношений при несогласии работника с изменением условий трудового договора из-за изменения организационных или технологических условий труда, а также обеспечивать определенность его правового положения в возникшей ситуации. При этом специальной гарантией является выплата такому работнику выходного пособия в размере двухнедельного среднего заработка (ч. 7 ст. 178 ТК).

                  Таким образом, указал Конституционный Суд, работодателем не могут быть изменены не только трудовая функция работника, что непосредственно установлено ч. 1 ст. 74 ТК, но и условие трудового договора, определяющее структурное подразделение, где трудится работник. Это касается и изменения условия договора о месте работы в обособленном структурном подразделении, расположенном вне места нахождения работодателя (в другой местности) и в силу ч. 2 ст. 57 Кодекса подлежащем обязательному указанию в трудовом договоре. «Соответственно, поручение работнику работы хотя и по той же трудовой функции, которая предусмотрена заключенным с ним трудовым договором, но в ином обособленном структурном подразделении, отличном от указанного в трудовом договоре, следует рассматривать как перевод на другую работу, который допускается только в порядке, установленном действующим законодательством, т.е. с согласия работника (ст. 72 и ч. 1 ст. 72.1 Трудового кодекса Российской Федерации)», – пояснил КС.

                  Предоставление работодателю права изменять без согласия работника условие договора о месте работы, включая обособленное структурное подразделение, являющееся фактическим местом исполнения трудовых обязанностей, не только нивелировало бы смысл и целевое предназначение законодательных норм о переводе на другую работу, но и влекло бы ущемление конституционного права каждого на свободное распоряжение своими способностями к труду, а также нарушение принципа запрета принудительного труда и не обеспечивало надлежащую защиту работника как экономически более слабой в трудовом правоотношении стороны. Соответственно, резюмировал Суд, положения ч. 1–4 ст. 74 ТК во взаимосвязи с п. 7 ч. 1 ст. 77 не могут расцениваться как не согласующиеся с конституционными предписаниями.

                  Касательно передачи работодателями отдельных видов работ на аутсорсинг, КС заметил, что такая практика в последние годы получила широкое распространение. При этом заключение работодателем гражданско-правовых договоров с третьими лицами по общему правилу исключает продолжение работником, обеспечивавшим выполнение передаваемых на аутсорсинг видов работ, своей прежней работы, поскольку его трудовая функция, определенная трудовым договором, объективно не может быть сохранена.

                  Вместе с тем, пояснил Суд, передача отдельных видов работ на аутсорсинг не может служить достаточным основанием для признания возникновения у работодателя эффекта изменения организационных или технологических условий труда, вызвавших необходимость изменения условий трудовых договоров с работниками, чьи функции переданы третьи лицам, в порядке ст. 74 ТК: исходя из буквального смысла ч. 1 такого рода изменение условий труда предполагает сохранение в сфере самостоятельного хозяйствования данного работодателя тех видов работ, которые и составляют содержание трудовых функций выполняющих их работников, определенных трудовыми договорами. Таким образом, у работодателя исчезает возможность изменения организационных или технологических условий труда, сопутствующих выполнению соответствующих работ, ввиду отсутствия этих работ.

                  В такой ситуации работодатель может предложить работнику другую работу, которая хотя и соответствует трудовой функции, предусмотренной трудовым договором, но предполагает иное обособленное структурное подразделение, расположенное в иной местности (как в деле заявителя). Очевидно, отмечается в постановлении, что для работника, нередко заинтересованного в сохранении конкретного места работы и стабильной занятости, подобное предложение может быть сопряжено с дополнительными организационными трудностями и финансовыми расходами, вызванными не только изменением транспортной доступности новой работы, но и необходимостью смены места жительства. В связи с этим законодатель и отнес изменение места работы (включая обособленное структурное подразделение, предусмотренное трудовым договором) к переводу на другую работу, допустимому только с согласия работника (ч. 2 ст. 57, ст. 72, ч. 1 ст. 72.1 ТК).

                  Однако в случае заявителя увольнение по п. 7 ч. 1 ст. 77 ТК невозможно, поскольку в основе увольнения лежит не волеизъявление работника, отказавшегося от продолжения работы в новых условиях, а объективная невозможность предоставления ему отсутствующей у работодателя работы в соответствующем обособленном структурном подразделении по той трудовой функции, которая обусловлена трудовым договором, подчеркнул КС. Фактически, пояснил Суд, этот работник оказывается в одинаковом положении с работником, должность которого подлежит сокращению, поскольку для обоих одинаково утрачивается возможность продолжения работы по причинам, связанным не с их волеизъявлением или виновным поведением, а с изменениями в сфере самостоятельного хозяйствования работодателя, которые исключают дальнейшее выполнение этими работниками прежней работы по причине ее отсутствия. Такие работники нуждаются в равных гарантиях, направленных на смягчение негативных последствий потери работы, что возможно лишь при увольнении по п. 2 ч. 1 ст. 81 ТК.

                  С учетом этого взаимосвязанные положения ч. 1–4 ст. 74 и п. 7 ч. 1 ст. 77 ТК не могут рассматриваться как не соответствующие Конституции, поскольку не предполагают одностороннего изменения работодателем условия трудового договора о месте работы работника в связи с заключением работодателем с третьим лицом гражданско-правового договора, исключающего возможность выполнения работником прежней работы в том же обособленном структурном подразделении, а также не предполагают увольнение работника в случае отказа продолжить работу в другой местности по основанию, предусмотренному п. 7 ч. 1 ст. 77 Кодекса, резюмируется в постановлении. Судебные акты по делу заявителя КС признал подлежащими пересмотру.

                  Эксперты оценили выводы Суда

                  В комментарии «АГ» адвокат, старший юрист АБ «Качкин и партнеры» Ольга Дученко отметила, что выводы КС вызвали у нее опасения с точки зрения соблюдения баланса прав сторон трудового договора.

                  Читайте также

                  КС: Срок заключения трудового договора не может зависеть от воли третьих лиц

                  Суд указал, что увязывание срока трудового договора со сроком действия заключенного работодателем с третьим лицом гражданско-правового договора приводило бы к тому, что занятость работника ставилась бы в зависимость от результата волеизъявления иных сторон

                  22 Мая 2020 Новости

                  «В последние годы Конституционный Суд последовательно придерживается курса на защиту прав работника как экономически более слабой стороны. При этом интересы работодателя мало кого волнуют, даже во время кризиса, – пояснила она. – Например, в Постановлении от 19 мая 2020 г. № 25-П, по сути, содержится запрет на ограничение срока трудового договора временем оказания работодателем услуг заказчикам по гражданско-правовым договорам. В результате суды стали чаще признавать срочные трудовые договоры заключенными на неопределенный срок».

                  По мнению эксперта, Постановление № 3-П/2022 содержит важные разъяснения. Во-первых, о недопустимости по инициативе работодателя без согласия работника изменения условий трудового договора из-за перемены организационных или технологических условий труда не только в части трудовой функции работника, но и места работы. «На мой взгляд, это очень расширительное и спорное толкование положений ТК», – считает Ольга Дученко. Во-вторых, передача работодателем отдельных видов работ третьему лицу (аутсорсинг) не может являться основаниям для признания возникновения у работодателя эффекта изменения организационных или технологических условий труда, позволяющего изменить условия трудового договора в порядке ст. 74 ТК, – в таком случае нужно проводить мероприятия по сокращению численности работников или штата.

                  «Несомненно, данное постановление окажет значительное влияние на судебную практику: суды будут чаще признавать незаконными изменения условий трудового договора в порядке ст. 74 ТК, а работодателям, в свою очередь, придется в большем количестве случаев проводить сокращение численности или штата», – полагает эксперт. В заключение Ольга Дученко добавила, что с учетом курса правоприменительной практики на защиту работников законодателю стоило бы подумать и о защите работодателей – например, пересмотрев правила выплаты выходных пособий при сокращении в сторону уменьшения.

                  «Не секрет, что работодатели, применяя п. 7 ч. 1 ст. 77 ТК, пытаются сэкономить на выплате выходного пособия. При увольнении в связи с отказом работника от работы в изменившихся условиях размер выходного пособия – двухнедельный средний заработок (ч. 6 ст. 178 ТК). Если же работника увольняют в связи с сокращением численности или штата, потребуется выплатить до трех средних месячных заработков (ч. 1–3 ст. 178 Кодекса), а в ситуации увольнения по данному основанию работников Крайнего севера или приравненных местностей – до шести средних месячных заработков (ст. 318). Поэтому регулярно возникают судебные споры относительно законности увольнения работника на основании п. 7 ч. 1 ст. 77 ТК», – отметила юрист, эксперт по трудовому праву Елена Карсетская.

                  Она добавила, что суды и ранее довольно часто придерживались позиции, что в ситуации, когда обязанности работника передаются, например, в другое подразделение, будет иметь место не изменение условий трудового договора, а сокращение штата (апелляционное определение Московского городского суда от 30 ноября 2018 г. № 33-52576/2018). «Но все же практика не была единообразной. Однако с учетом правовой позиции КС, изложенной в Постановлении № 3-П, работникам будет проще отстаивать свою позицию в суде», – убеждена эксперт.

                  Неканонические механизмы инициации трансляции, используемые мРНК эукариотических вирусов

                  1. Родригес Р. А. Л., да Силва Л. К. Ф., Абрахао Дж. С. Перевод с языка гигантов: связанные с трансляцией гены как основной вклад гигантских вирусов в виросферу. Арка Вирол. 2020;165:1267–1278. doi: 10.1007/s00705-020-04626-2. [PubMed] [CrossRef] [Google Scholar]

                  2. Pelletier J., Sonenberg N. Принципы организации рекрутирования эукариотических рибосом. Анну. Преподобный Биохим. 2019;88:307–335. doi: 10.1146/annurev-biochem-013118-111042. [PubMed] [CrossRef] [Google Scholar]

                  3. Хиннебуш А. Г. Механизм сканирования эукариотической инициации трансляции. Анну. Преподобный Биохим. 2014; 83: 779–812. doi: 10.1146/annurev-biochem-060713-035802. [PubMed] [CrossRef] [Google Scholar]

                  4. Алехина О. М., Василенко К. С. Инициация трансляции у эукариот: универсальность модели сканирования. Биохимия (Москва) 2012;77:1465–1477. doi: 10.1134/S0006297

                • 0056. [PubMed] [CrossRef] [Академия Google]

                  5. Елисеева И. А., Лябин Д. Н., Овчинников Л. П. Поли(А)-связывающие белки: структура, доменная организация и регуляция активности. Биохимия (Москва) 2013;78:1377–1391. doi: 10.1134/S0006297

                • 0014. [PubMed] [CrossRef] [Google Scholar]

                  6. Хиннебуш А. Г. Структурное понимание механизма сканирования и распознавания стартового кодона в эукариотической инициации трансляции. Тенденции биохим. науч. 2017; 42: 589–611. doi: 10.1016/j.tibs.2017.03.004. [PubMed] [CrossRef] [Академия Google]

                  7. Козак М. Расширение возможностей механизма сканирования для инициации трансляции. Ген. 2002; 299:1–34. doi: 10.1016/s0378-1119(02)01056-9. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  8. Теренин И. М., Акулич К. А., Андреев Д. Е., Полянская С. А., Шацкий И. Н., Дмитриев С. Е. Скольжение рибосомного комплекса 43S с распознаваемого кодона AUG, запускаемое задержка гидролиза GTP, связанного с eIF2. Нуклеиновые Кислоты Res. 2016; 44:1882–1893. doi: 10.1093/nar/gkv1514. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  9. Латорре П., Колакофски Д., Курран Дж. Y-белки вируса Сендай инициируются рибосомным шунтом. Мол. Клеточная биол. 1998;18:5021–5031. doi: 10.1128/MCB.18.9.5021. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  10. Ферт А. Э., Бриерли И. Неканоническая трансляция в РНК-вирусах. Дж. Генерал Вирол. 2012;93:1385–1409. doi: 10.1099/vir.0.042499-0. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  11. Талянский М.Е., Робинсон Д.Дж. Молекулярная биология умбравирусов: фантомные воины. Дж. Генерал Вирол. 2003;84:1951–1960. doi: 10.1099/vir.0.19219-0. [PubMed] [CrossRef] [Google Scholar]

                  12. Мацуда Д., Дреер Т. В. Близкое расположение инициирующих кодонов AUG придает эукариотической мРНК дицистронный характер. РНК. 2006; 12:1338–1349. doi: 10.1261/rna.67906. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  13. Козак М. Соблюдение правила первого AUG, когда второй кодон AUG следует за первым. проц. Натл. акад. науч. США. 1995; 92: 2662–2666. doi: 10.1073/pnas.92.7.2662. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  14. Dasso M.C., Milburn S.C., Hershey J.W., Jackson R.J. Выбор 5′-проксимального сайта инициации трансляции зависит от концентрации мРНК и eIF-2. Евро. Дж. Биохим. 1990; 187: 361–371. doi: 10.1111/j.1432-1033.1990.tb15313.x. [PubMed] [CrossRef] [Google Scholar]

                  15. Фролов И., Шлезингер С. Трансляция мРНК вируса Синдбис: эффекты последовательностей ниже инициирующего кодона. Дж. Вирол. 1994;68:8111–8117. doi: 10.1128/ОВИ.68.12.8111-8117.1994. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  16. Ventoso I., Sanz M.A., Molina S., Berlanga J.J., Carrasco L., Esteban M. Трансляционная устойчивость мРНК позднего альфавируса к фосфорилированию eIF2alpha: стратегия преодоления противовирусного эффекта протеинкиназы PKR. Гены Дев. 2006; 20:87–100. doi: 10.1101/gad.357006. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  17. Pappas C.L., Tzeng W.P., Frey T.K. Оценка цис-действующих элементов в субгеномной РНК вируса краснухи, которые играют роль в его трансляции. Арка Вирол. 2006; 151:327–346. doi: 10.1007/s00705-005-0614-x. [PubMed] [CrossRef] [Академия Google]

                  18. Горчаков Р., Фролова Е., Уильямс Б. Р., Райс С. М., Фролов И. PKR-зависимые и -независимые механизмы участвуют в выключении трансляции при заражении вирусом Синдбис. Дж. Вирол. 2004; 78: 8455–8467. doi: 10.1128/ОВИ.78.16.8455-8467.2004. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  19. Sanz M.A., Castelló A., Ventoso I., Berlanga J.J., Carrasco L. Двойной механизм трансляции субгеномной мРНК вируса Синдбис у инфицированных и неинфицированные клетки. ПЛОС Один. 2009 г.;4:e4772. doi: 10.1371/journal.pone.0004772. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  20. Garcia-Moreno M., Sanz M.A., Pelletier J., Carrasco L. Требования к eIF4A и eIF2 во время трансляции субгеномной мРНК вируса Синдбис у позвоночных и клетки-хозяева беспозвоночных. Клеточная микробиология. 2013; 15:823–840. doi: 10.1111/cmi.12079. [PubMed] [CrossRef] [Google Scholar]

                  21. Carrasco L., Sanz M.A., Gonzalez-Almela E. Регуляция трансляции в инфицированных альфавирусом клетках. Вирусы. 2018;10:70. дои: 10.3390/v10020070. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  22. Скабкин М. А., Скабкина О. В., Дхоте В., Комар А. А., Хеллен К. У., Пестова Т. В. Активность лигатина и MCT-1/DENR в инициации трансляции у эукариот и рециклинг рибосом. Гены Дев. 2010; 24:1787–1801. doi: 10.1101/gad.10. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  23. Санс М. А., Гонсалес Алмела Э., Карраско Л. Перевод субгеномной мРНК Sindbis не зависит от eIF2, eIF2A и eIF2D. науч. 2017;7:43876. doi: 10.1038/srep43876. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  24. Clyde K., Harris E. Вторичная структура РНК в кодирующей области вируса денге типа 2 направляет выбор стартового кодона трансляции и необходима для репликации вируса. Дж. Вирол. 2006; 80: 2170–2182. doi: 10.1128/ОВИ.80.5.2170-2182.2006. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  25. Edgil D., Polacek C., Harris E. Вирус денге использует новую стратегию для инициации трансляции, когда кап-зависимая трансляция ингибируется. Дж. Вирол. 2006; 80: 2976–2986. дои: 10.1128/ОВИ.80.6.2976-2986.2006. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  26. Фюттерер Дж., Кисс-Ласло З., Хон Т. Нелинейная миграция рибосом на 35S РНК вируса мозаики цветной капусты. Клетка. 1993; 73: 789–802. doi: 10.1016/0092-8674(93)

                  -q. [PubMed] [CrossRef] [Google Scholar]

                  27. Карран Дж., Колакофски Д. Сканирование независимой рибосомной инициации белка X вируса Сендай. EMBO J. 1988; 7: 2869–2874. doi: 10.1002/j.1460-2075.1988.tb03143.x. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  28. de Breyne S., Simonet V., Pelet T., Curran J. Идентификация цис-действующего элемента, необходимого для шунт-опосредованной инициации трансляции белков Y вируса Сендай. Нуклеиновые Кислоты Res. 2003; 31: 608–618. doi: 10.1093/nar/gkg143. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  29. Yueh A., Schneider R. J. Трансляция путем шунтирования рибосом на мРНК аденовируса и hsp70, чему способствует комплементарность 18S рРНК. Гены Дев. 2000; 14:414–421. [Бесплатная статья PMC] [PubMed] [Google Scholar]

                  30. Дмитриев С. Е., Теренин И.М., Дунаевский Ю.Е., Меррик В.С., Шацкий И.Н. Сборка комплексов инициации трансляции 48S из очищенных компонентов с мРНК, которые имеют некоторое спаривание оснований в своих 5′-нетранслируемых участках. Мол. Клетка. биол. 2003; 23:8925–8933. doi: 10.1128/MCB.23.24.8925-8933.2003. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  31. Xi Q., ​​Cuesta R., Schneider R. J. Связывание eIF4G с аденовирусными мРНК вирусным белком 100k управляет шунтированием рибосом. Гены Дев. 2004;18:1997–2009. doi: 10.1101/gad.1212504. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  32. Rajyaguru P., Parker R. Белки мотива RGG: модуляторы функциональных состояний мРНК. Клеточный цикл. 2012;11:2594–2599. doi: 10.4161/cc.20716. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  33. Dolph P.J., Racaniello V., Villamarin A., Palladino F., Schneider R.J. Трехсторонний лидер аденовируса может устранить потребность в кэп-связывающем белковом комплексе во время инициации трансляции. Дж. Вирол. 1988;62:2059–2066. doi: 10.1128/ОВИ.62.6.2059-2066.1988. [PubMed] [CrossRef] [Google Scholar]

                  34. Пуггин М. М., Рябова Л. А. Шунтирование рибосом, полицистронная трансляция и уклонение от противовирусной защиты у растительных параретровирусов и не только. Фронт. микробиол. 2018;9:644. doi: 10.3389/fmicb.2018.00644. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  35. Пестова Т. В., Колупаева В. Г. Роль индивидуальных эукариотических факторов инициации трансляции в рибосомном сканировании и отборе инициирующих кодонов. Гены Дев. 2002;16:2906–2922. doi: 10.1101/gad.1020902. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  36. Hann L. E., Gehrke L. мРНК, содержащие неструктурированную 5′-лидерную последовательность РНК 4 вируса мозаики люцерны, неэффективно транслируются в лизатах клеток HeLa, инфицированных полиовирусом. Дж. Вирол. 1995; 69: 4986–4993. doi: 10.1128/ОВИ.69.8.4986-4993.1995. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  37. Галли Д. Р., Слит Д. Э., Уоттс Дж. В., Тернер П. С., Уилсон Т. М. Сравнение эукариотических вирусных 5′-лидерных последовательностей в качестве энхансеров экспрессии мРНК in vivo . Нуклеиновые Кислоты Res. 1987; 15:8693–8711. doi: 10.1093/нар/15.21.8693. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  38. Агаларов С., Сахаров П. А., Фаттахова Д., Согорин Е. А., Спирин А. С. Инициация внутренней трансляции и eIF4F/АТФ-независимое сканирование мРНК эукариотической рибосомой частицы. науч. Отчет 2014; 4:4438. doi: 10.1038/srep04438. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  39. Ян З., Мартенс К.А., Бруно Д.П., Порселла С.Ф., Мосс Б. Проникающая инициация и формирование 3′-конца пострепликативных РНК поксвируса. Дж. Биол. хим. 2012; 287:31050–31060. doi: 10.1074/jbc.M112.3

                  . [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  40. Вопаленский В., Сикора М., Мелкова З., Машек Т., Поспишек М. Транскрипты пострепликативных генов вируса коровьей оспы не содержат 5′-метилгуанозиновый кэп. bioRxiv. 2020 г.: 10.1101/2020.07.15.204867. [CrossRef] [Google Scholar]

                  41. Широких Н. Е., Спирин А. С. Поли(А)-лидер эукариотической мРНК обходит зависимость трансляции от факторов инициации. проц. Натл. акад. науч. США. 2008; 105:10738–10743. doi: 10.1073/pnas.0804
                  5. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  42. Mulder J., Robertson M.E., Seamons R.A., Belsham G.J. Синтез белка вируса осповакцины имеет низкую потребность в интактном факторе инициации трансляции eIF4F, кэп-связывающий комплекс внутри инфицированных клеток. Дж. Вирол. 1998; 72:8813–8819. doi: 10.1128/ОВИ.72.11.8813-8819.1998. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  43. Бабланян Р., Госвами С.К., Эстебан М., Банерджи А.К., Меррик В.К. Механизм селективной трансляции мРНК вируса коровьей оспы: дифференциальная роль поли(A) ) и факторы инициации трансляции вирусных и клеточных мРНК. Дж. Вирол. 1991;65:4449–4460. doi: 10.1128/ОВИ.65.8.4449-4460.1991. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  44. Вопаленский В., Сикора М., Машек Т., Поспишек М. РНК-мессенджеры дрожжевых вирусоподобных элементов содержат нематричные 5′-поли( А) лидеров, и их экспрессия не зависит от eIF4E и Pab1. Фронт. микробиол. 2019;10:2366. doi: 10.3389/fmicb.2019.02366. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  45. Дхунгель П., Цао С., Ян З. 5′-поли(А) лидер мРНК поксвируса обеспечивает трансляционное преимущество, которого можно достичь в клетках с нарушенной кэп-зависимой трансляцией. PLoS Патог. 2017;13:e1006602. doi: 10.1371/journal.ppat.1006602. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  46. Jha S., Rollins M.G., Fuchs G., Procter D.J., Hall E.A., et al. Трансцарская мимикрия лежит в основе настройки рибосом киназой поксвируса. Природа. 2017; 546: 651–655. doi: 10.1038/nature22814. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  47. Ян Э., Мор И., Уолш Д. Полное руководство по стратегиям трансляции мРНК в инфицированных вирусом клетках. Анну. Преподобный Вирол. 2016;3:283–307. doi: 10.1146/annurev-virology-100114-055014. [PubMed] [CrossRef] [Академия Google]

                  48. Linero F., Welnowska E., Carrasco L., Scolaro L. Участие комплекса eIF4F в заражении вирусом Junin: блокирование eIF4E не нарушает репликацию вируса. Клеточная микробиология. 2013; 15:1766–1782. doi: 10.1111/cmi.12149. [PubMed] [CrossRef] [Google Scholar]

                  49. Leen E. N., Sorgeloos F., Correia S., Chaudhry Y., Cannac F., et al. Консервативное взаимодействие между C-концевым мотивом в VPg норовируса и доменом HEAT-1 eIF4G необходимо для инициации трансляции. PLoS Патог. 2016;12:e1005379. doi: 10.1371/journal.ppat.1005379. [Статья PMC бесплатно] [PubMed] [CrossRef] [Google Scholar]

                  50. Chung L., Bailey D., Leen E.N., Emmott E.P., Chaudhry Y., et al. Для трансляции норовируса требуется взаимодействие между С-концом связанного с геномом вирусного белка VPg и эукариотического фактора инициации трансляции 4G. Дж. Биол. хим. 2014; 289:21738–21750. doi: 10.1074/jbc.M114.550657. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  51. Coutinho de Oliveira L., Volpon L., Rahardjo A.K., Osborne M.J., Culjkovic-Kraljacic B., et al. Структурные исследования комплекса eIF4E-VPg выявили прямую конкуренцию за кэпированную РНК: значение для трансляции. проц. Натл. акад. науч. США. 2019;116:24056–24065. doi: 10.1073/pnas.1

                  2116. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  52. Хан М. А., Госс Д. Дж. Поли (А) связывающий белок усиливает аффинность связывания потивируса VPg с эукариотическим фактором инициации eIF4F и активирует трансляцию in vitro . Междунар. Дж. Биол. макромол. 2019;121:947–955. doi: 10.1016/j.ijbiomac.2018.10.135. [PubMed] [CrossRef] [Google Scholar]

                  53. Daughenbaugh K.F., Fraser C.S., Hershey J.W., Hardy M.E. Связанный с геномом белок VPg вируса Norwalk связывает eIF3, предполагая его роль в привлечении комплекса инициации трансляции. EMBO J. 2003; 22: 2852–2859. . doi: 10.1093/emboj/cdg251. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  54. Hosmillo M., Lu J., McAllaster M.R., Eaglesham J.B., Wang X., et al. Норовирусы разрушают основной компонент стрессовой гранулы G3BP1, чтобы способствовать вирусной VPg-зависимой трансляции. Элиф. 2019;8:e46681. doi: 10.7554/eLife.46681. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  55. Берроуз Дж. Н., Браун Ф. Наличие ковалентно связанного белка на РНК калицивируса. Дж. Генерал Вирол. 1978;41:443–446. doi: 10.1099/0022-1317-41-2-443. [PubMed] [CrossRef] [Google Scholar]

                  56. Майлио Дж., Мартин Ф. Вирусные внутренние сайты входа в рибосомы: четыре класса для одной цели. Уайли Междисциплинарный. Преподобный РНК. 2018;9:e1458. doi: 10.1002/wrna.1458. [PubMed] [CrossRef] [Google Scholar]

                  57. Ямамото Х., Унбехаун А., Спан С. М. Т. Рибосомная камерная музыка: к пониманию механизмов IRES. Тенденции биохим. науч. 2017; 42: 655–668. doi: 10.1016/j.tibs. 2017.06.002. [PubMed] [CrossRef] [Академия Google]

                  58. Джаафар З.А., Кифт Дж.С. Стратегии управления трансляцией на основе структуры вирусной РНК. Нац. Преподобный Микробиолог. 2019;17:110–123. doi: 10.1038/s41579-018-0117-x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  59. Архаб Ю., Булахов А. Г., Пестова Т. В., Хеллен К. У. Т. Распространение внутренних рибосомных сайтов входа (IRES) между вирусами путем горизонтального переноса генов. Вирусы. 2020;12:612. doi: 10.3390/v12060612. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  60. Кван Т., Томпсон С. Р. Инициация неканонической трансляции у эукариот. Харб Колд Спринг. Перспектива. биол. 2019;11:a032672. doi: 10.1101/cshperspect.a032672. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  61. Jang S.K., Krauslich H.G., Nicklin M.J., Duke G.M., Palmenberg A.C., Wimmer E. Сегмент 5′-нетранслируемой области РНК вируса энцефаломиокардита направляет внутренний вход рибосом во время трансляции in vitro . Дж. Вирол. 1988; 62: 2636–2643. дои: 10.1128/ОВИ.62.8.2636-2643.1988. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  62. Pelletier J., Sonenberg N. Внутренняя инициация трансляции эукариотической мРНК, управляемая последовательностью, полученной из РНК полиовируса. Природа. 1988; 334: 320–325. дои: 10.1038/334320a0. [PubMed] [CrossRef] [Google Scholar]

                  63. Теренин И. М., Смирнова В. В., Андреев Д. Е., Дмитриев С. Е., Шацкий И. Н. Путеводитель исследователя по галактике ИРЭС. Клетка. Мол. Жизнь наук. 2017;74:1431–1455. doi: 10.1007/s00018-016-2409-5. [PubMed] [CrossRef] [Google Scholar]

                  64. Козак М. Второй взгляд на клеточные последовательности мРНК, которые, как говорят, функционируют как внутренние сайты посадки рибосом. Нуклеиновые Кислоты Res. 2005; 33: 6593–6602. doi: 10.1093/nar/gki958. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  65. Джексон Р. Дж. Текущее состояние IRES клеточной мРНК позвоночных. Харб Колд Спринг. Перспектива. биол. 2013;5:a011569. doi: 10.1101/cshperspect.a011569. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  66. Томпсон С. Р. Итак, вы хотите знать, есть ли у вашего сообщения IRES? Уайли Междисциплинарный. Преподобный РНК. 2012;3:697–705. doi: 10.1002/wrna.1129. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  67. Андреев Д. Е., Теренин И. М., Дмитриев С. Е., Шацкий И. Н. Плюсы и минусы трансфекции пДНК и мРНК для изучения трансляции мРНК в клетках млекопитающих. Ген. 2016; 578:1–6. doi: 10.1016/j.gene.2015.12.008. [PubMed] [CrossRef] [Google Scholar]

                  68. Barreau C., Dutertre S., Paillard L., Osborne H.B. Опосредованную липосомами трансфекцию РНК следует использовать с осторожностью. РНК. 2006;12:1790–1793. doi: 10.1261/rna.1

                  . [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  69. Дмитриев С.Е., Андреев Д.Е., Адьянова З.В., Теренин И.М., Шацкий И.Н. Эффективная кэп-зависимая трансляция мРНК млекопитающих с длинными и высокоструктурированными 5′-нетранслируемыми области in vitro и in vivo . Мол. биол. (Москва) 2009;43:108–113. doi: 10.1134/S002689330

                  54. [PubMed] [CrossRef] [Google Scholar]

                  70. Дмитриев С. Е., Быкова Н. В., Андреев Д. Е., Теренин И. М. Адекватная система для изучения инициации трансляции на мРНК ретротранспозона L1 человека in vitro . Мол. биол. (Москва) 2006;40:20–24. doi: 10.1134/S00268

                  010043. [CrossRef] [Google Scholar]

                  71. Avanzino B.C., Jue H., Miller C.M., Cheung E., Fuchs G., Fraser C.S. Молекулярный механизм аттенуации вакцинного штамма полиовируса Sabin. Дж. Биол. хим. 2018;293:15471–15482. doi: 10.1074/jbc.RA118.004913. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  72. Бекхэм С. А., Матак М. Ю., Белоусофф М. Дж., Венугопал Х., Шах Н. и др. Структура комплекса PCBP2/стебель-петля IV, лежащего в основе инициации трансляции, опосредованной IRES полиовируса типа I. Нуклеиновые Кислоты Res. 2020;48:8006–8021. дои: 10.1093/нар/гкаа519. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  73. Chamond N., Deforges J., Ulryck N., Sargueil B. Рекрутирование 40S в отсутствие eIF4G/4A с помощью EMCV IRES уточняет модель для инициация трансляции на архетипе IRES типа II. Нуклеиновые Кислоты Res. 2014;42:10373–10384. doi: 10.1093/nar/gku720. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  74. Кифт Дж. С., Чжоу К., Джубин Р., Дудна Дж. А. Механизм рекрутирования рибосом с помощью РНК IRES гепатита С. РНК. 2001;7:194–206. doi: 10.1017/s1355838201001790. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  75. Петров А., Гросли Р., Чен Дж., О’Лири С.Э., Пуглиси Дж.Д. Множественные параллельные пути инициации трансляции на IRES CrPV. Мол. Клетка. 2016;62:92–103. doi: 10.1016/j.molcel.2016.03.020. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  76. Jang CJ, Jan E. Модульные домены сайта межгенной внутренней рибосомы Dicistroviridae. РНК. 2010;16:1182–1195. doi: 10.1261/РНК.2044610. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  77. Jang S.K., Davies M.V., Kaufman R.J., Wimmer E. Инициация синтеза белка путем внутреннего проникновения рибосом в 5′-нетранслируемую область РНК вируса энцефаломиокардита in vivo . Дж. Вирол. 1989; 63: 1651–1660. doi: 10.1128/ОВИ.63.4.1651-1660.1989. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  78. Пилипенко Е. В., Блинов В. М., Романова Л. И., Синяков А. Н., Маслова С. В., Агол В. И. Консервативные структурные домены в 5′-нетранслируемой области геномов пикорнавирусов: анализ сегмента, контролирующего трансляцию и нейровирулентность. Вирусология. 1989;168:201–209. doi: 10.1016/0042-6822(89)

                  -6. [PubMed] [CrossRef] [Google Scholar]

                  79. Skinner M.A., Racaniello V.R., Dunn G., Cooper J., Minor P.D., Almond J.W. Новая модель вторичной структуры 5′-некодирующей РНК полиовируса подтверждается биохимическими и генетическими данными, которые также показывают, что вторичная структура РНК важна для нейровирулентности. Дж. Мол. биол. 1989; 207: 379–392. doi: 10. 1016/0022-2836(89)

                  -1. [PubMed] [CrossRef] [Google Scholar]

                  80. Мартинес-Салас Э., Франсиско-Велилья Р., Фернандес-Чаморро Дж., Лозано Г., Диас-Толедано Р. Элементы IRES пикорнавируса: структура РНК и белок-хозяин взаимодействия. Вирус Рез. 2015;206:62–73. doi: 10.1016/j.virusres.2015.01.012. [PubMed] [CrossRef] [Академия Google]

                  81. Пилипенко Е. В., Гмыль А. П., Маслова С. В., Свиткин Ю. В., Синяков А. Н., Агол В. И. Прокариотоподобные цис- элементы в кэп-независимой внутренней инициации трансляции на РНК пикорнавируса. Клетка. 1992; 68: 119–131. doi: 10.1016/0092-8674(92)

                  -т. [PubMed] [CrossRef] [Google Scholar]

                  82. Слободская О. Р., Гмыль А. П., Маслова С. В., Тольская Е. А., Викторова Е. Г., Агол В. И. Нейровирулентность полиовируса коррелирует с наличием криптической AUG перед кодоном-инициатором. Вирусология. 1996;221:141–150. doi: 10.1006/viro.1996.0360. [PubMed] [CrossRef] [Google Scholar]

                  83. Lulla V., Dinan A.M., Hosmillo M., Chaudhry Y. , Sherry L., et al. Вышележащая кодирующая белок область энтеровирусов модулирует вирусную инфекцию в эпителиальных клетках кишечника. Нац. микробиол. 2019;4:280–292. doi: 10.1038/s41564-018-0297-1. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  84. Хеллен К.У., Пестова Т.В., Виммер Э. Влияние мутаций ниже внутреннего сайта посадки рибосомы на инициацию синтеза белка полиовируса. Дж. Вирол. 1994;68:6312–6322. doi: 10.1128/ОВИ.68.10.6312-6322.1994. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  85. Суини Т. Р., Абаева И. С., Пестова Т. В., Хеллен К. У. Механизм инициации трансляции на IRES пикорнавируса 1 типа. EMBO J. 2014; 33:76–92. doi: 10.1002/embj.201386124. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  86. Kaminski A., Pöyry T.A., Skene P.J., Jackson R.J. Механизм выбора сайта инициации, обеспечиваемый внутренним сайтом входа рибосомы риновируса человека 2. Дж. Вирол. 2010; 84: 6578–6589. doi: 10.1128/ОВИ.00123-10. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  87. Kafasla P., Morgner N., Robinson C.V., Jackson R.J. Белок, связывающий полипиримидиновый тракт, стимулирует IRES полиовируса, модулируя связывание eIF4G. EMBO J. 2010; 29: 3710–3722. doi: 10.1038/emboj.2010.231. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  88. Андреев Д. Е., Хирнет Дж., Теренин И. М., Дмитриев С. Е., Нипманн М., Шацкий И. Н. Глицил-тРНК-синтетаза специфически связывается с полиовирусом IRES для активации инициация перевода. Нуклеиновые Кислоты Res. 2012;40:5602–5614. дои: 10.1093/нар/гкс182. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  89. Меерович К., Свиткин Ю.В., Ли Х.С., Лейбкович Ф., Кенан Д.Дж. и др. La аутоантиген усиливает и исправляет аберрантную трансляцию РНК полиовируса в лизате ретикулоцитов. Дж. Вирол. 1993; 67: 3798–3807. doi: 10.1128/ОВИ.67.7.3798-3807.1993. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  90. Hunt S.L., Hsuan J.J., Totty N., Jackson R.J. внутренняя инициация трансляции РНК риновируса человека. Гены Дев. 1999;13:437–448. doi: 10.1101/gad.13.4.437. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  91. Свиткин Ю. В., Пестова Т. В., Маслова С. В., Агол В. И. Точечные мутации модифицируют ответ РНК полиовируса на фактор инициации трансляции: сравнение нейровирулентных и аттенуированных штаммы. Вирусология. 1988; 166: 394–404. doi: 10.1016/0042-6822(88)

                  -7. [PubMed] [CrossRef] [Google Scholar]

                  92. Агол В. И., Дроздов С. Г., Иванникова Т. А., Колесникова М. С., Королев М. Б., Тольская Е. А. Ограниченный рост аттенуированных штаммов полиовируса в культивируемых клетках нейробластомы человека. Дж. Вирол. 1989;63:4034–4038. doi: 10.1128/ОВИ.63.9.4034-4038.1989. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  93. La Monica N., Racaniello V.R. Различия в репликации аттенуированных и нейровирулентных полиовирусов в клеточной линии нейробластомы человека SH-SY5Y. Дж. Вирол. 1989;63:2357–2360. doi: 10.1128/ОВИ.63.5.2357-2360.1989. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  94. Гест С., Пилипенко Е., Шарма К., Чумаков К., Роос Р. П. Молекулярные механизмы аттенуации штамма Sabin полиовируса 3 типа. Дж. Вирол. 2004;78:11097–11107. doi: 10.1128/ОВИ.78.20.11097-11107.2004. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  95. Свиткин Ю. В., Иматака Х., Халегпур К., Кахведжян А., Либиг Х. Д., Соненберг Н. Взаимодействие поли(А)-связывающего белка с elF4G стимулирует IRES-зависимую трансляцию пикорнавируса. РНК. 2001; 7: 1743–1752. doi: 10.1017/S135583820100108X. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  96. White J.P., Reineke L.C., Lloyd R.E. Полиовирус переключается на независимый от eIF2 способ трансляции во время заражения. Дж. Вирол. 2011; 85: 8884–8893. doi: 10.1128/ОВИ.00792-11. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  97. Кастан Дж. П., Добрикова Е. Ю., Брайант Дж. Д., Громейер М. CReP опосредует селективную инициацию трансляции в эндоплазматическом ретикулуме. науч. Доп. 2020;6:eaba0745. doi: 10. 1126/sciadv.aba0745. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  98. Пилипенко Е. В., Блинов В. М., Чернов Б. К., Дмитриева Т. М., Агол В. И. Консервация элементов вторичной структуры 5′-нетранслируемой области кардио- и РНК афтовируса. Нуклеиновые Кислоты Res. 1989;17:5701–5711. doi: 10.1093/нар/17.14.5701. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  99. Колупаева В.Г., Пестова Т.В., Хеллен К.У., Шацкий И.Н. . Дж. Биол. хим. 1998; 273:18599–18604. doi: 10.1074/jbc.273.29.18599. [PubMed] [CrossRef] [Google Scholar]

                  100. Теренин И. М., Андреев Д. Е., Дмитриев С. Е., Шацкий И. Н. Новый механизм инициации трансляции у эукариот, не зависящий ни от m7G-cap, ни от IRES. Нуклеиновые Кислоты Res. 2013;41:1807–1816. дои: 10.1093/нар/гкс1282. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  101. Пилипенко Е. В., Гмыль А. П., Маслова С. В., Белов Г. А., Синяков А. Н. и др. Стартовое окно, отдельный элемент независимой от кэпа внутренней инициации трансляции на пикорнавирусной РНК. Дж. Мол. биол. 1994; 241:398–414. doi: 10.1006/jmbi.1994.1516. [PubMed] [CrossRef] [Google Scholar]

                  102. Камински А., Хауэлл М. Т., Джексон Р. Дж. Инициация трансляции РНК вируса энцефаломиокардита: аутентичный сайт инициации не выбирается с помощью механизма сканирования. EMBO J. 1990;9:3753–3759. doi: 10.1002/j.1460-2075.1990.tb07588.x. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  103. Пестова Т. В., Борухов С. И., Хеллен К. У. Эукариотические рибосомы требуют факторов инициации 1 и 1А для локализации кодонов инициации. Природа. 1998; 394: 854–859. дои: 10.1038/29703. [PubMed] [CrossRef] [Google Scholar]

                  104. Андреев Д.Е., Фернандес-Мирагалл О., Рамайо Дж., Дмитриев С.Е., Теренин И.М., и др. Необходимость дифференциального фактора для сборки комплексов инициации трансляции на альтернативных стартовых кодонах РНК вируса ящура. РНК. 2007; 13:1366–1374. doi: 10.1261/РНК.469707. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  105. Пилипенко Е. В., Пестова Т.В., Колупаева В.Г., Хитрина Е.В., Поперечная А.Н., и др. Белок, зависящий от клеточного цикла, служит в качестве специфичного для матрицы фактора инициации трансляции. Гены Дев. 2000;14:2028–2045. [PMC free article] [PubMed] [Google Scholar]

                  106. Пестова Т. В., Хеллен К. У., Шацкий И. Н. Канонические эукариотические факторы инициации определяют инициацию трансляции путем внутреннего входа в рибосомы. Мол. Клетка. биол. 1996;16:6859–6869. doi: 10.1128/MCB.16.12.6859. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  107. Колупаева В. Г., Хеллен К. У., Шацкий И. Н. Структурный анализ взаимодействия белка, связывающего пиримидиновый тракт, с внутренним местом входа рибосомы вируса энцефаломиокардита и стопы РНК вируса ротовой болезни. РНК. 1996; 2: 1199–1212. [PMC free article] [PubMed] [Google Scholar]

                  108. Пилипенко Е. В., Гмыль А. П., Маслова С. В., Хитрина Е. В., Агол В. И. Аттенуация вируса Тейлера мышиного энцефаломиелита модификациями олигопиримидин/АУГ тандема, хост-зависимая трансляционная цис-элемент. Дж. Вирол. 1995;69:864–870. doi: 10.1128/ОВИ.69.2.864-870.1995. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  109. Пилипенко Е. В., Викторова Е. Г., Гость С. Т., Агол В. И., Роос Р. П. Белки, специфичные для клеток, регулируют трансляцию вирусной РНК и вирус-индуцированные заболевания. EMBO J. 2001; 20: 6899–6908. doi: 10.1093/emboj/20.23.6899. [Статья PMC free] [PubMed] [CrossRef] [Google Scholar]

                  110. Пилипенко Е. В., Викторова Е. Г., Хитрина Е. В., Маслова С. В., Жарус Н. и др. Различные фенотипы аттенуации, вызванные мутациями в начальном окне трансляции вируса мышиного энцефаломиелита Тейлера. Дж. Вирол. 1999;73:3190–3196. doi: 10.1128/ОВИ.73.4.3190-3196.1999. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  111. Gingras A.C., Svitkin Y., Belsham G.J., Pause A., Sonenberg N. Активация трансляционного супрессора 4E-BP1 после заражения вирусом энцефаломиокардита и полиовирус. проц. Натл. акад. науч. США. 1996; 93: 5578–5583. doi: 10.1073/pnas. 93.11.5578. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  112. Борман А. М., Кин К. М. Интактный эукариотический фактор инициации 4G необходим для внутренней инициации трансляции вируса гепатита А. Вирусология. 1997;237:129–136. doi: 10.1006/viro.1997.8761. [PubMed] [CrossRef] [Google Scholar]

                  113. Koirala D., Shao Y., Koldobskaya Y., Fuller J.R., Watkins A.M., et al. Консервативный структурный мотив РНК для организации топологии во внутренних сайтах посадки рибосомы пикорнавирусов. Нац. коммун. 2019;10:3629. doi: 10.1038/s41467-019-11585-z. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  114. Avanzino B.C., Fuchs G., Fraser C.S. Клеточный кэп-связывающий белок, eIF4E, способствует реструктуризации и трансляции генома пикорнавируса. проц. Натл. акад. науч. США. 2017;114:9611–9616. doi: 10.1073/pnas.17043

                  . [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  115. Цукияма-Кохара К., Иидзука Н., Кохара М., Номото А. Внутренний сайт входа рибосомы в РНК вируса гепатита С. Дж. Вирол. 1992; 66: 1476–1483. doi: 10.1128/ОВИ.66.3.1476-1483.1992. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  116. Пестова Т. В., Шацкий И. Н., Флетчер С. П., Джексон Р. Дж., Хеллен К. У. Прокариотоподобный способ связывания цитоплазматической эукариотической рибосомы с инициирующим кодоном во время внутренней трансляции инициация РНК вируса гепатита С и классической чумы свиней. Гены Дев. 1998;12:67–83. doi: 10.1101/gad.12.1.67. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  117. Малыгин А. А., Косинова О. А., Шацкий И. Н., Карпова Г. Г. IRES ВГС взаимодействует с 18S рРНК для активации 40S рибосомы для последующих этапов инициации трансляции. Нуклеиновые Кислоты Res. 2013;41:8706–8714. doi: 10.1093/nar/gkt632. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  118. Quade N., Boehringer D., Leibundgut M., van den Heuvel J., Ban N. Cryo-EM структура вируса гепатита C, связанного с IRES к рибосоме человека в 3,9- разрешение. Нац. коммун. 2015;6:7646. doi: 10.1038/ncomms8646. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  119. Yamamoto H., Collier M., Loerke J., Ismer J., Schmidt A., et al. Молекулярная архитектура связанной с рибосомой внутренней РНК сайта входа в рибосому вируса гепатита С. EMBO J. 2015; 34:3042–3058. doi: 10.15252/embj.2015. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  120. Hashem Y., des Georges A., Dhote V., Langlois R., Liao HY., et al. Внутренние сайты входа в рибосомы, подобные вирусу гепатита С, вытесняют eIF3, чтобы получить доступ к субъединице 40S. Природа. 2013;503:539–543. doi: 10.1038/nature12658. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  121. Сизова Д. В., Колупаева В. Г., Пестова Т. В., Шацкий И. Н., Хеллен К. У. Специфическое взаимодействие эукариотического фактора инициации трансляции 3 с 5′-нетранслируемыми участками вируса гепатита С РНК вируса и вируса классической чумы свиней. Дж. Вирол. 1998; 72: 4775–4782. doi: 10.1128/ОВИ.72.6.4775-4782.1998. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  122. Джаафар З. А., Огуро А., Накамура Ю., Кифт Дж. С. Инициация трансляции вирусом гепатита С IRES требует ремоделирования eIF1A и рибосомного комплекса. Элиф. 2016;5:e21198. doi: 10.7554/eLife.21198. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  123. Кинг Х. А., Кобболд Л. К., Уиллис А. Е. Роль трансакционных факторов IRES в регулировании инициации трансляции. Биохим. соц. Транс. 2010; 38: 1581–1586. doi: 10.1042/BST0381581. [PubMed] [CrossRef] [Google Scholar]

                  124. Kim GW, Siddiqui A. N6-метиладенозиновая модификация генома РНК ВГС регулирует кэп-независимую IRES-опосредованную трансляцию посредством распознавания YTHDC2. проц. Натл. акад. науч. США. 2021;118:e2022024118. doi: 10.1073/pnas.2022024118. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  125. Robert F., Kapp L.D., Khan S.N., Acker M.G., Kolitz S., et al. Инициация синтеза белка вирусом гепатита С невосприимчива к уменьшению eIF2. ГТП. Наличие тройного комплекса Met-tRNA(i)(Met). Мол. биол. Клетка. 2006; 17: 4632–4644. doi: 10.1091/mbc.e06-06-0478. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  126. Теренин И. М., Дмитриев С. Е., Андреев Д. Е., Шацкий И. Н. Эукариотический аппарат инициации трансляции может работать в бактериоподобном режиме без eIF2. Нац. Структура Мол. биол. 2008; 15: 836–841. doi: 10.1038/nsmb.1445. [PubMed] [CrossRef] [Академия Google]

                  127. Пестова Т. В., де Брейне С., Писарев А. В., Абаева И. С., Хеллен К. У. eIF2-зависимый и eIF2-независимый способы инициации IRES вируса КЧС: общая роль домена II. EMBO J. 2008; 27: 1060–1072. doi: 10.1038/emboj.2008.49. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  128. Yamamoto H., Unbehaun A., Loerke J., Behrmann E., Collier M., et al. Структура комплекса инициации 80S млекопитающих с фактором инициации 5B на РНК HCV-IRES. Нац. Структура Мол. биол. 2014;21:721–727. doi: 10.1038/nsmb.2859. [PubMed] [CrossRef] [Google Scholar]

                  129. Дмитриев С.Е., Теренин И.М., Андреев Д.Е., Иванов П.А., Дунаевский Ю.Е., и соавт. GTP-независимая доставка тРНК к Р-сайту рибосомы с помощью нового эукариотического фактора трансляции. Дж. Биол. хим. 2010; 285:26779–26787. doi: 10.1074/jbc.M110.119693. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  130. Weisser M., Schafer T., Leibundgut M., Bohringer D., Aylett C.H.S., Ban N. Структурное и функциональное понимание реинициации человека комплексы. Мол. Клетка. 2017;67:447–456.e447. doi: 10.1016/j.molcel.2017.06.032. [PubMed] [CrossRef] [Академия Google]

                  131. González-Almela E., Williams H., Sanz M.A., Carrasco L. Факторы инициации eIF2, eIF2A, eIF2D, eIF4A и eIF4G не участвуют в трансляции, управляемой IRES вируса гепатита С в клетках человека. Фронт. микробиол. 2018;9:207. doi: 10.3389/fmicb.2018.00207. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  132. Янг Д. Дж., Макеева Д. С., Чжан Ф., Анисимова А. С., Столбушкина Е. А. и др. Tma64/eIF2D, Tma20/MCT-1 и Tma22/DENR повторно используют субъединицы 40S после терминации in vivo . Мол. Клетка. 2018;71:761–774.e765. doi: 10.1016/j.molcel.2018.07.028. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  133. Ким Дж. Х., Парк С. М., Парк Дж. Х., Кеум С. Дж., Джанг С. К. eIF2A опосредует трансляцию мРНК вируса гепатита С в условиях стресса. EMBO J. 2011; 30: 2454–2464. doi: 10.1038/emboj.2011.146. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  134. де Брейне С., Ю. Ю., Пестова Т. В., Хеллен К. У. Фактор требований для инициации трансляции на внутреннем сайте входа рибосомы пикорнавируса обезьяны. РНК. 2008; 14: 367–380. дои: 10.1261/РНК.696508. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  135. Ланкастер А. М., Ян Э., Сарноу П. Независимая от фактора инициации трансляция, опосредованная внутренним сайтом входа рибосомы вируса гепатита С. РНК. 2006; 12:894–902. doi: 10.1261/РНК.2342306. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  136. Локер Н., Истон Л. Е., Лукавски П. Дж. ВГС и ВКЧС IRES домен II опосредуют высвобождение eIF2 во время сборки рибосомы 80S. EMBO J. 2007; 26: 795–805. doi: 10.1038/sj.emboj.7601549. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  137. Yokoyama T., Machida K., Iwasaki W., Shigeta T., Nishimoto M., et al. IRES HCV захватывает активно транслирующую рибосому 80S. Мол. Клетка. 2019;74:1205–1214.e1208. doi: 10.1016/j.molcel.2019.04.022. [PubMed] [CrossRef] [Google Scholar]

                  138. Wilson J.E., Pestova T.V., Hellen C.U., Sarnow P. Инициация синтеза белка с А-сайта рибосомы. Клетка. 2000; 102: 511–520. doi: 10.1016/s0092-8674(00)00055-6. [PubMed] [CrossRef] [Академия Google]

                  139. Сасаки Дж., Накашима Н. Независимая от метионина инициация трансляции в капсидном белке РНК-вируса насекомых. проц. Натл. акад. науч. США. 2000;97:1512–1515. doi: 10.1073/pnas.010426997. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  140. Пфингстен Дж. С., Костантино Д. А., Кифт Дж. С. Структурная основа рекрутирования рибосом и манипулирования ими с помощью вирусной РНК IRES. Наука. 2006; 314:1450–1454. doi: 10.1126/science.1133281. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  141. Фернандес И. С., Бай Х. К., Муршудов Г., Шерес С. Х., Рамакришнан В. Инициация трансляции вирусом паралича сверчков IRES требует его транслокации в рибосоме. Клетка. 2014; 157:823–831. doi: 10.1016/j.cell.2014.04.015. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  142. Spahn C.M., Jan E., Mulder A., ​​Grassucci R.A., Sarnow P., Frank J. Крио-ЭМ-визуализация входа внутренней рибосомы вируса сайт, связанный с рибосомами человека: IRES функционирует как фактор трансляции на основе РНК. Клетка. 2004; 118: 465–475. doi: 10.1016/j.cell.2004.08.001. [PubMed] [CrossRef] [Академия Google]

                  143. Кох С. С., Брило А. Ф., Григорьев Н., Коростелев А. А. Вирус синдрома Таура IRES инициирует трансляцию, связывая свой тРНК-мРНК-подобный структурный элемент в рибосомном центре декодирования. проц. Натл. акад. науч. США. 2014; 111:9139–9144. doi: 10. 1073/pnas.1406335111. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  144. Мюррей Дж., Савва К.Г., Шин Б.С., Девер Т.Е., Рамакришнан В., Фернандес И.С. Структурная характеристика рекрутирования и транслокации рибосом с помощью IRES типа IV. Элиф. 2016;5:e13567. doi: 10.7554/eLife.13567. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  145. Muhs M., Hilal T., Mielke T., Skabkin M.A., Sanbonmatsu K.Y., et al. Крио-ЭМ рибосомных комплексов 80S с факторами терминации выявляет транслоцированный вирус паралича сверчков IRES. Мол. Клетка. 2015; 57: 422–432. doi: 10.1016/j.molcel.2014.12.016. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  146. Пфингстен Дж. С., Костантино Д. А., Кифт Дж. С. Сохранение и разнообразие трехмерных складок IRES межгенной области Dicistroviridae. Дж. Мол. биол. 2007; 370: 856–869.. doi: 10.1016/j.jmb.2007.04.076. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  147. Абаева И. С., Висенс К. , Бохлер А., Суфари Х., Симонетти А. и др. Межгенная область IRES вируса халастави арва способствует трансляции по простейшему из возможных механизмов инициации. Cell Rep. 2020; 33:108476. doi: 10.1016/j.celrep.2020.108476. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  148. Kerr C.H., Wang Q.S., Moon K.M., Keatings K., Allan D.W., et al. IRES-зависимое изменение положения рибосомы направляет трансляцию +1 перекрывающейся ORF, которая усиливает вирусную инфекцию. Нуклеиновые Кислоты Res. 2018;46:11952–11967. doi: 10.1093/nar/gky1121. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  149. Ren Q., Wang Q.S., Firth A.E., Chan M.M., Gouw J.W., et al. Выбор альтернативной рамки считывания, опосредованный тРНК-подобным доменом внутреннего сайта посадки рибосомы. проц. Натл. акад. науч. США. 2012;109:E630–639. doi: 10.1073/pnas.1111303109. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  150. Теренин И.М., Дмитриев С.Е., Андреев Д.Е., Роял Э. , Белшам Г.Дж. и др. Сайт входа в внутреннюю рибосому с перекрестным царством показывает упрощенный способ входа во внутреннюю рибосому. Мол. Клеточная биол. 2005;25:7879–7888. doi: 10.1128/MCB.25.17.7879-7888.2005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  151. Абаева И. С., Пестова Т. В., Хеллен К. У. Присоединение рибосомных комплексов и ретроградное сканирование при инициации на IRES вируса Халастави арва. Нуклеиновые Кислоты Res. 2016;44:2362–2377. doi: 10.1093/nar/gkw016. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  152. Неупане Р., Писарева В. П., Родригес К. Ф., Писарев А. В., Фернандес И. С. Комплекс IRES в 5′-UTR вирусной мРНК собирает функциональную Комплекс 48S через промежуточное соединение uAUG. Элиф. 2020;9:e54575. doi: 10.7554/eLife.54575. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  153. Gross L., Vicens Q., Einhorn E., Noireterre A., Schaeffer L., et al. IRES 5′ UTR дицистровируса вируса паралича сверчков представляет собой IRES типа III, содержащий основную структуру псевдоузла. Нуклеиновые Кислоты Res. 2017;45:8993–9004. doi: 10.1093/nar/gkx622. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  154. Majzoub K., Hafirassou M.L., Meignin C., Goto A., Marzi S., et al. RACK1 контролирует IRES-опосредованную трансляцию вирусов. Клетка. 2014;159: 1086–1095. doi: 10.1016/j.cell.2014.10.041. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  155. Робертс Р., Мэйберри Л.К., Браунинг К.С., Ракотондрафара А.М. 5′-лидер вируса Triticum Mosaic связывается с eIF4G и eIFiso4G для трансляции. ПЛОС Один. 2017;12:e0169602. doi: 10.1371/journal.pone.0169602. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  156. Джарамилло-Меса Х., Гэннон М., Хольшбах Э., Чжан Дж., Робертс Р. и др. Вирус Triticum Mosaic внутренний сайт посадки рибосомы зависит от пикорнавирусоподобного мотива YX-AUG для обозначения предпочтительного сайта инициации трансляции и, вероятно, для нацеливания на 18S рРНК. Дж. Вирол. 2019;93:e01705–18. doi: 10.1128/ОВИ.01705-18. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  157. Castelló A., Franco D., Moral-López P., Berlanga J.J., Álvarez E., et al. Протеаза ВИЧ-1 ингибирует Cap- и поли(А)-зависимую трансляцию при расщеплении eIF4GI и PABP. ПЛОС Один. 2009;4:e7997. doi: 10.1371/journal.pone.0007997. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  158. Perales C., Carrasco L., Ventoso I. Расщепление eIF4G протеазой ВИЧ-1: влияние на трансляцию. ФЭБС лат. 2003; 533: 89–94. doi: 10.1016/s0014-5793(02)03764-x. [PubMed] [CrossRef] [Google Scholar]

                  159. Ohlmann T., Prévôt D., Décimo D., Roux F., Garin J., et al. In vitro Расщепление eIF4GI, но не eIF4GII протеазой ВИЧ-1, и его влияние на трансляцию в системе лизатов ретикулоцитов кролика. Дж. Мол. биол. 2002;318:9–20. doi: 10.1016/S0022-2836(02)00070-0. [PubMed] [CrossRef] [Google Scholar]

                  160. Ventoso I., Blanco R., Perales C., Carrasco L. Протеаза ВИЧ-1 расщепляет эукариотический фактор инициации 4G и ингибирует кэп-зависимую трансляцию. проц. Натл. акад. науч. США. 2001; 98:12966–12971. doi: 10.1073/pnas.231343498. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  161. Buck C.B., Shen X., Egan M.A., Pierson T.C., Walker C.M., Siliciano R.F. Ген gag вируса иммунодефицита человека типа 1 кодирует внутреннюю запись рибосомы сайт. Дж. Вирол. 2001; 75: 181–19.1. doi: 10.1128/ОВИ.75.1.181-191.2001. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  162. Vallejos M., Carvajal F., Pino K., Navarrete C., Ferres M., et al. Функциональный и структурный анализ внутреннего сайта посадки рибосомы, присутствующего в мРНК природных вариантов ВИЧ-1. ПЛОС Один. 2012;7:e35031. doi: 10.1371/journal.pone.0035031. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  163. Brasey A., Lopez-Lastra M., Ohlmann T., Beerens N., Berkhout B., et al. Лидерная геномная РНК вируса иммунодефицита человека типа 1 содержит внутренний входной сегмент рибосомы, который активен во время фазы G2/M клеточного цикла. Дж. Вирол. 2003;77:3939–3949. doi: 10.1128/jvi.77.7.3939-3949.2003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  164. Смирнова В. В., Теренин И. М., Хуторненко А. А., Андреев Д. Е., Дмитриев С. Е., Шацкий И. Н. Несет ли 5′-нетранслируемый участок мРНК ВИЧ-1 внутреннюю рибосому место входа? Биохимия. 2016;121:228–237. doi: 10.1016/j.biochi.2015.12.004. [PubMed] [CrossRef] [Google Scholar]

                  165. Свиткин Ю. В., Пауза А., Соненберг Н. Аутоантиген облегчает трансляционную репрессию с помощью 5′-лидерной последовательности мРНК вируса иммунодефицита человека 1 типа. Дж. Вирол. 1994;68:7001–7007. doi: 10.1128/ОВИ.68.11.7001-7007.1994. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  166. Berkhout B., Arts K., Abbink T.E. Рибосомное сканирование 5′-нетранслируемой области РНК генома вируса иммунодефицита человека. Нуклеиновые Кислоты Res. 2011; 39: 5232–5244. doi: 10.1093/nar/gkr113. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  167. de Breyne S., Chamond N., Décimo D., Trabaud M.A., André P., et al. Исследования in vitro показывают, что разные способы инициации мРНК ВИЧ-1 имеют разные уровни потребности в эукариотическом факторе инициации 4F. ФЕБС Дж. 2012; 279: 3098–3111. doi: 10.1111/j.1742-4658.2012.08689.x. [PubMed] [CrossRef] [Google Scholar]

                  168. Weill L., James L., Ulryck N., Chamond N., Herbreteau C.H., et al. Новый тип IRES в кодирующей области gag рекрутирует три комплекса инициации на геномной РНК ВИЧ-2. Нуклеиновые Кислоты Res. 2010;38:1367–1381. doi: 10.1093/nar/gkp1109. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  169. Herbreteau C.H., Weill L., Décimo D., Prévôt D., Darlix J.L., et al. Геномная РНК ВИЧ-2 содержит новый тип IRES, расположенный ниже его инициирующего кодона. Нац. Структура Мол. биол. 2005; 12:1001–1007. doi: 10.1038/nsmb1011. [PubMed] [CrossRef] [Академия Google]

                  170. Акулич К. А., Андреев Д. Е., Теренин И. М., Смирнова В. В., Анисимова А. С. и др. Четыре пути инициации трансляции, используемые безлидерной мРНК у эукариот. науч. Отчет 2016; 6:37905. doi: 10.1038/srep37905. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  171. Андреев Д. Е., Теренин И. М., Дунаевский Ю. Е., Дмитриев С. Е., Шацкий И. Н. Безлидерная мРНК может связываться с 80S рибосомами млекопитающих и направлять синтез полипептидов в отсутствие Факторы инициации трансляции. Мол. Клетка. биол. 2006; 26:3164–3169.. doi: 10.1128/MCB.26.8.3164-3169.2006. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  172. Тахара С. М., Дитлин Т. А., Девер Т. Е., Меррик В. К., Уоррилоу Л. М. Влияние эукариотического фактора инициации 4F на отбор AUG в бицистронной мРНК. Дж. Биол. хим. 1991; 266:3594–3601. doi: 10.1016/S0021-9258(19)67836-1. [PubMed] [CrossRef] [Google Scholar]

                  173. Баррера А., Ольгин В., Вера-Отарола Дж., Лопес-Ластра М. Cap-независимая инициация трансляции несплайсированной РНК ретровирусов. Биохим. Биофиз. Акта Джин Регул. мех. 2020;1863:1. doi: 10.1016/j.bbagrm.2020.1. [PubMed] [CrossRef] [Google Scholar]

                  174. Song Y., Mugavero J., Stauft C.B., Wimmer E. Вирус денге и Зика. 5′-нетранслируемые области выполняют внутренние функции сайта входа рибосомы. мБио. 2019;10:e00459–19. doi: 10.1128/mBio.00459-19. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  175. Fernández-García L., Angulo J., Ramos H., Barrera A., Pino K., et al. Внутренний сайт посадки рибосомы мРНК вируса Денге активен, когда кэп-зависимая инициация трансляции ингибируется. Дж. Вирол. 2020 г.: 10.1128/ОВИ.01998-20. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  176. Дорохов Ю.Л., Скулачев М.В., Иванов П.А., Зверева С.Д., Тюлькина Л.Г., и др. Последовательности, богатые полипурином (A), способствуют сохранению межцарственного входа во внутреннюю рибосому. проц. Натл. акад. науч. США. 2002; 99: 5301–5306. doi: 10.1073/pnas.082107599. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  177. Дорохов Ю. Л., Шешукова Е. В., Комарова Т. В. Перекрытие 3′-концевого гена тобамовируса может быть механизмом улучшения приспособленности внутри хозяина. Фронт. микробиол. 2017; 8:851. дои: 10.3389/fmicb.2017.00851. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  178. May J., Johnson P., Saleem H., Simon A.E. Независимый от последовательности, неструктурированный внутренний сайт посадки рибосомы отвечает за внутреннюю экспрессию белок оболочки вируса морщинистости турнепса . Дж. Вирол. 2017; 91:e02421–16. doi: 10.1128/ОВИ.02421-16. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  179. Yuan X., Shi K., Meskauskas A., Simon A.E. 3′-конец Репа Вирус морщинки содержит высокоинтерактивную структуру, включающую трансляционный энхансер, который разрушается при связывании с РНК-зависимой РНК-полимеразой. РНК. 2009; 15:1849–1864. doi: 10.1261/rna.1708709. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  180. Тредер К., Кнеллер Э. Л., Аллен Э. М., Ван З., Браунинг К. С., Миллер В. А. 3′-независимый от крышки трансляционный элемент желтого карлика ячменя. вирус связывает eIF4F через субъединицу eIF4G, чтобы инициировать трансляцию. РНК. 2008; 14:134–147. doi: 10.1261/rna.777308. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  181. Gazo B.M., Murphy P., Gatchel J.R., Browning K.S. Новое взаимодействие белковых комплексов Cap-связывающего эукариотического фактора инициации (eIF) 4F и eIF(iso)4F с областью в 3′-нетранслируемой области сателлита вирус некроза табака. Дж. Биол. хим. 2004; 279:13584–13592. doi: 10.1074/jbc.M311361200. [PubMed] [CrossRef] [Google Scholar]

                  182. Ван З., Тредер К., Миллер В. А. Структура вирусного кэп-независимого трансляционного элемента, который функционирует посредством высокоаффинного связывания с субъединицей eIF4E eIF4F. Дж. Биол. хим. 2009 г.;284:14189–14202. doi: 10.1074/jbc.M808841200. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  183. Николсон Б.Л., Ву Б., Чевченко И., Уайт К.А. Tombusvirus рекрутирование трансляционного механизма хозяина через 3’UTR. РНК. 2010;16:1402–1419. doi: 10.1261/РНК.2135210. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  184. Nicholson B.L., Zaslaver O., Mayberry L.K., Browning K.S., White K.A. Y-образный трансляционный энхансер Tombusvirus образует комплекс с eIF4F и может быть функционально заменен гетерологичными трансляционными энхансерами. Дж. Вирол. 2013; 87: 1872–1883. doi: 10.1128/ОВИ.02711-12. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  185. Ступина В. А., Мескаускас А., МакКормак Дж. К., Инлинг Ю. Г., Шапиро Б. А. и др. 3′-проксимальный энхансер трансляции вируса морщинки турнепса связывается с 60S рибосомными субъединицами. РНК. 2008; 14: 2379–2393. doi: 10.1261/РНК.1227808. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  186. Gao F., Kasprzak W., Stupina V.A., Shapiro B.A., Simon A.E. Связывающий рибосомы 3′-трансляционный энхансер имеет Т-образную структуру и участвует в дальних взаимодействиях РНК-РНК. Дж. Вирол. 2012;86:9828–9842. doi: 10.1128/ОВИ.00677-12. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  187. Zuo X., Wang J., Yu P., Eyler D., Xu H., et al. Структура раствора кэп-независимого трансляционного энхансера и связывающего рибосому элемента в 3′-UTR вируса морщинки турнепса . проц. Натл. акад. науч. США. 2010;107:1385–1390. doi: 10.1073/pnas.0

                  0107. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  188. Gao F., Gulay S.P., Kasprzak W., Dinman J.D., Shapiro B.A., Simon A.E. Трансляционный энхансер гороха в виде Т-образной структуры поцелуев. Вирус энационной мозаики может связываться одновременно с рибосомами и 5′-проксимальной шпилькой. Дж. Вирол. 2013;87:11987–12002. doi: 10.1128/ОВИ.02005-13. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  189. Zhao P., Liu Q., Miller W.A., Goss D.J. Эукариотический фактор инициации трансляции 4G (eIF4G) координирует взаимодействие с eIF4A, eIF4B и eIF4E в связывание и трансляция 3′-кэп-независимого трансляционного элемента (BTE) вируса желтой карликовости ячменя J. Biol. хим. 2017; 292:5921–5931. doi: 10.1074/jbc.M116.764902. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  190. Wang Z., Parisien M., Scheets K., Miller W. A. ​​Фактор инициации трансляции, связывающийся с кэпом, eIF4E, связывает псевдоузел в вирусном кэпе -самостоятельный элемент перевода. Структура. 2011;19: 868–880. doi: 10.1016/j.str.2011.03.013. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  191. Ду З., Алехина О. М., Василенко К. С., Симон А. Е. Согласованное действие двух 3′-кэп-независимых энхансеров трансляции повышает конкурентоспособность транслируемых вирусных геномов . Нуклеиновые Кислоты Res. 2017;45:9558–9572. doi: 10.1093/nar/gkx643. [Статья PMC free] [PubMed] [CrossRef] [Google Scholar]

                  192. Шарма Г., Ступина В., Паллесен Дж., Шапиро Б., Саймон А., Динман Дж., Фрэнк Дж. Криоэлектронная микроскопия (Cryo-EM) структура кэп-независимого трансляционного энхансера Вирус морщинки репы (TCV), связанный с эукариотической рибосомой. Биофиз. Дж. 2012; 102:393А. doi: 10.1016/j.bpj.2011.11.2147. [CrossRef] [Google Scholar]

                  193. Мирас М., Семпере Р. Н., Крафт Дж. Дж., Миллер В. А., Аранда М. А., Трунигер В. Межсемейная рекомбинация между вирусами привела к приобретению нового усиливающего трансляцию элемента РНК, который позволяет сломать резистентность. Новый Фитол. 2014; 202: 233–246. doi: 10.1111/nph.12650. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  194. Guo L., Allen E.M., Miller W.A. Спаривание оснований между нетранслируемыми областями облегчает трансляцию непокрытой полиаденилированной вирусной РНК. Мол. Клетка. 2001;7:1103–1109. doi: 10.1016/s1097-2765(01)00252-0. [PubMed] [CrossRef] [Google Scholar]

                  195. Гао Ф., Алехина О. М., Василенко К. С., Саймон А. Е. Необычная дицистронная экспрессия из близко расположенных инициирующих кодонов в субгеномной РНК умбравируса. Нуклеиновые Кислоты Res. 2018;46:11726–11742. doi: 10.1093/nar/gky871. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  196. Rakotondrafara A.M., Polacek C., Harris E., Miller W.A. Осциллирующие взаимодействия ствол-петля поцелуев опосредуют 5′-зависимую от сканирования трансляцию с помощью вирусного 3′-кэп-независимого элемента трансляции. РНК. 2006; 12:1893–1906. doi: 10.1261/rna.115606. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  197. Фабиан М. Р., Уайт К. А. Анализ энхансера 3′-трансляции в томбусвирусе: динамическая модель РНК-РНК взаимодействий концов мРНК. РНК. 2006; 12:1304–1314. дои: 10.1261/РНК.69506. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  198. Sarawaneearuk S., Iwakawa H. O., Mizumoto H., Murakami H., Kaido M., et al. Зависимая от хозяина роль вирусной 5′-нетранслируемой области (UTR) в стабилизации РНК и кэп-независимом усилении трансляции, опосредованном 3′-UTR РНК1 вируса некротической мозаики красного клевера. Вирусология. 2009; 391:107–118. doi: 10.1016/j.virol.2009.05.037. [PubMed] [CrossRef] [Google Scholar]

                  199. Каретников А. , Лехто К. Механизмы трансляции, включающие дальние взаимодействия спаривания оснований между 5′- и 3′-нетранслируемыми областями и внутреннюю рибосомную фиксацию, консервативны для обоих геномных РНК реверсионного неповируса черной смородины. Вирусология. 2008;371:292–308. doi: 10.1016/j.virol.2007.10.003. [PubMed] [CrossRef] [Google Scholar]

                  200. Шарма С. Д., Крафт Дж. Дж., Миллер В. А., Госс Д. Дж. Рекрутирование субъединицы рибосомы 40S в 3′-нетранслируемую область (UTR) вирусной мРНК через комплекс eIF4 , облегчает независимый от заглавных букв перевод. Дж. Биол. хим. 2015; 290:11268–11281. doi: 10.1074/jbc.M115.645002. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  201. Ступина В. А., Юань X., Мескаускас А., Динман Дж. Д., Саймон А. Е. Связывание рибосомы с 5′-трансляционным энхансером изменяется в присутствии 3′-нетранслируемая область в кэп-независимой трансляции вируса морщинистости репы. Дж. Вирол. 2011;85:4638–4653. doi: 10.1128/ОВИ.00005-11. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  202. Йоши М., Нисикиори М., Томита К., Йошиока Н., Кодзука Р. и др. Локусы 1 и 2 размножения кукумовируса арабидопсиса кодируют факторы инициации трансляции 4E и 4G. Дж. Вирол. 2004; 78: 6102–6111. doi: 10.1128/ОВИ.78.12.6102-6111.2004. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  203. Gao F., Simon A.E. Множественные Cis -действующие элементы модулируют запрограммированный -1 рибосомный сдвиг рамки считывания в вирусе мозаики гороха. Нуклеиновые Кислоты Res. 2016;44:878–895. doi: 10.1093/nar/gkv1241. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  204. Мацуда Д., Дреер Т. В. ТРНК-подобная структура РНК вируса желтой мозаики репы представляет собой 3′-трансляционный энхансер. Вирусология. 2004; 321:36–46. doi: 10.1016/j.virol.2003.10.023. [PubMed] [CrossRef] [Google Scholar]

                  205. Колусси Т. М., Костантино Д. А., Хаммонд Дж. А., Рюле Г. М., Никс Дж. К., Кифт Дж. С. Структурная основа мимикрии транспортной РНК и конформационной пластичности вирусной РНК. Природа. 2014; 511:366–369. doi: 10.1038/nature13378. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  206. Haenni A.L., Joshi S., Chapeville F. ТРНК-подобные структуры в геномах РНК-вирусов. прог. Нуклеиновая Кислота Рез. Мол. биол. 1982; 27: 85–104. doi: 10.1016/s0079-6603(08)60598-x. [PubMed] [CrossRef] [Google Scholar]

                  207. Barends S., Bink HH, van den Worm S.H., Pleij C.W., Kraal B. Захват рибосом для вирусной трансляции: мимикрия тРНК как молекулярный троянский конь. Клетка. 2003; 112: 123–129.. doi: 10.1016/s0092-8674(02)01256-4. [PubMed] [CrossRef] [Google Scholar]

                  208. Matsuda D., Dreher T.W. Cap- и инициаторная тРНК-зависимая инициация синтеза полипротеина TYMV рибосомами: оценка модели троянского коня для трансляции РНК TYMV. РНК. 2007; 13: 129–137. doi: 10.1261/РНК.244407. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  209. Галли Д. Р., Кобаяши М. Роль 3′-нетранслируемой области неполиаденилированных вирусных мРНК растений в регуляции эффективности трансляции. Ген. 1994;142:159–165. doi: 10.1016/0378-1119(94)

                  -9. [PubMed] [CrossRef] [Google Scholar]

                  210. Barends S., Rudinger-Thirion J., Florentz C., Giegé R., Pleij C.W., Kraal B. тРНК-подобная структура регулирует трансляцию вируса мозаики костра РНК. Дж. Вирол. 2004; 78:4003–4010. doi: 10.1128/jvi.78.8.4003-4010.2004. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  211. Лезерс В., Тангуай Р., Кобаяши М., Галли Д. Р. Филогенетически консервативная последовательность внутри вирусных 3′-нетранслируемых псевдоузлов РНК регулирует трансляцию. Мол. Клетка. биол. 1993;13:5331–5347. doi: 10.1128/mcb.13.9.5331-5347.1993. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  212. Matsuda D., Dunoyer P., Hemmer O., Fritsch C., Dreher T.W. не являются существенными, но обеспечивают скромное конкурентное преимущество на предприятиях. Дж. Вирол. 2000;74:8720–8725. doi: 10.1128/jvi.74.18.8720-8725.2000. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  213. Гордон К. Х., Джонсон К. Н., Ханзлик Т. Н. Более крупная геномная РНК тетравируса Helicoverpa armigera stunt кодирует вирусную РНК-полимеразу и имеет новую 3′-концевую тРНК. -подобная структура. Вирусология. 1995;208:84–98. doi: 10.1006/viro.1995.1132. [PubMed] [CrossRef] [Google Scholar]

                  214. Шерлок М.Е., Хартвик Э.В., Макфадден А., Кифт Дж.С. Структурное разнообразие и филогенетическое распространение валил-тРНК-подобных структур в вирусах. РНК. 2021; 27: 27–39. doi: 10.1261/РНК.076968.120. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  215. Poncet D., Laurent S., Cohen J. Минимальное требование для распознавания РНК ротавирусным неструктурным белком NSP3 — четыре нуклеотида. EMBO J. 1994;13:4165–4173. doi: 10.1002/j.1460-2075.1994.tb06734.x. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  216. Грофт С. М., Берли С. К. Распознавание eIF4G ротавирусом NSP3 раскрывает основу для циркуляризации мРНК. Мол. Клетка. 2002; 9: 1273–1283. doi: 10. 1016/s1097-2765(02)00555-5. [PubMed] [CrossRef] [Google Scholar]

                  217. Vende P., Piron M., Castagné N., Poncet D. Эффективная трансляция мРНК ротавируса требует одновременного взаимодействия NSP3 с эукариотическим фактором инициации трансляции eIF4G и мРНК 3. ‘ конец. Дж. Вирол. 2000; 74: 7064–7071. doi: 10.1128/jvi.74.15.7064-7071.2000. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  218. Olsthorn R. C., Mertens S., Brederode F. T., Bol J. F. Конформационный переключатель на 3′-конце РНК растительного вируса регулирует репликацию вируса. EMBO J. 1999; 18:4856–4864. doi: 10.1093/emboj/18.17.4856. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  219. Chen S.C., Olsthoorn R.C. In vitro и in vivo исследования конформационного переключения РНК в вирусе мозаики люцерны . Дж. Вирол. 2010; 84: 1423–1429. doi: 10.1128/ОВИ.01443-09. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  220. Krab I.M., Caldwell C. , Gallie D.R., Bol JF. Белок оболочки повышает эффективность трансляции РНК вируса мозаики люцерны и взаимодействует с компонентом eIF4G фактора инициации. eIF4F. Дж. Генерал Вирол. 2005; 86: 1841–1849. doi: 10.1099/vir.0.80796-0. [PubMed] [CrossRef] [Google Scholar]

                  221. Холден К.Л., Харрис Э. Усиление трансляции вируса денге: роль 3′-нетранслируемой области и терминального 3′-домена ствол-петля. Вирусология. 2004;329: 119–133. doi: 10.1016/j.virol.2004.08.004. [PubMed] [CrossRef] [Google Scholar]

                  222. Бунг С., Бочкаева З., Теренин И., Зиновкин Р., Шацкий И. Н., Нипманн М. Влияние 3′-нетранслируемой области вируса гепатита С на IRES- зависимая и кап-зависимая инициация трансляции. ФЭБС лат. 2010; 584: 837–842. doi: 10.1016/j.febslet.2010.01.015. [PubMed] [CrossRef] [Google Scholar]

                  223. Гунишова С., Хронова В., Мохаммад М. П., Хиннебуш А. Г., Валашек Л. С. Пожалуйста, не перерабатывайте! Реинициация трансляции у микробов и высших эукариот. ФЭМС микробиол. 2018; 42:165–192. doi: 10.1093/femsre/fux059. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  224. Пауэлл М. Л. Прекращение трансляции-повторная инициация в РНК-вирусах. Биохим. соц. Транс. 2010; 38:1558–1564. doi: 10.1042/BST0381558. [PubMed] [CrossRef] [Google Scholar]

                  225. Pöyry T. A., Kaminski A., Connell E. J., Fraser C. S., Jackson R. J. Механизм исключительного случая реинициации после трансляции длинной ORF показывает, почему такие события обычно не происходят. происходят в трансляции мРНК млекопитающих. Гены Дев. 2007;21:3149–3162. doi: 10.1101/gad.439507. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  226. Мейерс Г. Характеристика элемента последовательности, направляющего реинициацию трансляции в РНК калицивируса вируса геморрагической болезни кролика. Дж. Вирол. 2007; 81: 9623–9632. doi: 10.1128/ОВИ.00771-07. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  227. Meyers G. Трансляция минорного капсидного белка калицивируса инициируется новым механизмом повторной инициации, зависящим от терминации. Дж. Биол. хим. 2003; 278:34051–34060. doi: 10.1074/jbc.M304874200. [PubMed] [CrossRef] [Академия Google]

                  228. Wenesz R., Luttermann C., Kreher F., Meyers G. Структурно-функциональная взаимосвязь в «сайте связывания рибосом выше по течению» калицивируса вируса геморрагической болезни кролика. Нуклеиновые Кислоты Res. 2019;47:1920–1934. doi: 10.1093/nar/gkz021. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  229. Luttermann C., Meyers G. Важность меж- и внутримолекулярного спаривания оснований для повторной инициации трансляции на эукариотической бицистронной мРНК. Гены Дев. 2009; 23: 331–344. doi: 10.1101/gad.507609. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  230. Зиновьев А., Хеллен К. У. Т., Пестова Т. В. Множественные механизмы реинициации на мРНК бицистронного калицивируса. Мол. Клетка. 2015;57:1059–1073. doi: 10.1016/j.molcel.2015.01.039. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

                  231. Пауэлл М.Л., Ли К. Е., Пойри Т.А., Джексон Р.Дж., Браун Т.Д., Брайерли И. Дальнейшая характеристика трансляционного сигнала терминации-повторной инициации гриппа B Сегмент 7 вируса РНК. ПЛОС Один. 2011;6:e16822. doi: 10.1371/journal.pone.0016822. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  232. Powell M.L., Napthine S., Jackson R.J., Brierley I., Brown T.D. Характеристика стратегии терминации-повторной инициации, используемой при экспрессии белка BM2 вируса гриппа B. РНК. 2008; 14: 2394–2406. doi: 10.1261/РНК.1231008. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  233. Абаева И. С., Маринчев А., Писарева В. П., Хеллен К. У., Пестова Т. В. Обход стеблей в сравнении с линейным пошаговым исследованием мРНК млекопитающих во время рибосомного анализа. сканирование. EMBO J. 2011; 30: 115–129.. doi: 10.1038/emboj.2010.302. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  234. Щепетильников М., Кобаяши К., Гелдрайх А., Каранта К., Робалья К. и др. Вирусный фактор TAV рекрутирует передачу сигналов TOR/S6K1 для активации повторной инициации после длинной трансляции ORF. EMBO J. 2011; 30: 1343–1356. doi: 10.1038/emboj.2011.39. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  235. Щепетильников М., Рябова Л. А. Недавние открытия о роли передачи сигналов TOR (Target of rapamycin) в трансляции у растений. Завод Физиол. 2018;176:1095–1105. doi: 10.1104/стр.17.01243. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  236. Thiébeauld O., Schepetilnikov M., Park H.S., Geldreich A., Kobayashi K., et al. Новый растительный белок взаимодействует с eIF3 и 60S, усиливая активируемую вирусом повторную инициацию трансляции. EMBO J. 2009; 28: 3171–3184. doi: 10.1038/emboj.2009.256. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  237. Mancera-Martínez E., Dong Y., Makarian J., Srour O., Thiébeauld O., et al. Фосфорилирование поддерживающего реинициацию белка, RISP, определяет его функцию в реинициации трансляции. Нуклеиновые Кислоты Res. 2021;49: 6908–6924. doi: 10.1093/nar/gkab501. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  238. Скабкин М. А., Скабкина О. В., Хеллен К. У., Пестова Т. В. Реинициация и другие нетрадиционные посттерминационные события при эукариотической трансляции. Мол. Клетка. 2013; 51: 249–264. doi: 10.1016/j.molcel.2013.05.026. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  239. Young D. J., Guydosh N. R., Zhang F., Hinnebusch A. G., Green R. Rli1/ABCE1 рециклирует терминирующие рибосомы и контролирует повторную инициацию трансляции в 3′-UTR. in vivo . Клетка. 2015; 162: 872–884. doi: 10.1016/j.cell.2015.07.041. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  240. Brown, JD, and Ryan, MD (2010) Ribosome «Skipping»: «Stop-Carry On» или «StopGo» Перевод . в Recoding: Expansion of Decoding Rules Enriches Gene Expression (Atkins, JF, and Gesteland, RF, eds.) Springer New York, New York, NY, стр. 101-121.

                  241. Liu Z., Chen O., Wall J.B.J., Zheng M., Zhou Y., et al. Систематическое сравнение пептидов 2А для клонирования мультигенов в полицистронном векторе. науч. 2017;7:2193. doi: 10.1038/s41598-017-02460-2. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  242. Pamudurti N.R., Bartok O., Jens M., Ashwal-Fluss R., Stottmeister C., et al. Трансляция кольцевых РНК. Мол Ячейка. 2017;66:9–21.e27. doi: 10.1016/j.molcel.2017.02.021. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  243. Тагава Т., Копарде В. Н., Зигельбауэр Дж. М. Идентификация и характеристика кольцевых РНК, кодируемых вирусом. Методы. 2021 г.: 10.1016/j.ymeth.2021.03.004. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  244. Чжао Дж., Ли Э. Э., Ким Дж., Ян Р., Чамседдин Б. и соавт. Трансформирующая активность кольцевой РНК, кодирующей онкопротеин, из вируса папилломы человека. Нац. коммун. 2019;10:2300. doi: 10.1038/s41467-019-10246-5. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  245. Tan K. E., Lim Y. Y. Вирусы присоединяются к круговому миру РНК. FEBS J. 2020 doi: 10.1111/febs.15639. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  246. AbouHaidar M.G., Venkataraman S., Golshani A., Liu B., Ahmad T. Новое кодирование, трансляция и генная экспрессия реплицирующегося ковалентно замкнутого кольцевая РНК из 220 н. проц. Натл. акад. науч. США. 2014;111:14542–14547. doi: 10.1073/pnas.1402814111. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  247. Thoms M., Buschauer R., Ameismeier M., Koepke L., Denk T., et al. Структурная основа выключения трансляции и уклонения от иммунного ответа белком Nsp1 SARS-CoV-2. Наука. 2020;369:1249–1255. doi: 10.1126/science.abc8665. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  248. Yuan S., Peng L., Park J.J., Hu Y., Devarkar S.C., et al. Неструктурный белок 1 SARS-CoV-2 является мощным фактором патогенности, перенаправляющим механизм синтеза белка хозяина на вирусную РНК. Мол. Клетка. 2020;80:1055–1066.e1056. doi: 10.1016/j.molcel.2020.10.034. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  249. Schubert K., Karousis E.D., Jomaa A. , Scaiola A., Echeverria B., et al. Nsp1 SARS-CoV-2 связывается с рибосомным каналом мРНК, подавляя трансляцию. Нац. Структура Мол. биол. 2020; 27: 959–966. doi: 10.1038/s41594-020-0511-8. [PubMed] [CrossRef] [Google Scholar]

                  250. Vankadari N., Jeyasankar N. N., Lopes W. J. Структура комплекса SARS-CoV-2 Nsp1/5′-нетранслируемой области и последствия для потенциальных терапевтических целей, вакцины и вирулентность. Дж. Физ. хим. лат. 2020;11:9659–9668. doi: 10.1021/acs.jpclett.0c02818. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  251. Tidu A., Janvier A., ​​Schaeffer L., Sosnowski P., Kuhn L., et al. Вирусный белок NSP1 действует как рибосомный привратник, отключая трансляцию хозяина и стимулируя трансляцию SARS-CoV-2. РНК. 2020 г.: 10.1261/rna.078121.120. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  252. Shi M., Wang L., Fontana P., Vora S., Zhang Y., et al. SARS-CoV-2 Nsp1 подавляет трансляцию хозяина, но не вируса, посредством двустороннего механизма. bioRxiv. 2020 год: 10.1101/2020.09.18.302901. [CrossRef] [Google Scholar]

                  253. Lapointe C.P., Grosely R., Johnson A.G., Wang J., Fernandez I.S., Puglisi J.D. Динамическая конкуренция между NSP1 SARS-CoV-2 и мРНК на рибосоме человека ингибирует инициацию трансляции. проц. Натл. акад. науч. США. 2021;118:e2017715118. doi: 10.1073/pnas.2017715118. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  254. Huang C., Lokugamage K.G., Rozovics J.M., Narayanan K., Semler B.L., Makino S. Белок nsp1 коронавируса SARS индуцирует зависимое от матрицы эндонуклеолитическое расщепление мРНК: вирусные мРНК устойчивы к расщеплению РНК, индуцированному nsp1. PLoS Патог. 2011;7:e1002433. doi: 10.1371/journal.ppat.1002433. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  255. Уолш Д., Мор И. Вирусная диверсия механизма синтеза белка хозяина. Нац. Преподобный Микробиолог. 2011; 9: 860–875. doi: 10.1038/nrmicro2655. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  256. Cantu F., Cao S., Hernandez C., Dhungel P., Spradlin J., Yang Z. Декапирующие ферменты, кодируемые поксвирусом, способствуют селективной трансляции вирусных мРНК. PLoS Патог. 2020;16:e1008926. doi: 10.1371/journal.ppat.1008926. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  257. Decroly E., Ferron F., Lescar J., Canard B. Обычные и нетрадиционные механизмы кэпирования вирусной мРНК. Нац. Преподобный Микробиолог. 2011;10:51–65. doi: 10.1038/nrmicro2675. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  258. Лашкевич К. А., Дмитриев С. Е. Таргетинг, транспорт и локальная трансляция мРНК в эукариотических клетках: от классического взгляда к многообразию новых концепций. Мол. биол. 2021 г.: 10.1134/S00268030080. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  259. Romero-Brey I., Bartenschlager R. Фабрики мембранной репликации, индуцируемые вирусами с плюс-цепью РНК. Вирусы. 2014;6:2826–2857. doi: 10.3390/v6072826. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  260. Reineke LC, Lloyd RE. Отклонение стрессовых гранул и P-тел при вирусной инфекции. Вирусология. 2013; 436: 255–267. doi: 10.1016/j.virol.2012.11.017. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  261. McCormick C., Khaperskyy D.A. Ингибирование трансляции и стрессовые гранулы в противовирусном иммунном ответе. Нац. Преподобный Иммунол. 2017; 17: 647–660. doi: 10.1038/nri.2017.63. [PubMed] [CrossRef] [Академия Google]

                  262. Dzananovic E., McKenna S.A., Patel T.R. Вирусные белки, нацеленные на протеинкиназу R хозяина, чтобы уклониться от врожденного иммунного ответа: мини-обзор. Биотехнолог. Жене. англ. 2018; 34:33–59. doi: 10.1080/02648725.2018.1467151. [PubMed] [CrossRef] [Google Scholar]

                  263. Алонсо М. А., Карраско Л. Реверсия гипотонической средой остановки синтеза белка, вызванной вирусом энцефаломиокардита. Дж. Вирол. 1981; 37: 535–540. doi: 10.1128/ОВИ.37.2.535-540.1981. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  264. Nair C. N. Метаболизм одновалентных катионов и цитопатические эффекты инфицированных полиовирусом клеток HeLa. Дж. Вирол. 1981; 37: 268–273. doi: 10.1128/ОВИ.37.1.268-273.1981. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

                  265. Дмитриев С.Е., Владимиров Д.О., Лашкевич К.А. Краткое руководство по низкомолекулярным ингибиторам синтеза эукариотических белков. Биохимия (Москва) 2020;85:1389–1421. doi: 10.1134/S00062970097. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

                  mtIF3 локально транслируется в аксонах и регулирует митохондриальную трансляцию для роста аксонов | BMC Biology

                  • Исследовательская статья
                  • Открытый доступ
                  • Опубликовано:
                  • Соён Ли 1,2 na2 ,
                  • Донгын Парк 1,2 na2 ,
                  • Чхунхун Лим 1 ,
                  • Дже-Ик Ким ORCID: orcid. org/0000-0001-9705-0394 1 и
                  • Кьюнг-Тай Мин 1,2 na1  

                  Биология BMC том 20 , Номер статьи: 12 (2022) Процитировать эту статью

                  • 1779 доступов

                  • 1 Цитаты

                  • 6 Альтметрический

                  • Сведения о показателях

                  Abstract

                  Background

                  Установление и поддержание функциональных нейронных связей зависит от соответствующего распределения и локализации митохондрий в нейритах, поскольку эти органеллы обеспечивают необходимую энергию и метаболиты. В частности, митохондрии транспортируются к аксонам и поддерживают локальное производство энергии для поддержания энергоемких нейронных процессов, включая ветвление, рост и регенерацию аксонов. Кроме того, локальный синтез белка необходим для структурных и функциональных изменений в аксонах, при этом митохондриальные мРНК, кодируемые ядром, локализованы в аксонах. Однако остается неясным, транслируются ли эти мРНК локально и участвуют ли потенциально транслируемые митохондриальные белки в регуляции митохондриальных функций в аксонах. Здесь мы стремимся лучше понять цель такой компартментализации, сосредоточив внимание на роли митохондриального фактора инициации 3 (mtIF3), чьи ядерно-кодируемые транскрипты, как было показано, присутствуют в конусах роста аксонов.

                  Результаты

                  Мы продемонстрировали, что нейротрофический фактор головного мозга (BDNF) индуцирует локальную трансляцию мРНК mtIF3 в конусах роста аксонов. Впоследствии белок mtIF3 транслоцируется в аксональные митохондрии и способствует митохондриальной трансляции, по оценке нашего недавно разработанного бимолекулярного флуоресцентного датчика комплементации для сборки митохондриальных рибосом. Далее мы показываем, что BDNF-индуцированный рост аксонов требует mtIF3-зависимой митохондриальной трансляции в дистальных аксонах.

                  Заключение

                  Мы описываем ранее неизвестную функцию митохондриального фактора инициации 3 (mtIF3) в синтезе и развитии белков аксонов. Эти находки дают представление о том, как нейроны адаптивно контролируют митохондриальную физиологию и развитие аксонов посредством локальной трансляции mtIF3.

                  История вопроса

                  Комплексы митохондриального окислительного фосфорилирования в первую очередь генерируют АТФ, необходимый для клеточной функции в телах нейронов и нейритах. Фактически митохондрии транспортируются к аксонам и производят локальную энергию для ветвления аксонов, формирования конусов роста и роста аксонов [1,2,3]. Локализованные митохондрии также играют важную роль в облегчении регенерации аксонов после повреждения [4,5,6]. Таким образом, быстрый синтез АТФ в ответ на локальную потребность в энергии, вероятно, имеет решающее значение, особенно для поляризованной функции нейронов.

                  Хотя было показано, что активный митохондриальный транспорт к кончику аксона поддерживает локальные потребности в энергии [7, 8], этого может быть недостаточно для объяснения того, как нейроны адаптивно регулируют митохондриальную функцию в аксоне [9]. Следовательно, мы считаем, что дополнительные механизмы, такие как локальный синтез митохондриальных белков, должны способствовать функциональному контролю аксональных митохондрий. Большинство митохондриальных генов кодируются в ядре, и после транскрипции их мРНК трансляция обычно происходит в телах клеток. С другой стороны, предыдущие исследования показали, что транскрипты митохондриальных генов, кодируемых ядром, могут локально транслироваться в дистальных аксонах [10,11,12,13,14]. Тем не менее, все еще неясно, управляет ли какой-либо локальный синтез митохондриальных белков, кодируемых ядром, митохондриальной функцией в конусе роста аксона.

                  В клетках млекопитающих митохондрии имеют только два фактора инициации митохондриальной трансляции, mtIF2 и mtIF3 [15]. Интересно, что транслатомные анализы выявили трансляцию mtIF3 в конусе роста аксонов [11], указывая на возможную роль локального синтеза mtIF3 в регуляции аксональной митохондриальной трансляции. mtIF3 регулирует динамику ассоциации рибосом на мРНК митохондрий. mtIF3 катализирует диссоциацию митохондриальных рибосом (миторибосом) на большую и малую субъединицы, блокируя любое преждевременное связывание большой субъединицы [16, 17]. mtIF2 и N-formylmethionine-tRNA слабо связываются с малой субъединицей в отсутствие мРНК, но mtIF3 облегчает связывание мРНК с малой субъединицей, так что стартовый кодон может быть правильно расположен в P-сайте [15, 17].

                  Учитывая критическую роль mtIF3 в инициации митохондриальной трансляции [18], вполне вероятно, что локально синтезированный mtIF3 может регулировать митохондриальную трансляцию в развивающихся аксонах для поддержки синтеза АТФ и соответствующей физиологии. Однако исследованиям митохондриальной трансляции в живых клетках препятствует отсутствие соответствующих инструментов. Здесь мы разработали молекулярный сенсор, который визуализирует митохондриальную трансляционную активность с использованием бимолекулярной флуоресцентной комплементации (BiFC) между определенной парой белков миторибосом. В сочетании с дополнительными трансгенными репортерами для функциональной визуализации этот новый инструмент привел нас к проверке вышеприведенной гипотезы и подтверждению значения локальной трансляции mtIF3 в митохондриальной физиологии и росте аксонов.

                  Результаты

                  BDNF индуцирует локальный синтез белка mtIF3 в конусе роста аксона

                  Сначала мы подтвердили, что мРНК mtIF3 присутствуют как в телах клеток, так и в аксонах первичных нейронов гиппокампа (рис. 1а), что согласуется с предыдущим отчетом [11]. . Чтобы проверить, транслоцируются ли локально транслируемые белки mtIF3 в митохондрии, мы создали трансген, который экспрессирует флуоресцентные белки mtIF3, слитые с фотоконвертируемыми Dendra2 вместе с нетранслируемыми областями (UTR) mtIF3 (5’UTR 9). 0683 mtIF3 -mtIF3-Dendra2-3’UTR mtIF3 ). Как и ожидалось, кодирующая последовательность (CDS) mtIF3 привела к митохондриальной локализации слияния mtIF3-Dendra2 в первичных нейронах гиппокампа, вероятно, из-за его митохондриальной нацеливающей последовательности [20] (Дополнительный файл 1: Fig. S1a, b). Далее мы использовали микрожидкостное устройство для разделения клеточных тел и аксонов первичных нейронов гиппокампа на две отдельные камеры [21] (рис. 1b) и оценки локальных эффектов в конусе роста аксонов. Флуоресцентные белки mtIF3-Dendra2 на кончиках аксонов были необратимо фотопереключены с зеленого на красный с использованием освещения 405 нм, а затем были измерены вновь транслированные белки mtIF3-Dendra2 с зеленой флуоресценцией путем анализа изображений с интервальной съемкой, сделанных каждые 5 минут в течение 90 мин. Несколько исследований показали, что многие митохондриальные белки, кодируемые ядром, могут быть синтезированы в ответ на локальную потребность в энергии [11,12,13,14]. Это побудило нас исследовать, усиливает ли обработка BDNF в аксональной камере микрофлюидных устройств локальную трансляцию репортера слияния mtIF3-Dendra2, тем самым приводя к его митохондриальной транслокации в конусе роста аксонов. Мы провели кимографический анализ дистальных аксонов размером ~ 20 мкм и обнаружили, что локальная обработка BDNF действительно повышала вновь синтезированные сигналы mtIF3-Dendra2 в аксональных митохондриях 5’UTR 9.0683 mtIF3 -mtIF3-Dendra2-3’UTR mtIF3 трансфицированных клеток (рис. 1c, d; дополнительный файл 1: рис. S1c). Общий ингибитор трансляции, анизомицин, блокировал синтез репортерного белка de novo, подтверждая, что белок mtIF3 трансляционно активируется при обработке BDNF. Большинство аксональных белков синтезируются в теле клетки и активно транспортируются к аксонам [22]. Чтобы исключить возможность транспорта вновь транслированного mtIF3-Dendra2 из тела клетки при стимуляции BDNF, мы создали конструкцию mtIF3-Dendra2 без UTR (mtIF3-Dendra2). Учитывая, что 3’UTR mtIF3 содержит консенсусный мотив (CTCCCATC), общий для обогащенных аксоном мРНК [11], маловероятно, что репортерные мРНК, лишенные UTR mtIF3, активно транспортируются в конус роста аксона. Делеция UTR действительно нарушала повышенную регуляцию вновь генерируемых сигналов mtIF3-Dendra2 при обработке BDNF, в то время как распределение белка mtIF3-Dendra2 без UTR было идентичным таковому из 5’UTR 9.0683 mtIF3 -mtIF3-Dendra2-3’UTR mtIF3 (рис. 1в, г; дополнительный файл 1: рис. S1б, в). Эти данные подтверждают, что обработка BDNF запускает локальный синтез белков mtIF3 в конусах роста аксонов через UTR mtIF3.

                  Рис. 1

                  BDNF индуцирует локальный синтез белка mtIF3 в конусе роста аксона. a мРНК mtIF3 были обнаружены как в телах клеток, так и в аксонах первичных нейронов гиппокампа в DIV4. Образцы РНК очищали из выделенных лизатов клеточных тел и аксонов. ОТ-ПЦР проводили с использованием каждой пары геноспецифических праймеров. β-актин, присутствующий в обоих лизатах, и γ-актин, обнаруженный в клеточных телах, указывают на то, что и клеточные тела, и аксоны были фракционированы без загрязнения [19].]. b Первичные нейроны гиппокампа высевали в камеру тела клетки. Аксоны достигали другой стороны устройства через микроканавку. Для локальной стимуляции аксонов лекарствами обрабатывали единственную аксональную камеру. c Кимограммы вновь синтезированных слитых белков mtIF3-Dendra2 в аксонах. Нейроны культивировали на микрожидкостных устройствах и трансфицировали вектором экспрессии белка mtIF3-Dendra2 в DIV3. Интенсивность флуоресценции слияния mtIF3-Dendra2 измеряли в митохондриальных областях на DIV4 (горизонтальная шкала, 5  мкм; вертикальная шкала, 5  мин). Красная стрелка указывает на изображения до фотоконверсии. Существующий mtIF3-Dendra2 был фотопреобразован с зеленого на красный на пути 20  мкм от кончика аксона. Зеленый сигнал представляет собой нефотоконвертированную флуоресценцию mtIF3-Dendra2, а красный сигнал представляет собой фотоконвертированную флуоресценцию. Был проанализирован восстановленный зеленый сигнал от существующих красных митохондрий. Затем были сделаны снимки с 5-минутными интервалами в течение 90 мин. BDNF (30 нг/мл) и анизомицин (20 мкМ) добавляли в аксональную камеру в момент времени 0 мин. d Количественное определение вновь синтезированных белков mtIF3-Dendra2. Зеленую флуоресценцию измеряли в митохондриях на самом конце кончика аксона. Относительную интенсивность рассчитывали путем нормализации значений в каждый момент времени к значению в 0-минутный момент времени. Данные представляют собой среднее значение ± стандартная ошибка среднего ( N = 3 повтора и n = 6–9 аксонов). * P < 0,05, ** P < 0,01, как определено двусторонним дисперсионным анализом повторных измерений с критерием множественных сравнений Холма-Сидака. Звездочкой отмечена статистическая значимость 5'UTR mtIF3 -mtIF3-Dendra2-3’UTR mtIF3 с обработкой BDNF для 5’UTR mtIF3 -mtIF3-Dendra2-3’UTR mtIF3 без обработки или с BDNF и анизомицином лечения. Статистической значимости среди групп mtIF3-Dendra2 без UTR не наблюдалось. e Псевдоцветные изображения локально синтезированного репортера Dendra2 в кончике аксона (масштабная линейка, 10  мкм). Эксперимент проводили так же, как на панели c. f Количественное определение вновь синтезированных репортеров Dendra2 в кончике аксона после лекарственного лечения. Данные представляют собой среднее значение ± стандартная ошибка среднего ( N = 3 повтора и n = 6–10 аксонов). * P < 0,05, ** P < 0,01, *** P < 0,001, **** P < 0,0001, как определено двухфакторным дисперсионным анализом повторных измерений с критерием множественных сравнений Холма-Сидака . Звездочка указывает на статистическую значимость 5'UTR mtIF3 -Dendra2-3’UTR mtIF3 с обработкой BDNF для 5’UTR mtIF3 -Dendra2-3’UTR mtIF3 без обработки или обработки BDNF и анизомицином. Между группами 5’UTR GAPDH — Dendra2-3’UTR GAPDH

                  Полноразмерное изображение

                  не наблюдалось статистической значимости. кодирующий флуоресцентный Dendra2 вместе с UTR из mtIF3 (5’UTR mtIF3 — Dendra2-3’UTR mtIF3 ) или GAPDH (5’UTR GAPDH — Dendra2-3’UTR GAPDH ). Сообщалось, что трансляция GAPDH не индуцируется BDNF в аксоне [23], тогда как N-концевая последовательность пальмитоилирования в репортерном белке служит для ограничения его свободной диффузии из тела клетки [5, 24]. Обработка BDNF в аксональной камере микрожидкостного устройства постепенно увеличивала флуоресценцию вновь синтезированного Dendra2 из репортера UTR mtIF3 на кончике аксона, тогда как обработка анизомицином подавляла ее (рис. 1д, е). Мы не обнаружили значительных изменений флуоресценции контрольного репортера GAPDH UTR после обработки BDNF. Примечательно, что мы наблюдали, что после обработки BDNF интенсивность сигнала Dendra2 без CDS mtIF3 увеличивается быстрее, чем у Dendra2 с CDS mtIF3. Возможно, что конъюгация mtIF3 CDS с Dendra2 может задерживать импорт белков в митохондриальный матрикс, укладку белков, накопление белков и созревание флуоресцентных белков. Таким образом, эти вышеупомянутые факторы могли в совокупности способствовать дифференциальной временной динамике сигнала Dendra2 между mtIF3-Dendra2 и Dendra2 при лечении BDNF. Вместе эти результаты предполагают, что белки mtIF3 локально синтезируются в конусах роста аксонов в ответ на BDNF. Кроме того, UTR mtIF3, вероятно, поддерживают аксональный транспорт мРНК mtIF3 и их BDNF-индуцированную трансляцию в дистальных аксонах.

                  Mito-riboBiFC обнаруживает зависимую от трансляции сборку миторибосом

                  Мы предположили, что локальная трансляция белков mtIF3, индуцированная BDNF, может участвовать в регуляции митохондриальной трансляции в развивающихся кончиках аксонов. Чтобы преодолеть возможные ограничения в биохимической оценке митохондриальной трансляции в дистальных аксонах, мы разработали новую стратегию визуализации митохондриальной трансляции в живых клетках с использованием BiFC [25], которая ранее использовалась для визуализации соединения цитоплазматических рибосомных субъединиц [26]. Это было основано на физической близости митохондриального рибосомного белка L2 (MRPL2) и митохондриального рибосомного белка S6 (MRPS6) на межсубъединичном мостике миторибосомы 55S [27] (рис. 2а). Мы воспользовались этой соседней локализацией двух MRP в виде пары BiFC, чтобы визуализировать сборку миторибосом во время трансляции. Подробно мы разделили флуоресцентный белок mVenus на N-концевой (VN, 1-172 аминокислоты) и C-концевой фрагменты (VC, 155-238 аминокислот). Затем мы объединили эти фрагменты mVenus с C-концами MRPS6 (S6-VN) и MRPL2 (L2-VC) соответственно. Короткие пептидные линкеры [26] были вставлены между фрагментами MRP и mVenus для повышения гибкости слитых белков MRP-mVenus (S6-VN, L2-VC), минимизации неспецифических взаимодействий и облегчения правильной сборки миторибосом. Совместная экспрессия S6-VN и L2-VC в клетках Neuro2A генерировала флуоресцентные сигналы mVenus исключительно в митохондриях (Fig. 2b). С другой стороны, другая пара MRP, расположенных далеко друг от друга в миторибосомах, демонстрировала относительно слабые флуоресцентные сигналы (Fig. 2a-c, MRPS16 и MRPL50). Маловероятно, что последняя пара проявляла слабые BiFC из-за их низкого уровня экспрессии (рис. 2d). Отсутствие сигналов мито-рибоBiFC в клетках, экспрессирующих только флуоресцентный митохондриальный маркер (т. е. мито-mTFP1), подтверждает отсутствие просачивания между двумя каналами визуализации (рис. 2б, в).

                  Рис. 2

                  Mito-riboBiFC выявляет трансляционно-зависимую сборку миторибосом. a Схематический дизайн мито-рибоBiFC. Митохондриальные рибосомные белки MRPL2 и MRPS6 были использованы в качестве пары BiFC для мито-рибоBiFC и проиллюстрированы крио-ЭМ структурой свиной миторибосомы 55S [28]. MRPS16 и MRPL50 служили в качестве отрицательного контроля. b Репрезентативные изображения мито-рибоBiFC (вверху) и окрашивания антител GFP, обнаруживаемых mVenus (внизу) в клетках Neuro2A. В качестве митохондриальных маркеров использовали Mito-mTFP1 и MT-CO1 (масштабная линейка, 2 мкм). c Количественная оценка флуоресцентных сигналов мито-рибоBiFC на панели b. Сигналы мито-рибоBiFC нормализовали к среднему значению флуоресцентных сигналов в группе S6-VN/L2-VC. Данные представляют собой среднее значение ± стандартная ошибка среднего ( N = 3 повтора и n = 100–143 клетки). **** P < 0,0001, как определено преобразованием выровненных рангов ANOVA с критерием суммы рангов Уилкоксона. d Количественная оценка интенсивности сигнала окрашивания антитела GFP в b . Сигналы GFP были нормализованы к среднему значению флуоресцентных сигналов в группе S6-VN. Данные представляют собой среднее ± SEM ( N = 3 повторности и n = 41–76 клеток). нс, не значимо; **** P < 0,0001, как определено преобразованием выровненных рангов ANOVA с критерием суммы рангов Уилкоксона. e Псевдоцветные изображения мито-рибоBiFC после последовательной обработки пуромицином (Puro) и хлорамфениколом (CA) (масштабная линейка, 2  мкм). f Количественная оценка сигналов мито-рибоBiFC в e . Линейный график показывает изменения интенсивности мито-рибоBiFC. Группу носитель-CA сравнивали с другими группами в каждый момент времени для статистического теста (левая панель). Точечный график отображает относительную интенсивность мито-рибоBiFC 90 мин после обработки ХА (1-й носитель, вода; 2-й носитель, этанол). Данные представляют собой среднее значение ± стандартная ошибка среднего ( N = 3 повтора и n = 22–26 клеток). Преобразование выровненных рангов ANOVA обнаружило значительные эффекты взаимодействия Puro и CA на интенсивность мито-рибоBiFC в 90-минутный момент времени ( P < 0,0001). ** P < 0,01, **** P < 0,0001, согласно критерию знакового ранга Уилкоксона (левая панель) или критерию суммы рангов Уилкоксона (правая панель)

                  Увеличить

                  В отличие от цитоплазматических рибосом, две субъединицы миторибосом могут быть собраны в отсутствие транслирующих мРНК [15]. Более того, сообщалось, что неспецифическая сборка фрагментов mVenus может привести к обнаружению BiFC [29]. Таким образом, мы спросили, действительно ли сигналы BiFC от пары S6-VN и L2-VC зависят от трансляции митохондриальных мРНК. При диссоциации транслирующих субъединиц рибосомы от мРНК пуромицином сигналы BiFC уменьшались только на 8% в течение 90-минутный период по сравнению с контролем автомобиля (рис. 2д, е). Это наблюдение может свидетельствовать о том, что 8% сигналов BiFC представляют зависимую от трансляции комплементацию белков S6-VN и L2-VC в митохондриях, хотя мы не можем исключить возможное влияние пуромицина на трансляцию белков S6-VN и L2-VC как таковых. .

                  Средняя скорость цитоплазматической трансляции составляет шесть аминокислот в секунду [30], а длина самого длинного транскрипта мРНК мт-ND5 составляет 1824  п.н. Напротив, сигналы флуоресценции от пары BiFC становятся детектируемыми через 10 мин после комплементации [31]. Учитывая, что трансляция отдельных митохондриальных мРНК может быть завершена менее чем за 2 мин, вполне вероятно, что транслирующая миторибосома диссоциирует от мРНК до созревания хромофора. Таким образом, мы пришли к выводу, что стабилизация трансляции миторибосом будет лучше визуализировать их мРНК-зависимую эмиссию комплементарных флуоресцентных сигналов. С этой целью мы использовали хлорамфеникол (ХА), который селективно останавливает миторибосомы, ингибируя образование пептидной связи в А-сайте [32, 33]. CA заметно увеличивала сигналы BiFC через 60 мин после обработки, тогда как предварительная обработка пуромицином блокировала эффекты CA (рис. 2д, е). Соответственно, мы пришли к выводу, что CA-индуцированные сигналы BiFC будут представлять активно транслирующие миторибосомы, и обозначили наш новый инструмент для визуализации митохондриальной трансляции как mito-riboBiFC (дополнительный файл 2).

                  Локально синтезированный mtIF3 способствует митохондриальной трансляции в конусе роста аксона

                  Чтобы проверить, способствует ли локально синтезированный mtIF3 митохондриальной трансляции в конусе роста аксона, мы манипулировали экспрессией mtIF3 с помощью временных трансфекций и исследовали их влияние на сигналы мито-рибоBiFC в конусах роста аксона. Сначала мы подтвердили истощение mtIF3 с помощью короткой шпилечной РНК (shRNA) в клетках NIH/3 T3 (дополнительный файл 3: рис. S3a, b). Затем мы культивировали нейроны гиппокампа на микрофлюидном устройстве для отделения аксонов от тел клеток [21] и обрабатывали всеми препаратами только в аксональном канале, чтобы индуцировать или блокировать локальную трансляцию (рис. 3а). Учитывая, что известно, что анизомицин ингибирует не только цитозольную трансляцию, но, возможно, и митохондриальную трансляцию [34], мы использовали циклогексимид (CHX) для ингибирования только цитозольной трансляции. Впоследствии степень митохондриальной трансляции была количественно оценена по вызванным CA изменениям интенсивности BiFC (дополнительный файл 2). Примечательно, что нейроны, экспрессирующие контрольную кшРНК, демонстрировали BDNF-индуцированные сигналы мито-рибоBiFC в конусе роста аксона. Однако обработка CHX в аксональном канале полностью блокировала увеличение сигналов мито-рибоBiFC при обработке BDNF, что указывает на то, что BDNF-индуцированный локальный синтез белка способствует митохондриальной трансляции. Важно отметить, что истощение mtIF3 устраняло BDNF-индуцированные сигналы мито-рибоBiFC (рис. 3б, в). Учитывая, что BDNF индуцирует трансляцию mtIF3 в дистальных аксонах, эти результаты вместе предполагают, что локальный синтез mtIF3 может быть необходим для облегчения митохондриальной трансляции при обработке BDNF, хотя истощение, опосредованное shRNA, может снижать уровни mtIF3 как в теле клетки, так и в аксоне.

                  Рис. 3

                  Локальный синтез белка mtIF3 необходим для митохондриальной трансляции в конусе роста аксонов. a Хронология экспериментов с мито-рибоBiFC. После посева клеток кшРНК и векторы сверхэкспрессии трансфицировали в DIV1. В DIV3 последовательно делались снимки до и после лечения лекарствами. BDNF, CHX и CA обрабатывали одновременно. Препараты в аксональной камере обрабатывали в течение 90 мин. b , c Визуализация митохондриальной трансляции в конусах роста аксонов, обедненных mtIF3, с помощью мито-рибоBiFC. Митохондрии были отмечены mTFP1, нацеленным на митохондрии. Трансфекцию кшРНК подтверждали экспрессией TagRFP657 (масштабная линейка, 10  мкм). Сигналы мито-рибоBiFC от окрашивания митохондрий мито-mTFP1 были количественно оценены, и была измерена относительная интенсивность увеличения BiFC при лечении лекарственным средством. Анализировали пять митохондрий на аксон. Данные представляют собой среднее ± SEM ( N = 3 повтора и n = 11–21 аксон). Преобразование выровненных рангов ANOVA обнаружило значительные эффекты взаимодействия истощения mtIF3 и BDNF на увеличение относительной интенсивности BiFC ( P = 0,0180). нс, не значимо; * P < 0,05, ** P < 0,01, как определено критерием суммы рангов Уилкоксона. d , e Репрезентативные изображения мито-рибоBiFC в конусах роста аксонов, экспрессирующих кшРНК и mtIF3 (SR) (масштабная линейка, 10  мкм). Сигналы Mito-riboBiFC от митохондриального окрашивания mito-mTFP1 анализировали до и после обработки CA. Анализировали пять митохондрий на аксон. Данные представляют собой среднее ± SEM ( N = 6 повторов и n = 24–54 аксона). Преобразование выровненных рангов ANOVA обнаружило значительные взаимодействия сверхэкспрессии mtIF3 (SR) и BDNF на мито-рибоBiFC в группах кшРНК mtIF3 (но не в контрольных группах кшРНК) ( P = 0,0123). нс, не значимо; ** P < 0,01, *** P < 0,001, **** P < 0,0001, как определено с помощью преобразования выровненных рангов ANOVA с критерием суммы рангов Уилкоксона

                  Полноразмерное изображение

                  Чтобы оценить, действительно ли локальная трансляция mtIF3 необходима для стимулирования митохондриальной трансляции при обработке BDNF, мы создали трансгены mtIF3, которые кодируют устойчивые к кшРНК (SR) CDS mtIF3 с UTR mtIF3 или без них (дополнительный файл 3: рис. S3c-e). . Векторы сверхэкспрессии mtIF3 также включали независимую экспрессионную кассету для флуоресцентного белка мито-mTFP1 для визуализации митохондрий в трансфицированных клетках для визуализации живых клеток (дополнительный файл 3: рис. S3f). Первичные нейроны гиппокампа котрансфицировали экспрессионными векторами для shRNA, mtIF3 (SR) и мито-рибоBiFC, и мы исследовали, может ли трансген mtIF3 восстанавливать фенотипы истощения mtIF3 при митохондриальной трансляции. Сверхэкспрессия mtIF3 (SR) в контрольных нейронах незначительно влияла на сигналы мито-рибоBiFC независимо от обработки BDNF (рис. 3г, д). Однако он специфически восстанавливал митохондриальную трансляцию, индуцированную BDNF, в нейронах, истощенных mtIF3. Для спасения требовались UTR mtIF3, поскольку сверхэкспрессия mtIF3 (SR) из трансгена, лишенного UTR mtIF3, не смогла восстановить фенотип истощения mtIF3, несмотря на высокие уровни сверхэкспрессии mtIF3 (рис. 3d, e; дополнительный файл 3: рис. S3e). Учитывая, что UTR mtIF3 опосредуют BDNF-индуцированную экспрессию репортера в дистальных аксонах (Fig. 1e, f), эти результаты дополнительно подтверждают, что локальная трансляция mtIF3 облегчает митохондриальную трансляцию при обработке BDNF в конусах роста аксонов.

                  mtIF3-зависимая митохондриальная трансляция повышает образование АТФ в растущих аксонах

                  Затем мы задались вопросом, будет ли локально транслируемый mtIF3 контролировать физиологию митохондрий в развивающихся аксонах. С этой целью мы использовали mito-ATeam1.03, генетически кодируемый датчик FRET (Fluorescence Resonance Energy Transfer) для митохондриального АТФ [35]. Обработка СА первичных нейронов гиппокампа, экспрессирующих mito-ATeam1.03, снижала интенсивность сигналов FRET, указывая на то, что для генерации митохондриального АТФ требуется митохондриальная трансляция (дополнительный файл 4). Затем мы культивировали первичные нейроны гиппокампа в микрожидкостном устройстве и оценивали локальные эффекты BDNF и ингибиторов трансляции на сигналы мито-ATeam1.03 в аксональном канале. Обработка BDNF повышала уровень митохондриального АТФ в конусе роста аксона, тогда как блокирование локальной трансляции с помощью CHX сводило на нет этот эффект BDNF (рис. 4а, б). Истощение mtIF3 также притупляло вызванное BDNF увеличение уровней митохондриального АТФ, но незначительно влияло на исходные уровни АТФ (рис. 4а, б). Чтобы определить, необходим ли локально синтезированный mtIF3 для образования митохондриальной АТФ, векторы mCherry, экспрессирующие mtIF3 (SR) (дополнительный файл 3: рис. S3g), котрансфицировали мито-ATeam1.03. Мы наблюдали спасительные эффекты сверхэкспрессии mtIF3 (SR) с UTR на уровни митохондриального АТФ в дистальных отделах аксонов при обработке BDNF (рис. 4c, d), что согласуется с эффектами локально синтезированного mtIF3 на митохондриальную трансляцию в конусе роста аксона (рис. 3d). , д). Эти результаты подтверждают нашу модель, что BDNF-индуцированный локальный синтез mtIF3 способствует митохондриальной трансляции и повышает выработку АТФ в аксональных митохондриях, тем самым удовлетворяя локальную потребность в энергии в развивающихся аксонах.

                  Рис. 4

                  mtIF3-зависимая митохондриальная трансляция повышает образование АТФ в конусе роста аксонов. a , b Уровни АТФ в истощенных по mtIF3 аксональных митохондриях измеряли с использованием генетически кодируемого индикатора АТФ mito-ATeam1.03. После посева клеток векторы shRNA и mito-ATeam1.03 трансфицировали в DIV1. В DIV3 последовательно делались снимки до и после лечения лекарствами. BDNF и CHX обрабатывали одновременно. Препараты в аксональную камеру лечили в течение 90 мин. Сигналы FRET были показаны на псевдоцветном изображении. Экспрессия кшРНК была подтверждена экспрессией TagRFP657 (масштабная линейка, 10  мкм). Сигналы FRET измеряли путем сравнения соотношения до и после химической обработки. Анализировали пять митохондрий на аксон. Данные представляют собой среднее значение ± стандартная ошибка среднего ( N = 4 повтора и n = 9–12 аксонов). нс, не значимо; * P < 0,05, ** P < 0,01, как определено двухфакторным ANOVA с критерием множественных сравнений Холма-Сидака. c , d Относительные уровни АТФ в аксональных митохондриях нейронов, экспрессирующих shRNA и mtIF3 (SR). После посева клеток векторы shRNA, гиперэкспрессии и мито-ATeam1.03 трансфицировали в DIV1. В DIV3 были последовательно получены изображения до и после обработки BDNF. BDNF в аксональной камере обрабатывали в течение 90 мин. Псевдоцвет показывает уровень АТФ в митохондриях. Экспрессия mCherry и TagRFP657 подтверждает экспрессию mtIF3 (SR) и кшРНК соответственно (масштабная линейка, 10  мкм). Увеличение относительных сигналов FRET рассчитывали путем сравнения до и после химической обработки. Анализировали пять митохондрий на аксон. Данные представляют собой среднее ± SEM ( N = 5 повторов и n = 17–34 аксона). Преобразование выровненных рангов ANOVA обнаружил значительные взаимодействия сверхэкспрессии mtIF3 (SR) и BDNF на сигналах FRET в группах кшРНК mtIF3 (но не в контрольных группах кшРНК) ( P < 0,0001). нс, не значимо; **** P < 0,0001, как определено с помощью преобразования выровненных рангов ANOVA с критерием суммы рангов Уилкоксона

                  Изображение в натуральную величину

                  Развитие аксонов требует mtIF3-зависимой митохондриальной трансляции в растущих аксонах

                  Чтобы определить, действительно ли локальная митохондриальная трансляция влияет на рост аксонов, мы применили СА либо к клеточным телам, либо к аксонам первичных нейронов гиппокампа, культивируемых в микрожидкостном устройстве (рис. 5а). Затем в аксональную камеру добавляли BDNF и соответственно количественно оценивали индуцированный BDNF рост аксонов. Мы обнаружили, что селективное ингибирование митохондриальной трансляции в аксонах, но не в телах клеток, подавляет BDNF-индуцированные удлинения аксонов (рис. 5б, в). Эти данные демонстрируют, что быстрое удлинение аксона этим трофическим фактором требует локальной митохондриальной трансляции в аксонах. Учитывая, что локально синтезируемый mtIF3 регулирует митохондриальную трансляцию в аксонах, мы пришли к выводу, что истощение mtIF3 будет нарушать удлинение аксонов. Действительно, транзиентная экспрессия mtIF3 shRNA заметно укорачивает длину аксона по сравнению с контрольной shRNA и дополнительно подавляет эффекты BDNF на развитие аксона (Fig. 5d, e). Сверхэкспрессия mtIF3 частично восстанавливала длину аксона в истощенных по mtIF3 нейронах в отсутствие обработки BDNF, а UTR mtIF3 были необязательны для эффектов сверхэкспрессии. Однако мы обнаружили, что BDNF-индуцированный рост аксонов требует экспрессии mtIF3 через UTR mtIF3 (рис. 5d, e). Эти результаты предполагают, что mtIF3 функционирует как в теле клетки, так и в аксоне для развития аксонов, но локально синтезированный mtIF3 играет более критическую роль в BDNF-индуцированном росте аксонов, вероятно, посредством mtIF3-зависимой митохондриальной трансляции и генерации АТФ в дистальных аксонах.

                  Рис. 5

                  Для развития аксонов требуется mtIF3-зависимая митохондриальная трансляция в растущих аксонах. a Хронология эксперимента. Первичные нейроны гиппокампа культивировали на микрожидкостном устройстве. В DIV4 хлорамфеникол (СА) добавляли либо к телу клетки, либо к камере аксона. Через 30 мин в аксональную камеру добавляли BDNF. Нейроны окрашивали и визуализировали в DIV5. b Репрезентативные изображения аксонов. Аксоны были отмечены иммуноокрашиванием Тау-1 (масштабная линейка, 200 мкм). c Длину аксонов измеряли от выходной границы микроборозд (пунктирные линии), включая основные аксоны и ответвления. Данные представляют собой среднее значение ± стандартная ошибка среднего ( N = 4–5 повторов и n = 422–745 аксонов). нс, не значимо; **** P < 0,0001, как определено с помощью ANOVA преобразования выровненных рангов с критерием суммы рангов Уилкоксона. d Репрезентативные изображения первичных нейронов гиппокампа, экспрессирующих кшРНК и mtIF3 (SR). Нейроны гиппокампа котрансфицировали кшРНК и векторами сверхэкспрессии, а затем обрабатывали BDNF в DIV1. Длину аксона измеряли в DIV3 (масштабная линейка, 100 мкм). Сигналы TagRFP657 и мито-mTFP1 подтверждают котрансфекцию кшРНК и векторов сверхэкспрессии. Белая стрелка указывает на начальную точку аксона, а синяя стрелка указывает на конечную точку аксона. e Длина аксона была рассчитана путем измерения сигналов TagRFP657. Данные представляют собой среднее значение ± стандартная ошибка среднего ( N = 5 повторов и n = 50 нейронов). Преобразование выровненных рангов ANOVA выявило значительное взаимодействие сверхэкспрессии mtIF3 (SR) и BDNF на длину аксона в группах mtIF3 shRNA (но не в контрольных группах shRNA) ( P = 0,0002). нс, не значимо; * P < 0,05, **** P < 0,0001, согласно критерию суммы рангов Уилкоксона

                  Изображение в натуральную величину

                  Обсуждение

                  Локальный синтез белка является отличительной чертой высокополяризованных нейронов и необходим для структурного и функционального поддержания аксонов и дендритов, таких как развитие нейритов, управление конусом роста, синаптическая передача, синаптическая пластичность, формирование ветвей и регенерация [36,37,38,39]. Анализ генной онтологии выявил высокое обогащение синаптических белков, цитоскелетных белков и рибосомных белков в аксональном транслатоме [11, 40]. Интересно, что также было установлено, что транскрипты кодируемых ядром митохондриальных белков в изобилии присутствуют в развивающихся и зрелых аксонах [10,11,12,13,14], что указывает на их локальную трансляцию в поддержании митохондриальной функции и жизнеспособности аксонов. Тем не менее, только несколько исследований документально подтвердили, что локальная трансляция митохондриальных белков, кодируемых ядром, может влиять на функцию митохондрий и выживание аксонов [41,42,43,44].

                  Здесь мы демонстрируем, что кодируемый ядром mtIF3 локально транслируется в развивающихся аксонах, тем самым способствуя аксональной митохондриальной трансляции, согласно оценке нашего недавно разработанного датчика мито-рибоBiFC. Многие исследования показали, что стационарные митохондрии в аксонах питают пространственно ограниченные границы [1, 2], но остается нерешенным вопрос о том, как эти стационарные митохондрии поддерживаются и поддерживаются в долгосрочной перспективе. Наши результаты показывают, что митохондриальные белки могут пополняться за счет усиленной митохондриальной трансляции посредством локального синтеза белка в аксонах. Мы наблюдали, что истощение mtIF3 отменяет активацию митохондриальной трансляции и продукции АТФ при стимуляции BDNF. Отсутствие этой локальной трансляции и адаптивного контроля митохондриальной функции ограничивает развитие аксонов, подтверждая их критическую роль в физиологии нейронов. Однако мы также заметили, что сверхэкспрессия mtIF3 сама по себе не влияла на функции митохондрий. Недавно было показано, что митохондриальная трансляция синхронизируется и однонаправленно контролируется цитозольной трансляцией [45]. Наше наблюдение неизменно указывает на то, что усиление митохондриальных функций для удовлетворения локальных потребностей в энергии достигается путем взаимодействия с цитозольной трансляцией. Таким образом, наши результаты показывают, что локальная трансляция в аксонах может быть важным механизмом, с помощью которого митохондриальная трансляция регулируется в нейронах млекопитающих.

                  В последнее десятилетие было предпринято много усилий для разработки инструментов для измерения или наблюдения за митохондриальной трансляцией. Например, биохимическое обнаружение вновь синтезированных митохондриальных белков широко используется для изучения митохондриальной трансляции [46,47,48,49,50]. Однако отсутствие соответствующих инструментов визуализации для митохондриальной трансляции препятствует оценке этого субклеточного события на уровне отдельных клеток. Недавнее исследование визуализировало митохондриальную трансляцию с использованием неканонической маркировки аминокислот in situ [51]. Этот метод позволяет обнаруживать митохондриальную трансляцию с разрешением одной клетки, но его применение ограничено фиксированными клетками. В нашем исследовании был разработан новый метод, обозначенный как mito-riboBiFC, для мониторинга митохондриальной трансляции в живых клетках. Mito-riboBiFC позволяет нам исследовать митохондриальную трансляцию в различных пространственно-временных масштабах. Соответственно, будет представлять большой интерес определить, как митохондриальная трансляция регулируется в зависимости от их внутриклеточного расположения или митохондриальной динамики, особенно в нейронах, где субклеточная среда и энергетические потребности пространственно различны.

                  Тем не менее, у мито-рибоБиФЦ есть некоторые ограничения, которые следует исправить в будущем. К ним относится относительно медленная кинетика созревания мито-рибоBiFC. Митохондрии очень динамичны и гетерогенны с точки зрения их транспорта, мембранного потенциала и биогенеза. Эти митохондриальные события могут происходить в относительно короткие промежутки времени (например, несколько секунд или минут) по сравнению со временем фолдинга и созревания комплекса BiFC [52]. Использование нового хромофора в визуализации BiFC должно улучшить текущее временное разрешение нашего мито-рибоBiFC, лучше визуализируя быстрое изменение митохондриальной трансляции в соответствии с разнообразной митохондриальной динамикой.

                  Выводы

                  Наши результаты позволяют по-новому взглянуть на понимание адаптивной регуляции митохондриальной физиологии посредством локального синтеза белка митохондриального трансляционного фактора, кодируемого ядром, во время развития аксонов. Новые инструменты визуализации митохондриальной функции должны дополнительно анализировать молекулярные механизмы, лежащие в основе пространственно-временного контроля митохондриальной физиологии, и указывать на новые терапевтические стратегии для лечения соответствующих заболеваний нервной системы.

                  Методы

                  Животные

                  Эмбрионы беременных мышей (C57BL/6 J, Hyochang Science, Корея) использовали для первичной культуры нейронов гиппокампа. Все экспериментальные процедуры проводились в соответствии с протоколами, одобренными Институциональным комитетом по уходу за животными и их использованию Ульсанского национального института науки и технологий (UNIST).

                  Культура клеток

                  Первичные нейроны гиппокампа

                  Культуру первичных нейронов гиппокампа обрабатывали следующим образом. Вкратце, из эмбрионов мышей E18 вырезали гиппокампы и промывали HBSS (Invitrogen). Гиппокампы расщепляли 0,025% трипсином (Invitrogen) и промывали средой для растирания (90% среды Игла, модифицированной Дульбекко, и 10% эмбриональной бычьей сыворотки, Invitrogen). Диссоциированные клетки высевали на культуральные чашки или покровные стекла, покрытые 50 мкг/мл поли-D-лизина (Sigma). После заселения клеток нейроны поддерживали в среде для культивирования нейронов, которая состоит из среды Neurobasal, GlutaMax, B27 и пенициллин-стрептомицина (Invitrogen). Нейроны трансфицировали липофектамином 2000 (Invitrogen).

                  Клеточные линии

                  Клеточная линия Neuro2A использовалась для экспериментов с мито-рибоBiFC и была приобретена в ATCC. Клетки Neuro2A поддерживали в культуральной среде, которая состоит из среды Игла, модифицированной Дульбекко, 10% эмбриональной телячьей сыворотки и 1% пенициллин-стрептомицина (Invitrogen). Используя набор для обнаружения микоплазмы (Takara, 6601), мы подтвердили отсутствие контаминации в клеточной линии Neuro2A. PEI (Полинауки, 23966-1) или липофектамин 2000 (Invitrogen) использовали для трансфекции конструкций в клетки Neuro2A. Клеточная линия NIH/3 T3 была приобретена у ATCC и использована для модуляции экспрессии mtIF3. Клетки поддерживали в культуральной среде, которая состоит из среды Игла, модифицированной Дульбекко, 10% телячьей сыворотки и 1% пенициллин-стрептомицина (Invitrogen). Для трансфекции конструкций mtIF3 использовали Metafectene (Biontex).

                  Разделение клеточных тел и аксонов

                  Чтобы выделить лизат клеточных тел и аксонов отдельно, нейроны высевали на 6-луночные вставки с размером пор 3 мкм (SPL Life Sciences). Образцы клеточных тел и аксонов собирали путем соскоба с верхней и нижней сторон вкладышей. Для обработки клеточных тел или аксонов лекарствами по отдельности нейроны помещали на микрофлюидные устройства (Xona Microfluidics). Микрожидкостные устройства прикрепляли к чашке со стеклянным дном (In Vitro Scientific, D60-30-1.5) для визуализации живых клеток или к квадратным покровным стеклам размером 22 мм (Globe Scientific, 1404-15) для фиксированных образцов. Мы знали, что на аксоны, связанные с другими аксонами, могут влиять межклеточные взаимодействия. К сожалению, мы не могли исключить этот потенциальный эффект от других аксонов, потому что наши эксперименты с использованием микрофлюидных устройств требовали высокой плотности клеток, и технически было сложно найти аксоны, которые не касались бы других аксонов в микрофлюидных устройствах. Однако, несмотря на этот факт, все контрольные группы на протяжении экспериментов (с использованием микрожидкостных устройств) подвергались воздействию одной и той же среды, в которой аксоны соприкасались с другими аксонами. Таким образом, мы думаем, что этот потенциальный эффект взаимодействия аксонов с аксонами не ослабит наш вывод. Для медикаментозного лечения использовали 30 нанограммов на миллилитр BDNF (Sigma), 50 мкг/мл хлорамфеникола (Sigma), 20 мкМ анизомицина (Sigma) и 100 мкг/мл циклогексимида (Sigma).

                  Препарат вектора

                  Для анализа локального синтеза белка вектор pDendra2-C (Evrogen) был модифицирован: 5’UTR mtIF3-2xPal-Dendra2-3’UTR mtIF3 , 5’UTR mtIF3-CDS mtIF3-2xPal-Dendra2-3’UTR mtIF3 , CDS mtIF3-3xPal-Dendra2 и 5’UTR GAPDH-2xPal-Dendra2-3’UTR GAPDH . Чтобы заблокировать эффект диффузии, были добавлены два повтора последовательности пальмитоилирования. Для анализа мито-рибоBiFC, pcDNA6/V5-HisA 9Плазмида 0632 (Invitrogen) была модифицирована: последовательность кДНК Neuro2A мыши Mrps6 (NM_080456.1), Mrpl2 (NM_025302.4), Mrps16 (NM_025440.3) и Mrps16 (NM_025440.3) и NMRpl20 906.38 (NM_025440. 3) используется для создания конструкций MRPS6-VN172 , MRPL2-VC155 , MRPS16-VN172 и MRPL50-VC155 . VC был слит с MRPL2 и MRPL50 с помощью линкерных пептидов: GSKQKVMNH. MRPS6 и MRPS16 были слиты с VN с помощью линкерных пептидов: GSRSIAT. Для снижения экспрессии mtIF3 AAV-shRNA-ctrl (Addgene, #85741) был модифицирован: pAAV2-Control-shRNA-TagRFP657 , pAAV2-mtIF3-shRNA-TagRFP657 . Для устойчивого к кшРНК mtIF3 мутагенез сайта-мишени кшРНК на mtIF3 выполняли с помощью ПЦР с удлинением с перекрытием. pcDNA6/V5-HisA и psi-Check2 плазмиды были модифицированы: pcDNA6-5’UTR mtIF3-CDS (SR) mtIF3-3xFLAG-3’UTR mtIF3 , psi-Check2-SV40 промотор -3xFlag-CMV промотор-мито-mTFP1 , psi-Check2-SV40 промотор-5’UTR mtIF3-CDS (SR) mtIF3-3xFLAG-3’UTR mtIF3-CMV промотор-мито-mTFP1 , промотор psi-Check2-SV40-CDS (SR) mtIF3-3xFLAG-CMV промотор-мито-mTFP1 , промотор psi-Check2-SV40-3xFlag-HSV-TK промотор-mCherry , Промотор SV40-5’UTR mtIF3-CDS (SR) mtIF3-3xFLAG-3’UTR mtIF3-HSV-TK промотор-mCherry и psi-Check2-SV40 промотор-CDS (SR) mtIF3-3xFLAG- Промотор HSV-TK-mCherry.

                  Конфокальная микроскопия и анализ изображений

                  Все изображения были получены с использованием конфокального микроскопа (Zeiss LSM 780). Визуализацию живых клеток проводили в камере для живых клеток, в которой поддерживалась температура 37 °C и 5% CO 9 .0683 2 нагревательным прибором. Оборудование для коррекции Definite Focus z использовалось для сохранения оси z во время покадровой съемки. Ортогональная проекция и кадрирование изображения были обработаны в ZEN 3.1 (синяя версия). Интенсивность сигнала флуоресценции количественно определяли с помощью ImageJ (NIH).

                  Анализ локального синтеза белка

                  Для анализа локальной трансляции мРНК флуоресцентный белок Dendra2 конъюгировали с UTR mtIF3 или GAPDH: 5’UTR mtIF3-последовательность пальмитоилирования-Dendra2-3’UTR mtIF3, 5’UTR mtIF3-CDS mtIF3-последовательность пальмитоилирования-Dendra2-3’UTR mtIF3, CDS mtIF3-последовательность пальмитоилирования-Dendra2 и 5’UTR GAPDH-последовательность пальмитоилирования-Dendra2-3’UTR GAPDH. Первичные нейроны гиппокампа культивировали на микрожидкостных устройствах и трансфицировали этими векторами в DIV3 с использованием липофектамина 2000 (Invitrogen). Через двадцать четыре часа после трансфекции проводили анализ синтеза белка. Существующая флуоресценция dendra2 (зеленый) в кончике аксона была фотопреобразована в красную флуоресценцию с помощью лазера с длиной волны 405 нм в течение 10 с, а вновь синтезированные зеленые сигналы измерялись в течение 90 мин с 5 минутным интервальным изображением. Ингибитор синтеза белка анизомицин (20 мкМ, Sigma) использовали для подтверждения того, что повышенный зеленый сигнал был вызван синтезом белка de novo. BDNF (30 нг/мл, Sigma) и анизомицин обрабатывали в аксональной камере микрожидкостных устройств, чтобы локально индуцировать или блокировать синтез белка. Изображения были получены с использованием лазеров с длиной волны 488, 561 нм.

                  Визуализация живых клеток

                  Перед визуализацией мито-рибоBiFC в клетках Neuro2A культуральную среду заменяли и клетки инкубировали в течение 30 мин. Двадцать микрометров пуромицина (Sigma) наносили на 10 минут. После обработки пуромицином последовательно обрабатывали 50 мкг/мл хлорамфеникола (Sigma). Для мечения митохондрий также трансфицировали мито-mTFP1. Изображения были получены с использованием лазеров 458, 514 нм. Для исключения и предотвращения эффекта FRET мы отдельно включали и выключали два лазера (458 нм, 514 нм) на двух разных дорожках. То есть, когда мы обнаружили мито-рибоBiFC, был включен только 514-нм лазер, а mTFP1 почти не возбуждался в этой установке визуализации. Таким образом, наша процедура визуализации может подавлять как просачивание, так и эффект FRET от сигналов mTFP1. Для визуализации АТФ первичные нейроны гиппокампа культивировали в микрожидкостных устройствах, которые прикрепляли к чашкам со стеклянным дном. Нейроны трансфицировали векторами кшРНК и векторами со сверхэкспрессией в DIV1. В DIV3 изображения были получены с использованием лазеров с длиной волны 458, 514 и 633 нм. CHX, BDNF и CA лечили одновременно, и изображения были сделаны до лечения лекарствами и через 90 мин. Интенсивность флуоресценции измеряли в пяти митохондриях на концах аксонов. Соотношение до и после медикаментозного лечения усредняли для измерения степени митохондриальной трансляции. Для визуализации митохондриальной АТФ первичные нейроны гиппокампа трансфицировали генетически кодируемым индикатором АТФ на основе FRET для митохондрий, мито-ATeam1.03, в DIV1 с кшРНК и сверхэкспрессирующими векторами с использованием липофектамина 2000 (Invitrogen). Изображения были получены при излучении 475 нм и 527 нм с помощью возбуждающего лазера 405 нм. BDNF или циклогексимид наносили на аксональную камеру в течение 90 мин. Рассчитывали повышенное отношение FRET к CFP до и после медикаментозного лечения.

                  Вестерн-блоттинг

                  Клетки лизировали с использованием буфера RIPA (150 мМ хлорида натрия, 1% Triton X-100, 0,5% дезоксихолата натрия и 0,1% додецилсульфата натрия). Белки разделяли с помощью SDS-PAGE и переносили на мембрану PVDF (Millipore) или мембрану NC (GE Healthcare). Мембраны блокировали 5% обезжиренным молоком в TBST (10 мМ Трис, 150 мМ NaCl, 0,5 % Твин 20) в течение 30–60 мин. Для иммуноблоттинга антитела против mtIF3 (Sigma, HPA039791, поликлональный или ORIGENE, TA800421, моноклональный) и β-тубулин (Abcam, ab6046, поликлональный или Proteintech, 66240-1-lg, моноклональный) инкубировали при 4 °C в течение ночи. Мембраны промывали три раза по 10 минут TBST и инкубировали вторичные антитела против кроличьего или мышиного IgG, конъюгированные с пероксидазой хрена (иммунологическое исследование Джексона), в течение 1 часа. Мембраны промывали три раза по 10 мин TBST и проявляли раствором ECL (Bio-Rad). Для mtIF3, устойчивого к кшРНК, клетки дважды промывали и собирали охлажденным льдом PBS. Клетки собирали центрифугированием при 2500g в течение 5 минут при 4 °C. Затем клетки лизировали буфером RIPA (50 мМ Tris-Cl pH 8,0, 150 мМ NaCl, 5 мМ ЭДТА, 10 % NP-40, 0,5 % дезоксихолата натрия и 1 мМ PMSF). Целый клеточный лизат использовали для вестерн-блоттинга. Изображения полных вестерн-блотов можно найти в дополнительном файле 5.

                  RT-PCR

                  Тотальную РНК тела клетки и фракции аксонов выделяли с помощью набора для выделения РНК PicoPure (Applied Biosystems). Двести нанограммов РНК подвергали ОТ-ПЦР с использованием набора High Capacity RNA-to-cDNA (Life Technologies). Необработанные изображения геля были показаны в дополнительном файле 6. Праймеры, использованные для ПЦР:

                  прямой 5′-GAGAGCAGATCCACCAGGAG-3′ и

                  обратный 5′-CTGTTTCCGTCGTCGTCTTT-3′ для mtIF3;

                  вперед 5′-ACCAACTGGGACGACATGGAGAAGA-3′ и

                  обратный 5′-CGTTGCCAATAGTGATGACCTGGCC-3′ для β-актина;

                  прямой 5′-GGACGACATGGAGAAGATCTGGCAC-3′ и

                  обратный 5′-CCGGACACCGGAACCGCTCATTG-3′ для γ-актина.

                  Иммуноокрашивание

                  Для первичных нейронов гиппокампа клетки промывали PBS и фиксировали 4% PFA в течение 10 мин. Клетки пермеабилизировали с помощью PBST (PBS с 0,2% Triton X-100) в течение 10 минут и блокировали 1% BSA в PBST в течение 30 минут. Первичные антитела инкубировали при 4 °C в течение ночи. Для иммунного окрашивания использовали антитело против Tau1 (Millipore, MAB3420, моноклональное). Клетки трижды промывали PBS и инкубировали со вторичными антителами Alexa Fluor (Invitrogen). Затем эти клетки трижды промывали PBS и покровные стекла помещали на предметные стекла. Изображения были получены с использованием конфокальной микроскопии LSM780. Для Neuro2A клетки промывали ледяным PBS с последующей фиксацией с использованием 4% PFA/сахарозы в течение 20 мин. После 3-кратной промывки PBS клетки пермеабилизировали PBST (PBS с 0,5% Triton X-100) в течение 15 мин и блокировали 1% BSA в PBS в течение 1 ч. Первичные антитела инкубировали при 4 °C в течение ночи. Клетки промывали 3 раза PBS и инкубировали со вторичными антителами Alexa Fluor (Invitrogen) в течение 1 ч при комнатной температуре. Клетки трижды промывали PBS и покровные стекла помещали на предметные стекла. Для иммуноокрашивания использовали антитела против GFP (Abcam, ab6556, поликлональные), MT-CO1 (Abcam, ab14705, моноклональные) и Flag (Sigma, F1804, моноклональные). Изображения были получены с использованием 405, 458, 488, 561, 594 и 633 нм лазеры.

                  Статистический анализ

                  Статистический анализ проводили с использованием программного обеспечения Prism (GraphPad Software) или R (версия 3. 6.1) с библиотекой ARTool [53, 54]. Все значения были представлены со средним значением ± SEM. Тест Шапиро-Уилка на нормальность ( P < 0,05) или F -критерий и тест Брауна-Форсайта на равную дисперсию ( P < 0,05) выполняли для каждого набора данных. Двусторонний дисперсионный анализ с критерием Холма-Сидака (повторные измерения), дисперсионный анализ выровненных рангов с критерием знакового ранга Уилкоксона (повторные измерения) или сумма рангов Уилкоксона (неповторяющиеся измерения) использовались для определения статистических различий между группами. P < 0,05 считалось статистически значимым. * P < 0,05, ** P < 0,01, *** P < 0,001, **** P < 0,0001. Весь статистический анализ можно найти в дополнительном файле 7.

                  Доступность данных и материалов

                  Все данные, полученные или проанализированные в ходе этого исследования, включены в эту опубликованную статью и ее дополнительные информационные файлы.

                  Сокращения

                  mtIF3:

                  Митохондриальный фактор инициации 3

                  БДНФ:

                  Нейротрофический фактор головного мозга

                  Миторибосомы:

                  Митохондриальные рибосомы

                  БиФК:

                  Бимолекулярная флуоресцентная комплементация

                  UTR:

                  Непереведенные регионы

                  CDS:

                  Кодовая последовательность

                  MRPL2:

                  Митохондриальный рибосомный белок L2

                  MRPS6:

                  Митохондриальный рибосомный белок S6

                  СА:

                  Хлорамфеникол

                  кШРНК:

                  Короткая шпилька РНК

                  СР:

                  кшРНК-устойчивый

                  CHX:

                  Циклогексимид

                  ВН:

                  мВенеры в N-терминал

                  ВК:

                  мВенеры в С-терминал

                  ЛАД:

                  Флуоресцентный резонансный перенос энергии

                  Ссылки

                  1. Spillane M, Ketschek A, Merianda TT, Twiss JL, Gallo G. Митохондрии координируют участки ветвления аксона посредством локализованного внутриаксонального синтеза белка. Cell Rep. 2013;5(6):1564–75. https://doi.org/10.1016/j.celrep.2013.11.022.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  2. Ваарманн А., Мандель М., Зеб А., Варески П., Лив Дж., Куум М. и др. Митохондриальный биогенез необходим для роста аксонов. Разработка. 2016; 143(11):1981–92. https://doi.org/10.1242/dev.128926.

                    КАС Статья пабмед Google ученый

                  3. Lee S, Wang W, Hwang J, Namgung U, Min KT. Увеличение связывания ER-митохондрий способствует регенерации аксонов. Proc Natl Acad Sci U S A. 2019;116(32):16074–9. https://doi.org/10.1073/pnas.1818830116.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  4. Чжоу Б., Ю П., Линь М.Ю., Сунь Т., Чен Ю., Шэн Ч.Х. Содействие регенерации аксонов за счет усиления митохондриального транспорта и восстановления дефицита энергии. Джей Селл Биол. 2016;214(1):103–19. https://doi.org/10.1083/jcb.201605101.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  5. Сакстон В.М., Холленбек П.Дж. Аксональный транспорт митохондрий. Дж. Клеточные науки. 2012; 125 (часть 9): 2095–104. https://doi.org/10.1242/jcs.053850.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  6. Niescier RF, Kwak SK, Joo SH, Chang KT, Min KT. Динамика митохондриального транспорта в аксонах. Неврологи передней клетки. 2016;10:123. https://doi.org/10.3389/fncel.2016.00123.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  7. Ашрафи А. , Кар А.Н., Гейл Дж.Р., Элькалун А.Г., Варгас Дж.Н., Сейлз Н. и др. Гетерогенная популяция митохондриальных мРНК, кодируемых ядром, присутствует в аксонах первичных симпатических нейронов. Митохондрия. 2016;30:18–23. https://doi.org/10.1016/j.mito.2016.06.002.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  8. Shigeoka T, Jung H, Jung J, Turner-Bridger B, Ohk J, Lin JQ и др. Динамическая аксональная трансляция в развивающихся и зрелых зрительных цепях. Клетка. 2016; 166(1):181–9.2. https://doi.org/10.1016/j.cell.2016.05.029.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  9. Кузневская Б., Цышевский Д., Василевский М., Саковска П., Милек Дж., Кулински Т.М. и др. Биогенез митохондриального белка в синапсе поддерживается локальной трансляцией. Представитель EMBO 2020: e48882.

                  10. Гейл Младший, Ашрафи А., Джойо А.Е., Каплан Б.Б. Митохондриальные мРНК, кодируемые ядром: мощная сила роста и развития аксонов. Нейробиолог. 2018;24(2):142–55. https://doi.org/10.1177/1073858417714225.

                    КАС Статья пабмед Google ученый

                  11. Смитс П., Смейтинк Дж., ван ден Хеувел Л. Митохондриальная трансляция и не только: процессы, связанные с дефицитом комбинированного окислительного фосфорилирования. Дж. Биомед Биотехнолог. 2010; 2010:737385–24. https://doi.org/10.1155/2010/737385.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  12. Кристиан Б.Э., Спремулли Л.Л. Доказательства активной роли IF3mt в инициации трансляции в митохондриях млекопитающих. Биохимия. 2009;48(15):3269–78. https://doi.org/10.1021/bi8023493.

                    КАС Статья пабмед Google ученый

                  13. Рудлер Д.Л., Хьюз Л.А., Перкс К.Л., Ричман Т.Р., Кузнецова И., Эрмер Дж.А., и соавт. Точность инициации трансляции необходима для скоординированной сборки дыхательного комплекса. Научные достижения. 2019;5(12):eaay2118.

                    КАС Статья Google ученый

                  14. Koc EC, Spremulli LL. Идентификация митохондриального фактора инициации трансляции млекопитающих 3 и изучение его роли в образовании комплекса инициации с природными мРНК. Дж. Биохим. 2002;277(38):35541–9. https://doi.org/10.1074/jbc.M202498200.

                    КАС Статья Google ученый

                  15. Тейлор А.М., Блертон-Джонс М., Ри С.В., Криббс Д.Х., Котман К.В., Чон Н.Л. Платформа микрофлюидной культуры для повреждения, регенерации и транспорта аксонов ЦНС. Нат Методы. 2005;2(8):599–605. https://doi.org/10.1038/nmeth777.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  16. McEWEN BS, Grafstein B. Быстрые и медленные компоненты аксонального транспорта белка. Джей Селл Биол. 1968; 38 (3): 494–508. https://doi.org/10.1083/jcb.38.3.494.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  17. Видаки М., Дрис Ф., Саксена Т., Ланслотс Э., Талиаферро М.Дж., Татаракис А. и др. Потребность в Mena, регуляторе актина, в локальной трансляции мРНК в развивающихся нейронах. Нейрон. 2017;95(3):608–22 e5. https://doi.org/10.1016/j.neuron.2017.06.048.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  18. Wang W, Rai A, Hur EM, Smilansky Z, Chang KT, Min KT. DSCR1 необходим как для удлинения конуса роста аксонов, так и для управления ими. Джей Селл Биол. 2016;213(4):451–62. https://doi.org/10.1083/jcb.201510107.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  19. Ху С-Д, Чиненов Ю, Керппола Т.К. Визуализация взаимодействий между белками семейства bZIP и Rel в живых клетках с использованием бимолекулярной флуоресцентной комплементации. Молекулярная клетка. 2002;9(4):789–98. https://doi.org/10.1016/S1097-2765(02)00496-3.

                    КАС Статья пабмед Google ученый

                  20. Al-Jubran K, Wen J, Abdullahi A, Roy Chaudhury S, Li M, Ramanathan P, et al. Визуализация соединения рибосомных субъединиц выявляет наличие в ядре 80S рибосом. РНК. 2013;19(12): 1669–83. https://doi.org/10.1261/rna.038356.113.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  21. Амунтс А. , Браун А., Тутс Дж., Шерес Ш.В., Рамакришнан В. Структура митохондриальной рибосомы человека. Наука. 2015;348(6230):95–8. https://doi.org/10.1126/science.aaa1193.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  22. Greber BJ, Bieri P, Leibundgut M, Leitner A, Aebersold R, Boehringer D, et al. Полная структура митохондриальной рибосомы 55S млекопитающих. Наука. 2015;348(6232):303–8. https://doi.org/10.1126/science.aaa3872.

                    КАС Статья пабмед Google ученый

                  23. Кодама Й, Ху К-Д. Бимолекулярная флуоресцентная комплементация (BiFC): 5-летнее обновление и перспективы на будущее. БиоТехники. 2012;53(5):285–98. https://doi.org/10.2144/000113943.

                    КАС Статья пабмед Google ученый

                  24. Инголия NT, Ларо Л.Ф., Вайсман Дж. С. Рибосомное профилирование эмбриональных стволовых клеток мыши раскрывает сложность и динамику протеомов млекопитающих. Клетка. 2011;147(4):789–802. https://doi.org/10.1016/j.cell.2011.10.002.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  25. Робида А.М., Керппола Т.К. Бимолекулярный флуоресцентный комплементарный анализ индуцируемых белковых взаимодействий: влияние факторов, влияющих на укладку белка, на ассоциацию фрагментов флуоресцентного белка. Дж Мол Биол. 2009;394(3):391–409. https://doi.org/10.1016/j.jmb.2009.08.069.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  26. Балкли Д., Иннис К.А., Блаха Г., Стейц Т.А. Пересмотр структур нескольких антибиотиков, связанных с бактериальной рибосомой. Proc Natl Acad Sci U S A. 2010;107(40):17158–63. https://doi.org/10.1073/pnas.1008685107.

                    Артикул пабмед ПабМед Центральный Google ученый

                  27. Лю Г., Мерсер Тимоти Р., Ширвуд А.-Мари Дж., Сиира Стефан Дж., Хиббс Мойра Э., Мэттик Джон С. и др. Картирование митохондриальных РНК-белковых взаимодействий с помощью цифрового следа РНКазы. Сотовые отчеты. 2013;5(3):839–48. https://doi.org/10.1016/j.celrep.2013.09.036.

                    КАС Статья пабмед Google ученый

                  28. McLaughlin JE, Bin-Umer MA, Tortora A, Mendez N, McCormick S, Tumer NE. Полногеномный скрининг Saccharomyces cerevisiae выявил критическую роль митохондрий в токсичности трихотеценового микотоксина. Proc Natl Acad Sci U S A. 2009;106(51):21883–8. https://doi.org/10.1073/pnas.07106.

                    Артикул пабмед ПабМед Центральный Google ученый

                  29. Имамура Х., Нхат К. П., Тогава Х., Сайто К., Иино Р., Като-Ямада Ю. и др. Визуализация уровней АТФ внутри отдельных живых клеток с помощью генетически кодируемых индикаторов, основанных на переносе энергии флуоресцентного резонанса. Proc Natl Acad Sci U S A. 2009;106(37):15651–6. https://doi.org/10.1073/pnas.0

                    4106.

                    Артикул пабмед ПабМед Центральный Google ученый

                  30. Jung H, Yoon BC, Holt CE. Локализация мРНК аксонов и локальный синтез белка в сборке, поддержании и восстановлении нервной системы. Нат Рев Нейроски. 2012;13(5):308–24. https://doi.org/10.1038/nrn3210.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  31. Хафнер А.С., Донлин-Асп П.Г., Лейтч Б., Герцог Э., Шуман Э.М. Локальный белковый синтез является повсеместным признаком пре- и постсинаптических компартментов нейронов. Наука. 2019;364(6441).

                  32. Cioni JM, Lin JQ, Holtermann AV, Koppers M, Jakobs MAH, Azizi A, et al. Поздние эндосомы действуют как платформы для трансляции мРНК и поддерживают митохондрии в аксонах. Клетка. 2019;176(1-2):56–72.e15.

                    КАС Статья Google ученый

                  33. Gumy LF, Yeo GS, Tung Y-CL, Zivraj KH, Willis D, Coppola G, et al. Транскриптомный анализ сенсорных аксонов эмбрионов и взрослых выявляет изменения в локализации репертуара мРНК. рна. 2011;17(1):85–9.8. https://doi.org/10.1261/rna.2386111.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  34. Хиллефорс М., Джойо А.Е., Мамеза М.Г., Каплан Б.Б. Жизнеспособность аксонов и функция митохондрий зависят от локального синтеза белка в симпатических нейронах. Селл Мол Нейробиол. 2007;27(6):701–16. https://doi.org/10.1007/s10571-007-9148-y.

                    КАС Статья пабмед Google ученый

                  35. Ашрафи А., Натера-Наранхо О., Джойо А.Е., Каплан Б.Б. Регуляция аксонального транспорта мРНК цитохром с оксидазы IV. Мол Селл Нейроски. 2010;43(4):422–30. https://doi.org/10.1016/j.mcn.2010.01.009.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  36. Couvillion MT, Soto IC, Shipkovenska G, Churchman LS. Синхронизированные митохондриальные и цитозольные программы трансляции. Природа. 2016; 533(7604):499–503. https://doi.org/10.1038/nature18015.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  37. Рихтер У., Лахтинен Т., Мартинен П., Суоми Ф., Баттерсби Б.Дж. Контроль качества синтеза митохондриального белка необходим для целостности мембраны и пригодности клеток. Джей Селл Биол. 2015;211(2):373–89. https://doi.org/10.1083/jcb.201504062.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  38. Barsh GS, Lagouge M, Mourier A, Lee HJ, Spåhr H, Wai T, et al. SLIRP регулирует скорость синтеза митохондриального белка и защищает LRPPRC от деградации. ПЛОС Генетика. 2015;11(8):e1005423.

                    Артикул Google ученый

                  39. Richter-Dennerlein R, Oeljeklaus S, Lorenzi I, Ronsor C, Bareth B, Schendzielorz AB, et al. Синтез митохондриального белка адаптируется к притоку белка, кодируемого ядром. Клетка. 2016;167(2):471–83 e10. https://doi.org/10.1016/j.cell.2016.09.003.

                    КАС Статья пабмед ПабМед Центральный Google ученый

                  40. Estell C, Stamatidou E, El-Messeiry S, Hamilton A. Визуализация митохондриальной трансляции in situ показывает слабую корреляцию с интенсивностью нуклеоидной ДНК и отсутствие подавления во время митоза. Дж. Клеточные науки. 2017;130(24):4193–9. https://doi.org/10.1242/jcs.206714.

                    КАС Статья пабмед Google ученый

                  41. Роуз Р.Х., Бриддон С.Дж., Холлидей Н.Д. Бимолекулярная флуоресцентная комплементация: активация семи сигнальных сетей трансмембранных доменных рецепторов. Бр Дж. Фармакол. 2010;159(4):738–50. https://doi.org/10.1111/j.1476-5381.2009.00480.x.

                    КАС Статья пабмед Google ученый

                  42. Wobbrock JO, Findlater L, Gergle D, Higgins JJ, редакторы. Выровненное ранговое преобразование для непараметрического факторного анализа с использованием только процедур анова. Материалы конференции SIGCHI по человеческому фактору в вычислительных системах; 2011.

                  Скачать ссылки

                  Благодарности

                  Мы хотим посвятить эту работу жизни и карьере нашего любимого наставника и коллеги, доктора Кьюнг-Тай Мин, который недавно скончался.

                  Финансирование

                  Эта работа была поддержана Программой фундаментальных научных исследований через Национальный исследовательский фонд Кореи (NRF), финансируемой Министерством науки и ИКТ (2016R1A3B1

                • 2 до K.M.; 2020R1A2C1005492, 2021R1A4A1031644 до J.-I.K.1A.-I.K. 2021; . Эта работа также была поддержана грантом от Фонда Су Кёнбэ (SUHF-17020101 для C. L.).

                  Информация об авторе

                  Примечания автора

                  1. Кьюнг-Тай Мин умерла.

                  2. Соён Ли и Донгын Пак в равной степени внесли свой вклад в эту работу.

                  Авторы и организации

                  1. Департамент биологических наук, Ульсанский национальный институт науки и технологий (UNIST), Ульсан, 44919, Республика Корея Kyung-Tai Min

                  2. Национальный творческий исследовательский центр протеостаза, Ульсанский национальный институт науки и технологий (UNIST), Ульсан, 44919, Республика Корея

                    Soyeon Lee, Dongkeun Park & ​​Kyung-Tai Min

                  Авторы

                  1. Soyeon Lee

                    Просмотр публикаций автора

                    Вы также можете искать этого автора в PubMed Google Scholar

                  2. Dongkeun Park

                    Просмотр публикаций автора

                    Вы также можете искать этого автора в PubMed Google Scholar

                  3. Chunghun Lim

                    Посмотреть публикации автора

                    Вы также можете искать этого автора в PubMed Google Scholar

                  4. Jae-Ick Kim

                    Просмотр публикаций автора

                    Вы также можете искать этого автора в PubMed Google Scholar

                  5. Kyung-Tai Min

                    Просмотр публикаций автора

                    Вы также можете искать этого автора в PubMed Google Scholar

                  Вклады

                  Концептуализация, Д. П. и К.М.; методики, С.Л., Д.П., С.Л., Ж.-И.К. и К.М.; расследование, С.Л. и Д.П.; интерпретация данных, С.Л., Д.П., С.Л., Ж.-И.К. и К.М.; написание — первоначальный вариант, С.Л., Д.П. и К.М.; написание — обзор и редактирование, С.Л., Д.П., К.Л. и Ж.-И.К.; приобретение финансирования, C.L., J.-I.K. и К.М.; надзор, С.Л., Ж.-И.К. и К.М. Все авторы прочитали и одобрили окончательный вариант рукописи.

                  Авторы переписки

                  Переписка с Чонхун Лим или Дже-Ик Ким.

                  Декларация этики

                  Утверждение этики и согласие на участие

                  Уход за мышами и экспериментальные процедуры проводились в соответствии с протоколами, утвержденными Институциональным комитетом по уходу за животными и их использованию Ульсанского национального института науки и технологий (UNIST).

                  Согласие на публикацию

                  Неприменимо.

                  Конкурирующие интересы

                  Авторы заявляют, что у них нет конкурирующих интересов.

                  Дополнительная информация

                  Примечание издателя

                  Springer Nature остается нейтральной в отношении юрисдикционных претензий в опубликованных картах и ​​институциональной принадлежности.

                  Дополнительная информация

                  Дополнительный файл 1: Рис. S1.

                  mtIF3-Dendra2 локализован в митохондриях. a Схематическое изображение кодирующей последовательности mtIF3. mtIF3 имеет митохондриальную адресную последовательность в N-концевом домене (131 а.о.). b Первичные нейроны гиппокампа трансфицировали векторами Dendra2. Митохондрии метили митохондриально-направленной трансфекцией mCherry (mito-mCherry). CDS mtIF3 привел к митохондриальной локализации Dendra2 (масштабная линейка, 10 мкм). c Исходное изображение местности, используемой для кимографа. Эти изображения были сделаны через 90 минут после лечения лекарственным средством (масштабная линейка, 10 мкм). Аксоны визуализировали из аксональной камеры микрофлюидных устройств.

                  Дополнительный файл 2: Рис. S2.

                  Схематическое изображение анализа мито-рибоBiFC. Транслирующий рибосомный комплекс проявляет активную динамику. Во время элонгации рибосомные субъединицы последовательно вращаются, что приводит к низкой интенсивности мито-рибоБиФК. Для замораживания транслирующихся митохондриальных рибосом мы обрабатывали хлорамфениколом, ингибирующим образование пептидной связи. Ожидается, что невращающийся рибосомный комплекс будет демонстрировать высокий сигнал BiFC. Через 90 минут после обработки хлорамфениколом мы сравнили интенсивность мито-рибоБиФК до и после обработки хлорамфениколом. Поскольку высокотранслирующая мРНК связывается с большим количеством рибосом, мы могли обнаружить более высокое увеличение сигнала в активно транслируемой мРНК.

                  Дополнительный файл 3: Рис. S3.

                  Модуляция уровня экспрессии mtIF3. a, b Уровень mtIF3 снижался за счет РНК-интерференции с кшРНК. Выполняя вестерн-блоттинг, мы подтвердили успешное восстановление mtiF3 через 48 ч после инкубации кшРНК в клетках NIH/3T3. Уровень mtIF3 был снижен примерно на 50% по сравнению с контрольной группой. Уровень экспрессии mtIF3 нормализовали по уровню β-тубулина. Данные представляют собой среднее значение ± стандартная ошибка среднего (N = 5 независимых экспериментов). * Р <0,05, как определено с помощью непарного t-критерия Уэлча. c Последовательность устойчивого к кшРНК (SR) mtIF3. 7 нуклеотидов CDS mtIF3 были мутированы в сайте нацеливания mtIF3 shRNA. d Коэкспрессия mtIF3 (SR) с кшРНК анализируется вестерн-блоттингом. Плазмиды shRNA и 5’UTR-mtIF3 (SR)-3xFLAG-3’UTR котрансфицировали в течение 72 ч в клетки Neuro2A. e Относительный уровень экспрессии mtIF3 с UTR или без UTR, проанализированный вестерн-блоттингом. Плазмиду mtIF3 (SR) с НТО или без НТО трансфицировали в течение 72 ч в клетки Neuro2A. Постепенно увеличивающееся количество плазмиды mtIF3 (SR)-3xFLAG использовали для трансфекции для сравнения с UTR-зависимым уровнем экспрессии mtIF3. * указывает на mtIF3 с меткой 3xFlag (SR), а ** указывает на эндогенный mtIF3. β-тубулин использовали для контроля нагрузки. f, g Двойные промоторные конструкции и репрезентативные изображения mtIF3 с мито-mTFP1 или mCherry в клетках Neuro2A (масштабная линейка, 5 мкм).

                  Дополнительный файл 4: Рис. S4.

                  Блокирование митохондриальной трансляции снижает уровень АТФ в митохондриях. Лечение хлорамфениколом вызывало быстрое снижение интенсивности FRET. Первичные нейроны гиппокампа трансфицировали Mt-ATeam1.03 в DIV2, и изображения получали каждые 5 минут в течение 90 минут в DIV3. После получения первого снимка хлорамфеникол обрабатывали в течение всего времени эксперимента без промывки. Значения представлены как среднее значение ± стандартная ошибка среднего, и статистическая значимость была проверена между 5 минутами до лечения и 0 минутами после лечения с использованием парного t-критерия. N = 10 клеток из 3 независимых экспериментов. *** Р < 0,001.

                  Дополнительный файл 5.

                  Необработанные изображения иммуноблотов на рис. S3.

                  Дополнительный файл 6.

                  Необработанные изображения результатов ОТ-ПЦР на рис. 1а.

                  Доп. файл 7.

                  Статистический анализ. Резюме всего статистического анализа в этой статье.

                  Права и разрешения

                  Открытый доступ Эта статья находится под лицензией Creative Commons Attribution 4.0 International License, которая разрешает использование, совместное использование, адаптацию, распространение и воспроизведение на любом носителе или в любом формате, при условии, что вы укажете соответствующую ссылку на оригинальный автор(ы) и источник, предоставьте ссылку на лицензию Creative Commons и укажите, были ли внесены изменения. Изображения или другие сторонние материалы в этой статье включены в лицензию Creative Commons на статью, если иное не указано в кредитной строке материала. Если материал не включен в лицензию Creative Commons статьи, а ваше предполагаемое использование не разрешено законом или выходит за рамки разрешенного использования, вам необходимо получить разрешение непосредственно от правообладателя. Чтобы просмотреть копию этой лицензии, посетите http://creativecommons.org/licenses/by/4. 0/. Отказ Creative Commons от права на общественное достояние (http://creativecommons.org/publicdomain/zero/1.0/) применяется к данным, представленным в этой статье, если иное не указано в кредитной линии данных.

                  Перепечатки и разрешения

                  Об этой статье

                  Половина тРНК модулирует трансляцию как реакцию на стресс у Trypanosoma brucei

                  Резюме

                  В отсутствие обширных механизмов контроля транскрипции патогенный паразит Trypanosoma brucei в решающей степени зависит от регуляции трансляции. экспрессия генов. Однако молекулярное понимание регуляции биосинтеза белка скудно. Здесь мы анализируем интерактом малой некодирующей РНК (нкРНК) рибосом в T. brucei в различных условиях роста и на разных стадиях жизни. Ассоциированные с рибосомами нкРНК недавно были признаны беспрецедентными регуляторами функций рибосом. Наши данные показывают, что 3′-половина тРНК Thr продуцируется во время лишения питательных веществ и становится одним из наиболее распространенных фрагментов РНК, полученных из тРНК (tdR). Половинки тРНК Thr связываются с рибосомами и полисомами и стимулируют трансляцию, облегчая загрузку мРНК во время восстановления после стресса после прекращения голодания. Блокирование или истощение эндогенной тРНК 9Половинки 0602 Thr смягчают этот стимулирующий эффект как in vivo, так и in vitro . У T. brucei и его близких родственников отсутствуют хорошо описанные ферменты млекопитающих для половинного процессинга тРНК, что указывает на уникальный биогенез tdR у этих паразитов.

                  Введение

                  Патогенный простейший паразит Trypanosoma brucei и его родственники являются возбудителями африканского трипаносомоза человека в регионах к югу от Сахары и других разрушительных заболеваний, которые трудно поддаются лечению. T. brucei имеет сложный жизненный цикл с участием двух разных хозяев, насекомого и млекопитающего, и обладает четко различимыми стадиями развития 1 . Несмотря на то, что этому простейшему организму приходится приспосабливаться к различным условиям окружающей среды, ему в значительной степени не хватает способности регулировать транскрипцию генов, кодирующих белок. Следовательно, и в отличие от др. эукариот, они в значительной степени полагаются на посттранскрипционные средства для регуляции экспрессии генов 2 . На первый взгляд, отсутствие контроля над транскрипцией кажется энергетически расточительным, но это может помочь трипаносомам быстрее реагировать на вызовы окружающей среды и даже может быть полезным во время передачи хозяину 3 . В то время как хорошо изученные посттранскрипционные механизмы регуляции генов, такие как пути RNAi, работают у большинства эукариот, регуляция трансляции, управляемая miRNA, по-видимому, отсутствует в трипаносомах 4 . Несмотря на то, что контроль трансляции имеет ключевое значение для регуляции экспрессии генов у T. brucei 5 , мало информации о том, как эти паразиты регулируют биосинтез белка на молекулярном уровне. Недавно мы идентифицировали связанные с рибосомами нкРНК (ранкРНК) у архея 9.0707 H. volcanii 6,7 и Saccharomyces cerevisiae 8  как сильнодействующие агенты, участвующие в механизмах контроля трансляции. RancRNAs представляют новый класс регуляторов трансляции, действующих в первую очередь во время реакции на стресс, и включают как малые, так и длинные ncRNAs (rev. ref. 9). В последние годы ранкРНК были идентифицированы как риборегуляторы во всех областях жизни. Основным преимуществом контроля трансляции, опосредованного ранкРНК, является его немедленная доступность, поскольку регуляторная единица представляет собой малую РНК, обычно полученную из уже существующих видов РНК и способную нацеливаться на рибосому как основной компонент механизма трансляции.

                  Чтобы выяснить, играют ли ранкРНК решающую роль в T. brucei , мы проанализировали небольшой интерактом нкРНК рибосом, выделенных из двух разных стадий развития паразитов, подвергающихся воздействию различных условий окружающей среды. Мы выявляем половинки тРНК как один из наиболее сильно затронутых классов транскриптов, активация которых происходит во время депривации питательных веществ и в стационарной фазе. В частности, количество тРНК Thr 3′-половины значительно увеличивается, и было обнаружено, что она взаимодействует с рибосомами и полисомами при голодании. Это специфическое взаимодействие тРНК с полурибосомой стимулирует биосинтез белка как in vitro, так и in vivo и, по-видимому, играет роль в первую очередь во время фазы восстановления после стресса Т. brucei .

                  Результаты

                  Ассоциированные с рибосомами нкРНК у

                  T. brucei

                  Чтобы получить представление о составе и предполагаемой биологической функции нового класса ранкРНК 9 , мы создали библиотеку кДНК, кодирующую малые РНК размером от 20 до 300 нуклеотидов, которые совместно очищаются с цитозольными рибосомами в Т. Брюсей . С этой целью рибосомы и полисомы из проциклических, а также из кровяных форм 9Собирали 0707 клеток T. brucei в экспоненциальной и стационарной фазах. Кроме того, были выделены рибосомы для идентификации ранкРНК из проциклических клеток после теплового шока, холодового шока или пищевого стресса. После глубокого секвенирования полученные чтения были проанализированы с использованием модифицированной версии ранее установленного конвейера APART 10 . После обрезки адаптерных последовательностей и контроля качества осталось 30,1 млн прочтений (в среднем 5 млн прочтений на библиотеку кДНК), которые были дополнительно проанализированы, в результате чего было получено 359 ридов.6 предполагаемых кандидатов в ранкРНК. Доступ ко всем считываниям секвенирования можно получить в Европейском архиве нуклеотидов под номером PRJEB24915. Большинство прочтений секвенирования картировано в локусах рибосомной РНК, что неудивительно, учитывая тот факт, что 28S рРНК рибосом T. brucei естественным образом расщепляется на шесть фрагментов, большинство из которых находится в исследуемом диапазоне размеров. Второй по величине пул последовательностей, сопоставленных с локусами тРНК (рис. 1а). При сравнении распределения картированных прочтений между различными условиями роста или стресса было очевидно, что при лишении питательных веществ и во время стационарной фазы прочтения, полученные из тРНК, стали очень многочисленными видами и преобладали в секвенированном пуле ранкРНК (рис. 1a). Подробная информация обо всех считываниях секвенирования, полученных из тРНК, собрана в дополнительных данных 1. Распределение длин считываний, полученных из тРНК, выявило четкий пик около 33 нуклеотидов, который в основном представляет собой половины тРНК (рис. 1b). При анализе уровней обилия половинок тРНК в различных условиях роста стала очевидной значительно высокая корреляция между образцами, полученными в результате теплового шока, холодового шока и экспоненциально растущими 9Образцы 0707 T. brucei с одной стороны и голодающие и стационарные клетки с другой (рис. 1в). Кроме того, этот анализ показал, что уровни содержания фрагментов тРНК, выделенные из образцов формы кровотока, сильно отличаются от всех других и указывают на уникальный паттерн экспрессии, включая отдельную фракцию фрагментов тРНК длиной 21 нуклеотид (рис. 1b, c). тРНК несут множественные посттранскрипционные модификации, которые могут препятствовать обратной транскрипции во время подготовки библиотеки кДНК и, таким образом, потенциально могут исказить выводы о длине фрагментов тРНК и количестве клеток. Чтобы обойти это потенциальное ограничение и подтвердить данные последовательности ранкРНК, мы провели всесторонний анализ половин тРНК на нозерн-блоттинге на тотальной РНК, выделенной из T. brucei в различных стрессовых условиях. Результаты подтверждают данные секвенирования, показывая разные уровни половинок тРНК почти для всех изоакцепторов тРНК (дополнительная фигура 1). Эти эксперименты показывают, что большинство обнаруживаемых половин тРНК происходят из 5′-части тРНК, и, таким образом, дополнительно подтверждают данные секвенирования. В этих северных анализах мы заметили, что обработка тРНК пополам вследствие различных условий роста и стресса зависит от вида тРНК и, следовательно, довольно гетерогенна (дополнительная фигура 1).

                  Рис. 1

                  Профилирование уровней распространенности прочтений секвенирования ранкРНК. a Распределение фракций считываний секвенирования, отнесенных к разным классам РНК, среди различных условий роста и стадий жизни T. brucei . Обратите внимание, что категория «нкРНК» включает аннотированные нкРНК T. brucei , не указанные в другом списке. b Распределение длин считываний секвенирования, полученного из тРНК, наблюдаемое в различных условиях роста. c Образец корреляционной матрицы, показывающий корреляцию Пирсона уровней экспрессии идентифицированных продуктов процессинга тРНК между различными условиями роста и стадиями жизни. d Ассоциацию половинок тРНК с рибосомами оценивали с помощью нозерн-блоттинга РНК, выделенной из неочищенного рибосомного осадка из экспоненциально растущих клеток или из клеток, голодавших в течение двух часов, путем инкубации паразита в PBS. 5S рРНК (5S) служила контролем загрузки. Указаны изоакцепторные антикодоны тРНК и происхождение половинки тРНК (5′ или 3′)

                  Изображение полного размера

                  Количество половинок тРНК меняется во время стресса

                  Чтобы проверить, какие из этих половинок тРНК также связаны с рибосомами, мы повторили Нозерн-блот анализирует сырой осадок рибосомы. Поскольку данные секвенирования и нозерн-блоттинга показали наиболее обильный процессинг тРНК в халв-меры при лишении питательных веществ (после инкубации клеток в PBS или во время стационарной фазы), мы сравнили рибосомы, выделенные из голодающих и экспоненциально растущих T. brucei культуры (рис. 1г). На этих нозерн-блотах можно было четко обнаружить по крайней мере десять половинок тРНК. Среди этих потенциально связанных с рибосомами фрагментов тРНК 3′-половина тРНК Thr , а также две 5′-половины, происходящие от тРНК Ala и тРНК Asp , были наиболее распространенными (рис. 1d) и демонстрировали дифференциальную клеточную экспрессию. во время испытаний в условиях роста (дополнительный рисунок 1). Сначала мы сосредоточились на 3′-половине тРНК, происходящей от тРНК 9.0602 Изоакцептор Thr , содержащий антикодон AGU ( Tb427_10_tRNA_Thr_1 ). Судя по показаниям секвенирования, эта половина особенно распространена во время лишения питательных веществ и в стационарной фазе (дополнительные данные 1, дополнительная фигура 2a). Нозерн-блоттинг подтвердил эту картину распространенности и продемонстрировал, что половина 3′-тРНК Thr накапливается зависимым от времени образом в проциклических клетках T. brucei во время голодания и в поздней стационарной фазе (рис. 2a, b). Момент времени появления первой тРНК Thr 3′-половина обнаружения (два часа лишения питательных веществ) совпадает с нарушением движения клеток T. brucei . Помещение голодающих клеток обратно в нормальную среду для роста приводит к возобновлению движения жгутика через 30 минут, тогда как половина тРНК Thr оставалась на постоянном уровне во время этой фазы восстановления до 2 часов (рис. 2c).

                  Рис. 2

                  тРНК Thr 3′ половина накапливается при стрессе в проциклическом и кровяном русле T. brucei . a Проциклические клетки T. brucei голодали в течение указанного времени путем инкубации в PBS. Тотальную РНК экстрагировали, и присутствие 3′-половины тРНК Thr (длиной 37 нуклеотидов; см. также дополнительную фигуру 10) отслеживали с помощью нозерн-блоттинга. b Присутствие 3′-половины тРНК Thr исследовали, как и в a , в проциклических клетках, выращенных до различной плотности клеток (указано в верхней части панели). c То же, что и и , но клеткам давали возможность восстановиться в нормальной среде в течение указанных периодов времени после пищевого стресса. На нижней панели контраст этой части блота был скорректирован, чтобы более четко видеть 3′-половину тРНК Thr . d Клетки кровотока T. brucei подвергли стрессу путем инкубации в PBS, а затем дали возможность восстановиться в нормальной среде для роста. Наличие 3′-половины тРНК Thr анализировали, как описано в . Во всех случаях рРНК, окрашенные EtBr, служат в качестве контроля загрузки

                  Изображение в натуральную величину

                  В нозерн-блоттингах мы заметили более медленно мигрирующую полосу над зрелой тРНК Thr в голодающих клетках, которая быстро исчезает во время фазы восстановления (рис. 2). Вопреки интуиции, эта более медленно мигрирующая полоса РНК соответствует тРНК Thr , в которой отсутствует 3′-конец CCA (дополнительная фигура 3a, b). Следует отметить, что почти во всех считываниях секвенирования, происходящих от тРНК Thr , также отсутствуют 3′-концы CCA во время пищевого стресса (дополнительная фигура 2b). Эта обрезка 3′-тРНК на самом деле является широко распространенным явлением при недостатке питательных веществ у T. brucei (дополнительная фигура 1a) и, таким образом, потенциально аналогичен человеческим тРНК с окислительным стрессом 11 . В применяемых условиях голодания (инкубация с PBS в течение не менее 2 часов) новая транскрипция тРНК, вероятно, незначительна, что позволяет предположить, что половинки тРНК продуцируются во время пищевого стресса из зрелых тРНК, лишенных 3′ CCA.

                  В кровотоке формы T. brucei наблюдалась другая картина половинной численности тРНК Thr . В отличие от проциклической стадии, которая является наиболее распространенной формой у насекомого-хозяина, тРНК Thr 3′-половина уже присутствует во время экспоненциального роста в кровяном русле формы паразита. Полууровень тРНК в форме кровяного русла оставался постоянным во время голодания и в фазе восстановления (рис. 2г).

                  По сравнению с 3′-половиной тРНК Thr , для 5′-половины тРНК Ala ( Tb427.07.6821 ) был очевиден совершенно другой характер экспрессии (дополнительная фигура 1). Он присутствует в легко обнаруживаемых количествах при экспоненциальном росте в проциклической форме, а также в кровяном русле, в то время как он не обнаруживается в условиях голодания у обеих форм паразита (рис. 3а, б). Облегчение лишения питательных веществ путем переноса клеток обратно в богатую среду привело к быстрому повторному появлению тРНК 9.0602 Ala половина в пределах от 15 до 30 мин. Также во время стационарной фазы роста содержание этой половины 5′-тРНК снижается в зависимости от увеличения плотности клеток (рис. 3c). Это указывает на то, что накопление фрагментов является специфичным для тРНК, и снова предполагает, что половинки тРНК не являются неспецифическими промежуточными продуктами деградации.

                  Рис. 3

                  тРНК Ala 5′-половина присутствует при нормальном росте, но исчезает при стрессе в проциклическом и кровяном русле T. brucei . . Проциклические клетки T. brucei подвергали голоданию в течение двух часов путем инкубации в PBS. Затем клетки оставляли восстанавливаться в нормальных средах в течение указанных периодов времени. Тотальную РНК экстрагировали и присутствие 5′-половины тРНК Ala (длина: 34 нуклеотида) отслеживали с помощью нозерн-блоттинга. b Клетки кровотока T. brucei подвергали стрессу путем инкубации в PBS в течение 30 или 60 мин, а затем позволяли восстановиться в нормальной среде для роста. Наличие тРНК Ala 5′-половину анализировали, как описано в a . c Присутствие 5′-половины тРНК Ala исследовали, как и в a , в проциклических клетках, выращенных до различной плотности клеток (указанных в верхней части панели). Во всех случаях рРНК, окрашенные EtBr, служат в качестве контроля загрузки

                  Половинки тРНК ассоциированы с рибосомами и полисомами

                  Половинки тРНК обладают сродством к рибосомным частицам. Поэтому полисомные профили экспоненциально растущих проциклических клеток и клеток, голодавших в течение двух часов, регистрировали в линейных градиентах сахарозы. В условиях голодания количество полисом было заметно уменьшено, а пики моносом и рибосомных субъединиц увеличились по сравнению с экспоненциально растущим контролем (рис. 4а). Это указывает на снижение скорости трансляции и снижение общей метаболической активности в условиях роста, когда питательные вещества ограничены. Собирали фракции полисомных градиентов, выделяли РНК и использовали для Нозерн-блоттинга. При поиске тРНК Thr В 3′-половине после пищевого стресса сигналы были обнаружены во фракциях, соответствующих большой субъединице рибосомы (60S), моносомах (80S), полисомах и в легких фракциях на вершине градиента (свободная РНК) (рис. . 4б). Это указывает на то, что половина тРНК Thr действительно ассоциирована с рибосомами in vivo и ее сайт связывания, по-видимому, находится в большой рибосомной субъединице. Несмотря на то, что количество полисом в градиенте сахарозы голодающих клеток ниже предела применяемой системы детекции (рис. 4а), четко видимая тРНК 9Полусигнал 0602 Thr был обнаружен на нозерн-блоте (рис. 4b). Это указывает на то, что часть половинок тРНК накапливается на нескольких полисомах, присутствующих в голодающих клетках. Количественная оценка сигналов нозерн-блоттинга, соответствующих полноразмерной тРНК Thr и 3′-половине тРНК Thr в полисомной фракции, показала, что 55% сигнала происходит от полумера тРНК. Сообщалось, что в клетках человека определенные половинки тРНК способствуют образованию стрессовых гранул (SG) и даже становятся неотъемлемой частью стрессовых гранул 12,13 . Формирование SG полезно не только для выживания в сложных условиях, но и для восстановления после стресса 14 . Поэтому нас интересовало, модулирует ли 3′-половину тРНК T. brucei Thr SG образование и/или оборот. Для этой цели мы использовали клеточную линию, экспрессирующую меченный YFP маркер гранул DHh2 (ссылка 15 ), и наблюдали за сборкой SG в присутствии тРНК 3′-половина . После двух часов голодания у паразита легко наблюдались стрессовые гранулы (дополнительная фигура 4). Однако образование стрессовых гранул, по-видимому, не коррелирует с тРНК 9.0602 Thr уменьшает содержание вдвое в T. brucei , поскольку увеличение его внутриклеточной концентрации путем электропорации 3′-полутранскриптов не влияло на образование или стабильность стрессовых гранул (дополнительная фигура 4). Кроме того, в градиентах сахарозы стресс-гранулы не осаждаются вместе с рибосомными или полисомными фракциями в применяемых условиях (рис. 4в). Эти данные подтверждают мнение о том, что 3′-половинки тРНК Thr (i) не модулируют образование истинных стрессовых гранул у T. bruce i но (ii) связываются с рибосомами и полисомами in vivo. Чтобы подтвердить ассоциацию рибосом, мы провели исследования связывания in vitro с использованием градиентно очищенных рибосом T. brucei 80S, выделенных либо из экспоненциально растущих, либо из голодающих клеток. В этих экспериментах по связыванию можно было подтвердить ассоциацию рибосом, и, кроме того, наблюдалось предпочтительное взаимодействие половины тРНК с нагруженными рибосомами (рис. 4d).

                  Рис. 4

                  ТРНК Thr 3′-полуассоциирует с рибосомами in vivo и in vitro. a Профилирование полисом с градиентами сахарозы (10–40%) с использованием полных клеточных лизатов, полученных из экспоненциально растущих клеток T. brucei (серые) и из клеток, голодавших в течение 2 часов в PBS (черные). b РНК экстрагировали из фракций, содержащих полисомы, 80S моносомы, 60S или 40S рибосомальные субъединицы, и из фракций с легким градиентом сахарозы (свободная РНК) и использовали для нозерн-блоттинга для мониторинга тРНК Thr 3′-половина (длина: 37 нуклеотидов). В a и b показаны репрезентативные данные трех независимых экспериментов. c Фракции полисомных профилей не подвергнутых стрессу (без стресса) или голодающих (стрессовых) клеток также исследовали на наличие YFP-меченого DHh2 (73  кДа) с помощью вестерн-блоттинга. Указано расположение белковых маркеров молекулярной массы (см. также дополнительную фигуру 16). Вестерн-блоты были повторены дважды. d Ассоциация 3′-половины тРНК Thr с рибосомами была проанализирована с использованием анализа связывания на фильтре in vitro с использованием градиентно очищенных 80S рибосом, выделенных из стрессированных или не подвергнутых голоданию клеток, и синтетических половинок тРНК, меченных на 5′-конце [ 32 P] . Среднее значение и стандартное отклонение четырех независимых экспериментов по связыванию показаны под сканом, тогда как эффективность связывания с использованием ненагруженных рибосом 80S была установлена ​​на 1,00

                  Изображение в натуральную величину

                  ТРНК

                  Thr наполовину стимулирует T. brucei трансляцию

                  Установив рибосомную ассоциацию тРНК Thr 3′ наполовину, мы затем проверили, имеет ли это взаимодействие функциональные последствия для работы рибосом. Поэтому мы провели анализ трансляции in vitro с экстрактами клеток T. brucei , используя общий пул эндогенных мРНК в качестве матрицы и включение S-метионина 35 в белки в качестве считывания (рис. 5a). В присутствии нацеливающего на рибосомы антибиотика пуромицина все полосы с радиоактивной меткой резко уменьшались, что свидетельствует о том, что 35 Мечение белков S-метионином зависело от трансляции. Когда анализ проводили в присутствии 3′-половин тРНК Thr , транскрибированных in vitro, мы наблюдали небольшой, но воспроизводимый стимулирующий эффект на трансляцию около 20% (рис. 5а). Однако 3′-половины тРНК Thr , содержащие CCA-хвост (вид, который не был обнаружен в наших биоинформатических анализах; дополнительная фигура 2b), не могли стимулировать трансляцию. Чтобы выяснить, зависит ли нарушение стимуляции трансляции этим 3′-удлинением от последовательности ССА или просто от длины, мы повторили анализ с тРНК 9.0602 Thr , наполовину несущий последовательность GGU на 3′-конце. Также эта молекула не могла стимулировать синтез белка in vitro, что указывает на эффект ограничения длины (рис. 5а). Кроме того, добавление 5′-половины тРНК Ala или 3′-половины, происходящей от тРНК Asp , не влияло на синтез белка in vitro (рис. 5a, дополнительная фигура 5). Оба последних результата служат контролем специфичности для стимулирующего эффекта 3′-половины тРНК Thr .

                  Рис. 5

                  3′-половина тРНК Thr стимулирует трансляцию in vitro и in vivo. a Слева авторадиограммы двух репрезентативных SDS-полиакриламидных гелей анализов трансляции in vitro, проведенных в отсутствие (имитация) или в присутствии транскрибируемой in vitro тРНК Thr 3′-половина, либо содержащая 3′-CCA или конец 3′-GGU (+) или его отсутствие (-). Среднее значение и стандартное отклонение от четырех до девяти независимых экспериментов по трансляции in vitro в отсутствие (фиктивных) или в присутствии половинок тРНК (либо происходящих из тРНК Thr тРНК Ala ) показаны на правом графике. Добавление ингибитора трансляции пуромицина (Pmn) служит контролем специфичности анализа ( n  = 3). b Слева авторадиограмма двух репрезентативных гелей трансляционных реакций in vivo, проведенных в отсутствие (имитация) или в присутствии электропорированной тРНК Thr 3′-половинки, либо содержащие 3′-CCA, либо Показаны конец GGU (+) или его отсутствие (-). Количественная оценка (среднее значение и стандартное отклонение) от трех до десяти независимых экспериментов по метаболическому мечению в отсутствие (фиктивных) или в присутствии введенных половинок тРНК (либо происходящих из тРНК Thr тРНК Ala ) показан на правом графике. c Авторадиограмма анализа трансляции in vivo с использованием электропорированных тРНК Thr 3′-половинки, содержащие разные химические группы на 5′-конце. Показан типичный гель из четырех независимых экспериментов. 5′-PPP: 5′-трифосфат; 5′-P: 5′-монофосфат. 3′-CCA: указывает на наличие или отсутствие хвоста 3′-CCA. Значимость в a и b по парным шкалам Стьюдента t — тест: ** P  ≤ 0,01. d Изобилие мРНК тубулина (1755 нуклеотидов; см. Дополнительную фигуру 17a), связанной с рибосомами (P100) во время T. brucei реакций трансляции in vitro в присутствии или отсутствии тРНК Thr 3′-половину отслеживали с помощью блот-анализ ( n  = 2). S100 указывает на соответствующие пострибосомные супернатанты. Реакции останавливали либо через 5, либо через 20 мин инкубации. На всех рисунках либо окрашенные кумасси белковые гели, либо окрашенные EtBr гели РНК (нижние панели) служат контролем загрузки

                  Изображение в полный размер

                  Чтобы выяснить, имеют ли эти эффекты in vitro физиологическое значение для паразита, мы использовали электропорацию для введения половинок синтетической тРНК в клетки T. brucei . Условия для электропорации малых РНК были оптимизированы с использованием миРНК (миРНК-315), нацеленной на α-тубулин 16 , который, как было показано, вызывает морфологический фенотип (так называемые клетки FAT) из-за накопления множественных ядер из-за неполного цитокинеза. 17 . Фенотип наблюдался через 18 часов после электропорации, и в наших оптимизированных условиях электропорации 71% клеток демонстрировали фенотип FAT (дополнительная фигура 6).

                  Затем мы вводили половинки транскрибированной in vitro тРНК Thr в клетки T. brucei . Нозерн-блоттинг, проведенный через два часа после электропорации, продемонстрировал легко обнаруживаемые количества транскрибированных in vitro половин тРНК внутри клеток (дополнительная фигура 7a). Отсутствие этапа электропорации привело к полной потере сигнала нозерн-блоттинга, что свидетельствует о том, что транскрипты in vitro действительно были введены в клетку (дополнительная фигура 7b). После электропорации клетки инкубировали в условиях лишения питательных веществ и, наконец, переносили обратно в полную среду для восстановления. 35 Затем во время фазы восстановления после стресса оценивали включение S-метионина. В этих условиях мы наблюдали заметно повышенную трансляционную активность в присутствии тРНК Thr 3′ наполовину примерно на 35% (рис. 5b). Как ранее было показано in vitro, добавление CCA или GGU к 3′-концу тРНК наполовину устраняло стимуляцию трансляции, тем самым демонстрируя специфичность 3′-полуэффекта тРНК Thr . В то время как длина 3′-половины тРНК Thr кажется критической, химическая идентичность 5′-конца, по-видимому, менее важна. Половинки, содержащие моно- или трифосфат, были в равной степени способны стимулировать трансляцию in vivo (рис. 5с). Подобно анализу трансляции in vitro, тРНК Ala 5′-половина не действовала in vivo (рис. 5b).

                  тРНК несут множественные посттранскрипционные модификации нуклеозидов, биологическая роль которых в трансляции и за ее пределами только начинает пониматься (ссылка 18 и ссылки в ней). Недавно было показано, что даже регуляторная роль фрагмента, происходящего от тРНК, в человеческих стволовых клетках зависит от посттранскрипционной модификации -19. Однако участие модифицированных нуклеозидов в биологии фрагментов, происходящих от тРНК, нельзя обобщать. Тот факт, что in vitro транскрибируется тРНК 93′-половины 0602 Thr стимулируют трансляцию in vivo (рис. 5b, c), что исключает ключевую роль модификаций этой молекулы для этой конкретной функции. Подтверждение этого вывода исходит из основанных на ЖХ-МС/МС анализов аффинно очищенной тРНК Thr из не подвергавшихся стрессу и голодавших клеток T. brucei с помощью метода сканирования нейтральной потери 20 . Эти данные масс-спектрометрии РНК показали очень похожие профили модификации без существенных различий (дополнительная фигура 8). Таким образом, эти находки не оставляют никаких оснований подозревать тРНК 9.0602 Thr модификации нуклеозидов за то, что они являются фундаментальными для зависимого от стресса образования 3′-половины и за наблюдаемую стимулирующую роль во время трансляции in vivo и in vitro.

                  Поскольку и тРНК, и рибосомы являются высококонсервативными компонентами механизма трансляции, мы затем проверили, может ли полуопосредованная тРНК Thr стимуляция трансляции также наблюдаться у других видов. Поэтому мы ввели синтетическую T. brucei тРНК Thr наполовину либо в галофильные археи Haloferax volcanii , либо в дрожжи S. cerevisiae . В обоих организмах мы наблюдали аналогичную стимуляцию синтеза белка (дополнительная фигура 9a). Эта половина тРНК также стимулирует синтез белка млекопитающих, как показано в реакциях трансляции in vitro на основе экстракта HeLa (дополнительная фигура 9b). Хотя у нас нет доказательств того, что аналогичный эндогенный фрагмент тРНК существует у H. volcanii, S. cerevisiae или клетки человека, сам факт того, что тРНК T. brucei Thr функционирует наполовину у отдаленно родственных видов, свидетельствует о высококонсервативном способе действия.

                  Чтобы получить первое представление о механизме 3′-полуфункции тРНК Thr , мы проверили, стимулирует ли эта ранкРНК трансляцию, способствуя связыванию мРНК с рибосомой. С этой целью собирали T. brucei реакций трансляции in vitro, синтез белка останавливали через 5 или 20 мин добавлением циклогексимида, а затем рибосомы осаждали через подушку из сахарозы. Нозерн-блот-анализ осадка рибосом и соответствующих фракций супернатанта продемонстрировал повышенные уровни мРНК тубулина в большом количестве на рибосомах (в 1,3–3,8 раза) в присутствии тРНК 9.0602 Thr 3′ половина (рис. 5г). Одновременно уровни мРНК тубулина снижались в супернатантах без рибосом, что указывает на усиленную инициацию трансляции в присутствии половины тРНК.

                  Истощение эндогенной тРНК

                  Thr наполовину облегчает стимуляцию

                  Для изучения влияния эндогенной тРНК Thr 3′ на синтез белка мы провели аффинную очистку с использованием биотинилированного антисмыслового ДНК-олигонуклеотида. В качестве входных данных выбран пул малых РНК (30–40 нуклеотидов) из 9Использовали 0707 клеток T. brucei (рис. 6а). Впоследствии аффинно очищенный материал, обогащенный 3′-половиной тРНК Thr , и проточный материал, который представляет собой небольшой пул РНК, обедненный этой половиной тРНК (рис. 6b), были протестированы в реакциях трансляции in vitro. Добавление половины аффинно очищенной тРНК Thr к реакциям трансляции in vitro показало очень мягкий стимулирующий эффект (рис. 6c). Отсутствие значительной стимуляции трансляции в этих условиях связано со значительно низкой концентрацией извлеченной эндогенной тРНК 9.0602 Thr 3′-полумолекулы (~ 1 пмоль на реакцию по сравнению с 500 пмоль в обычных реакциях трансляции in vitro; дополнительная фигура 10). Однако, когда эндогенный пул малых РНК, лишенных 3′-половины тРНК Thr , использовали в анализах трансляции in vitro, мы наблюдали заметное ингибирование трансляции (рис. 6c). Это произошло исключительно из-за отсутствия тРНК Thr 3′ наполовину, так как контрольная фракция (фракция III; — биот-АСО на рис. 6в) не проявляла такого эффекта. Эти данные свидетельствуют о том, что в 9В клетках 0707 T. brucei тРНК Thr наполовину противодействует ингибирующим эффектам других малых РНК, таких как другие производные от тРНК фрагменты, которые могут присутствовать в этом диапазоне размеров, на биосинтез белка. In vivo подтверждение этой интерпретации исходит из экспериментов по введению антисмысловых олигонуклеотидов (ASO), нацеленных на 3′-половину эндогенной тРНК Thr . Электропорация этих ASO в T. brucei нейтрализует роль эндогенной тРНК Thr наполовину, что приводит к явному ингибированию трансляции во время восстановления после стресса, как измерено в анализе метаболического мечения (рис. 6d).

                  Рис. 6

                  Истощение эндогенной тРНК Thr 3′-половины ослабляет стимулирующие эффекты во время трансляции. a Схема стратегии, используемой для аффинной очистки эндогенной тРНК Thr 3′-половина из пула малых РНК (диапазон размеров 30–40 нуклеотидов). В качестве контроля ту же процедуру проводили в отсутствие биотинилированного антисмыслового олигонуклеотида (АСО). b Нозерн-блот-анализ РНК, выделенной из образцов, полученных после аффинной очистки, показывающий успешное выделение тРНК Thr 3′ половина (см. также дополнительную фигуру 10) при использовании биотинилированного ASO (фракция II+) и его частичном истощении из соответствующего протока (сравните фракции III, — и +ASO). Показан репрезентативный блот двух независимых экспериментов по аффинной очистке. c Истощение 3′-полов эндогенной тРНК Thr из пула малых РНК приводит к снижению активности трансляции in vitro. Эффекты фракций РНК, полученных после аффинной очистки, тестировали на трансляцию in vitro. Количественная оценка (среднее значение и стандартное отклонение) показывает среднее значение трех независимых экспериментов. d Химически модифицированную АСО, комплементарную тРНК Thr 3′-половину, электропорировали в клетки T. brucei , и их влияние на трансляцию in vivo исследовали путем метаболического мечения во время восстановления после стресса. Авторадиограмма показывает репрезентативный полиакриламидный гель SDS, в котором метаболическое мечение проводили в клетках, подвергнутых электропорации без ASO (-), или клетках, подвергнутых электропорации с одной (a) или двумя (a+b) различными ASO, нацеленными на эндогенную тРНК Thr 3′-половины. Окрашивание геля кумасси (нижняя панель) служит контролем загрузки. Количественная оценка трех независимых экспериментов по метаболическому мечению показана справа. В качестве контроля специфичности метаболическое мечение выполняли также после электропорации аналогичного АСО без какой-либо комплементарности последовательности тРНК Thr 3′ половина (ctr). Значимость по парному тесту Стьюдента t : ** P  ≤ 0,01

                  Изображение в натуральную величину

                  Обсуждение

                  Кинетопластиды, в том числе T. brucei , обладают весьма своеобразной биологией РНК. Например, большинство митохондриальных мРНК сильно редактируются за счет вставок/делеций уридинов, все тРНК необходимо импортировать в митохондрии, некоторые тРНК подвергаются посттранскрипционному процессингу с помощью взаимозависимых систем модификации/редактирования 21 , цитоплазматические рибосомы состоят из нескольких отдельных больших фрагментов рибосомной субъединицы рРНК 22 , или полицистронные первичные транскрипты мРНК процессируются в зрелые мРНК посредством процесса, называемого транс-сплайсингом (rev. in ref. 23 ). Все эти особенности РНК управляются специальными механизмами обработки/редактирования/транспортировки, что делает их потенциальными мишенями для терапевтических вмешательств. Недавно мы определили класс ассоциированных с рибосомами малых нкРНК (ранкРНК) как до сих пор неизвестное семейство регуляторов трансляции 9 . RancRNAs напрямую связаны с механизмом трансляции и благодаря своему маленькому размеру и непосредственной доступности обладают потенциалом быть регуляторами первой волны во время стрессовых столкновений 8 . Чтобы получить представление о биологии ранкРНК T. brucei , мы секвенировали и проанализировали библиотеку ранкРНК, происходящую из клеток, выращенных в экспоненциальной или стационарной фазе (проциклическая форма, а также форма кровотока), а также из клеток, подвергшихся температурному стрессу или голоданию. Стало очевидным, что особенно тРНК-производные чтения значительно увеличиваются при голодании и что большинство из них представляют собой половинки тРНК (рис. 1а, б).

                  Один из наиболее распространенных видов, происходящих от тРНК, происходит из 3′-половины тРНК Thr во время пищевого стресса и во время стационарной фазы в проциклической форме (рис. 1d, дополнительная фигура 1, дополнительные данные 1). Производство половинок тРНК путем расщепления внутри или вокруг антикодоновой петли во время различных стрессовых условий ранее наблюдалось в различных модельных системах, включая трипаносоматиды 24 , инфузории 25 и клетки млекопитающих 26,27,28,29 . В кинетопласте T. cruzi половинки тРНК также были обнаружены в нестрессовых условиях 30 , но их стало больше при пищевом стрессе 24 . В то время как раскрытие физиологической роли этих фрагментов тРНК требует дальнейших специальных исследований, можно показать, что у T. cruzi эти половинки тРНК, индуцированные стрессом, накапливаются в цитоплазматических гранулах. В последующих исследованиях было показано, что определенное количество этих половинок тРНК секретируется в ростовую среду во внеклеточных везикулах 31,32 , тем самым потенциально доставляя регуляторные молекулы нкРНК к другим паразитам, а также к клеткам млекопитающих. Сходная роль упакованных в экзосомы малых молекул РНК, включая половинки тРНК, была недавно предложена у простейших паразитов рода Leishmania 33 . Аналогичное понимание tdR RNome и его предполагаемой функции у близкородственного паразита T. brucei в значительной степени отсутствует 34 . В отличие от пула половинок тРНК в T. cruz i, в котором, по-видимому, преобладают половины, происходящие только от нескольких изоакцепторов тРНК 24,30 , популяция половинок тРНК T. brucei гораздо более разнообразна (дополнительная фигура 1, дополнительные данные 1).

                  В то время как в большинстве зарегистрированных случаев биологическая роль и клеточная мишень секвенированных полумолекул тРНК оставались неясными, некоторые исследования ясно продемонстрировали функцию, связанную с реакцией на стресс. В клетках человека было показано, что индуцированная стрессом тРНК Ala 5′ наполовину ингибирует синтез белка путем секвестрации определенных факторов инициации трансляции и способствует образованию стрессовых гранул 13,28 . 3′-половина тРНК Thr , идентифицированная здесь, функционирует заметно иначе. Он вырабатывается в условиях голодания или при переходе проциклических клеток T. brucei в стационарную фазу и связывается с рибосомами и полисомами (рис. 4). Однако вместо ингибирования механизма трансляции, как это было показано для других ранкРНК 6,7,8 , эта связанная с рибосомой РНК стимулирует биосинтез белка (рис. 5). В частности, после длительного голодания, которое приводит к полной потере клеточной подвижности, вырабатывается 3′-половина тРНК Thr , которая связывается с рибосомами и стимулирует синтез белка во время фазы восстановления после стресса. Блокирование половин эндогенной тРНК Thr с помощью подхода антисмысловых олигонуклеотидов (ASO) или истощение половин тРНК Thr с помощью аффинной очистки ослабляет этот стимулирующий эффект на биосинтез белка in vivo и in vitro (рис. 6). В то время как тРНК 9Половина 0602 Thr является особой в том смысле, что это единственная 3′-половина, идентифицированная как прочная ассоциация с рибосомами (рис. 1d), структурно она не демонстрирует каких-либо очевидных особенностей по сравнению с другими идентифицированными фрагментами, происходящими от тРНК. Вышеупомянутая 5′-половина тРНК человека Ala , ингибирующая инициацию трансляции и способствующая образованию стрессовых гранул, формирует G-квадруплексы как предпосылку для ее биологической функции 35 . ТРНК T. brucei 9Однако 3′-половина 0602 Thr , похоже, не принимает структуры G-квадруплекса (дополнительная фигура 11), что намекает на другой способ действия.

                  Интересно, что в форме кровотока T. brucei , преобладающей форме паразита у хозяина-млекопитающего, эта половина тРНК присутствует в легко обнаруживаемых количествах на всех фазах роста или в стрессовых ситуациях (рис. 2). Это говорит о том, что на этой стадии жизни метаболизм T. brucei может более сильно выигрывать от присутствия этой ранкРНК. Известно, что время удвоения 9Форма кровотока 0707 T. brucei значительно короче по сравнению с формой насекомого 36 , что может быть отчасти связано со стимулирующим действием на метаболизм тРНК Thr 3′-половины. В связи с этим представляет большой интерес исследование ситуации на других стадиях жизни, а именно у неделящихся форм культивированных и метациклических трипаносом.

                  Каким образом ранкРНК может стимулировать рибосому во время производства белка с механистической точки зрения? При исследовании специфической эндогенной мРНК мы продемонстрировали усиленную ассоциацию мРНК тубулина с рибосомами в присутствии тРНК 9.0602 Thr 3′ половина (рис. 5г). Эти находки согласуются с точкой зрения, что тРНК наполовину стимулирует трансляцию, способствуя фазе инициации у T. brucei . Чтобы 3′-половина тРНК Thr выполняла эту роль in vitro и in vivo, необходимо удалить 3′-конец ССА (рис. 5а, б). Мы показали, что почти все тРНК быстро теряют свой конец ССА при голодании (дополнительная фигура 1a). В присутствии 3′-удлинений на половине, CCA или искусственно добавленных GGU эффект стимуляции трансляции теряется. Это открывает возможность прямой регуляции тРНК 9.0602 Thr 3′ половинная активность in vivo путем модулирования степени добавления/удаления хвоста 3′ CCA. Сравнение сигналов нозерн-блоттинга для 3′-половины тРНК Thr с синтетическими стандартами выявило около 2500 молекул на клетку, подвергнутую стрессу. Следовательно, 3′-половина tRNA Thr примерно на два порядка меньше, чем ожидаемый пул рибосом в T. brucei . Однако можно представить себе роль этой тРНК, наполовину действующей в режиме оборота. Наши эксперименты по аффинной очистке показали, что истощение тРНК 9Половина 0602 Thr из пула малых РНК размером от 30 до 40 нуклеотидов фактически ингибирует глобальную трансляцию (рис. 6с). Следовательно, возможно, что тРНК Thr 3′ наполовину противодействует любой ингибирующей малой РНК в этом диапазоне размеров (включая другие потенциальные РНК, происходящие от тРНК), присутствующей в стрессовой клетке. Ранее мы показали на S. cerevisiae и H. volcanii , что ранкРНК могут оказывать глобальные ингибирующие эффекты на продукцию белка in vivo, несмотря на то, что они менее распространены, чем пул рибосом 6,8 . Таким образом, хотя мы не раскрыли полный молекулярный механизм, используемый 3′-половиной тРНК Thr для усиления трансляции у T. brucei во время восстановления после стресса, наши данные совместимы со стимулирующей ролью во время загрузки мРНК (рис. 5d). ). В этом сценарии полузанятые рибосомы тРНК Thr (комплекс, который накапливается во время лишения питательных веществ (рис. 2a–c и 4b)) более эффективно возобновляют трансляцию, как только паразит сталкивается с более благоприятными условиями окружающей среды. На основании представленных гелей SDS (рис. 5a–c) тРНК 9Половина 0602 Thr , по-видимому, влияет на глобальную трансляцию, а не на конкретные мРНК.

                  Известно, что в клетках человека индуцированные стрессом половинки тРНК продуцируются ангиогенином, ферментом типа РНКазы А, который расщепляет тРНК в антикодоновой петле 25,28 . T. brucei не имеет гомолога ангиогенина, что указывает на альтернативный путь полубиогенеза тРНК у паразита. Сообщалось, что у людей и растений фрагменты РНК, производные тРНК (tdR), также могут продуцироваться Dicer, центральной эндонуклеазой механизма si/miRNA 37,38 . Поскольку T. brucei действительно обладает путем siRNA, хотя и не имеет miRNA, мы исследовали, могут ли гомологи Dicer участвовать в процессинге 3′-половины tRNA Thr . Используя РНКи против двух подобных дайсеру белков (TbDCL1 и TbDCL2), мы могли исключить эти нуклеазы как участвующие в расщеплении тРНК у T. brucei (дополнительная фигура 12). Было показано, что у дрожжей Rny1, член семейства РНКаз T2, расщепляет тРНК в антикодоновой петле во время окислительного стресса, таким образом продуцируя полумолекулы 39 . Однако гомолог Rny1 не был идентифицирован в геномах T. brucei или его близких родственников. Примечательно, что участие tdR в регуляции клеточных процессов эволюционно настолько законсервировано (его можно наблюдать во всех сферах жизни), однако в их биогенезе, по-видимому, участвует большое количество разнообразных ферментов. Следовательно, кажется, что в кинетопластидах работает совершенно другой механизм процессинга тРНК, который ждет своего открытия.

                  тРНК 93′-половина 0602 Thr , описанная здесь, является последним добавлением функциональных tdR, о которых сообщалось в последние годы. Класс tdR, который включает половинки тРНК, а также более короткие фрагменты ~14–26 нуклеотидов, первоначально был описан в клетках и организмах, подвергшихся сложным условиям роста во всех трех сферах жизни (обзоры в ссылках 40,41 ). Последующие исследования выявили tdR также в нормальных условиях, предполагая возможные функции домашнего хозяйства (ref. 42 и ссылки в них). Определенные tdR были признаны основными регуляторами клеточного метаболизма, особенно во время клеточного стресса и болезней (обзор в ссылках 9).0602 41,43 ). В отличие от др. малых регуляторов ncRNA (таких как miRNA, siRNAs или piRNAs) tdRs представляют собой структурно и функционально очень многогранный класс ncRNAs -40-. К настоящему времени идентифицированные биологические роли tdRs включают регуляцию транскрипции, трансляции, образования стрессовых гранул, апоптоза, клеточной пролиферации, РНКи, везикулярно-опосредованной межклеточной коммуникации, межпоколенческого наследования и ретротранспозиции (rev. ref. 40). Совсем недавно было обнаружено, что tdR длиной 22 нуклеотида регулирует биогенез рибосом в клетках человека, контролируя трансляцию важнейших рибосомных белков 44 . РНКи против этого tdR приводила к нарушению жизнеспособности клеток и усилению апоптоза в моделях рака человека. В большинстве зарегистрированных случаев функции tdR фрагмент тРНК, по-видимому, ингибирует клеточный процесс. 3′-половина T. brucei Thr , представленная здесь, является одним из немногих примеров, в которых tdR стимулирует клеточную функцию, такую ​​как трансляция, во время восстановления после стресса. Это еще больше диверсифицирует регуляторный потенциал tdR по сравнению с другими малыми регуляторами нкРНК. Поэтому мы не можем исключить возможность того, что T. brucei тРНК Thr 3′-половина играет дополнительную биологическую роль в паразите вне контроля трансляции. Удивительно, что молекула «предшественника» tdR, т. е. настоящая тРНК, выполняет в основном одну основную клеточную роль в качестве субстрата для механизма синтеза белка, в то время как продукты ее процессинга функционально настолько гетерогенны. Таким образом, события посттранскрипционного расщепления могут генерировать новые регуляторные молекулы, тем самым дополнительно увеличивая сложность клеточных RNome в целом и расширяя биологию тРНК в частности.

                  Методы

                  Штаммы и условия роста

                  Trypanosoma brucei проциклическая стадия (PCF) 427, 29–13 или формы кровотока New York single markers (NYSM) 45 клеточные линии использовались во всех экспериментах. Клетки проциклической стадии 427 и 29-13 выращивали при 27 °C в среде SDM-79 с добавлением 5 или 10% фетальной телячьей сыворотки (FCS), соответственно 46 . Формы кровотока (BSF) культивировали в среде HMI-9, содержащей 10% FCS, при 37 °C/5% CO 2 (арт. 47 ). Культуры собирали в фазе экспоненциального роста при плотности ниже 2 × 10 7 клеток/мл для PCF и 10 6 клеток/мл для BSF. Для стационарной фазы собирали проциклические клетки с плотностью 6–7 × 10 7 клеток/мл. Для теплового шока экспоненциально растущие клетки инкубировали 30 мин в предварительно нагретой до 41°С среде; к клеткам PCF применяли холодовой шок, инкубируя их в течение 30 мин в среде с температурой 13 °C; окислительный стресс: среда, содержащая 125 мкМ перекиси кислорода (H 2 O 2 ) в течение 1 ч. Если не указано иное, к клеткам PCF применяли питательный стресс, инкубируя их в течение 2 ч в 1x PBS (фосфатно-солевой буфер) при 27°C. Пищевой стресс BSF включал инкубацию в течение 1 ч в 1x PBS при 37°C. Клеточная линия, экспрессирующая эндогенную копию DHh2 с N-концевой меткой (eYFP), была сконструирована с использованием плазмиды, любезно предоставленной Kramer and Carrington 15 . Трансфекцию, клонирование и отбор трансгенных проциклических клеток 427 проводили, как описано 9.0602 48 .

                  Подготовка библиотеки RancRNA и биоинформатический анализ

                  Малые РНК, связанные с рибосомами, выделяли, как описано 49 . Библиотеку кДНК готовили с использованием набора для подготовки библиотеки малых РНК TruSeq ( Illumina ) и секвенировали с использованием платформы Illumina HiSeq 2000. Биоинформатический анализ проводили, как описано Luidalepp et al. 50 , за исключением четырех несоответствий. Перекрывающиеся пары прочтений были соединены с использованием Pandaseq 9.0602 51 . Затем чтения были картированы с эталонным геномом T. brucei TREU927, полученным из TriTrypDB 52 с использованием STAR 53 . Аннотация генома в версии 32 TriTrypDB была дополнена предсказанием гена тРНК с использованием tRNAscan-SE 54 , а характеристики транскрипта были расширены на 50 нуклеотидов вверх и вниз по течению, чтобы включить области предшественников тРНК. Впоследствии было извлечено сопоставление прочтений в аннотированных транскриптах, а предполагаемые продукты обработки были идентифицированы с помощью модифицированной версии конвейера APART 9.0602 10 . В частности, для идентификации событий процессинга РНК вместо контигов, состоящих из перекрывающихся чтений, использовались блоки считывания, определенные с использованием алгоритма блокбастера 55 . Нормализация уровней экспрессии в образцах была выполнена с использованием пакета Bioconductor и edgeR 56 . Статистический анализ проводился в среде R. Все прочтения секвенирования были отправлены в Европейский архив нуклеотидов (ENA), и к ним можно получить доступ по номеру PRJEB249.15.

                  Электропорация проциклического

                  T. brucei клеток

                  Экспоненциальное выращивание 427 клеток (4,5 × 10 7 ) собирали центрогированным (1400 × г на 10 мин. На 4 ° С) и сзади 1 мл 1 мл 1 мл 1 мл. ледяного 1x Cytomix (25 мМ HEPES/KOH, pH 7,6, 10 мМ K 2 HPO 4 , 120 мМ KCl, 0,15 мМ CaCl 2 , 5 мМ TA 2 MgCl ). Клетки промывали 1 мл 1x Cytomix, ресуспендировали в 190 мкл 1x Cytomix и смешивали с 500 пмоль половины тРНК, транскрибированной in vitro, в 1x буфере для отжига (10 мМ Tris-HCl; pH 7,6, 80 мМ MgCl 9).0683 2 ) до конечного объема 200 мкл. Смесь подвергали электропорации дважды с использованием генетического импульсного генератора Bio-Rad II (1,2 кВ, 25 мкФ и 0 Ом) в кювете для электропорации диаметром 4 мм (EP-104, Cell Projects Ltd ). Наконец, проциклические клетки T. brucei ресуспендировали с 1 мл SDM-79 (5% FCS) и переносили в предварительно нагретую 3 мл среду для восстановления в течение 2 часов при 27 °C. Следующие нити РНК были получены с помощью транскрипции in vitro с использованием РНК-полимеразы T7 57,58 и впоследствии введены с помощью этого подхода в T. brucei : Thr_(AGU)-3′-half + CCA: 5′ AAGACGGAGGUCGGGGGUUCGAUCCCCCCAGUGGCCUCCA 3′, Thr_(AGU)-3′-half-CCA: 5′ AAGACGGAGGUCGGGGGUUCGAUCCCCCCAGUGGCCU 3′, Thr_(AGU)-3’half + GGU: 5′ AAGACGGAGGUCGGGGGUUCGAUCCCCCCAGUGGCCUGGU 3′, Thr_(AGU)-5′-половина: 5′ GGCCGCUUAGCUCAAUGGCAGAGCGCCGUCCUAGU 3′. Используемая 5′-половина тРНК Ala представляла собой синтетический олигонуклеотид ( Microsynth ) с последовательностью Ala_(CGA)-5′-половина: 5′ GGGGAUGUAGCUCAGAUGGUAGAGCGCCCGCUUAGC 3′.

                  Метаболическая маркировка

                  Активность трансляции в T. brucei отслеживали с помощью метаболического мечения. 4,5 × 10 7 проциклических клеток подвергали электропорации с половинками тРНК (500 пмоль), как описано выше, оставляли восстанавливаться в течение 2 часов при нормальных условиях роста и, наконец, подвергали стрессу путем инкубации в 1x PBS. После 2-часового пищевого стресса клетки снова собирали (см. выше) и ресуспендировали в 750 мкл предварительно нагретой среды. 1/3 или клетки использовали для выделения РНК и последующего обнаружения электропорированных половин тРНК с помощью нозерн-блоттинга. Остальные 2/3 клеток смешивали с 250 мкл SDM-79.(5% FCS), содержащие 2 мкл L- 35 S-метионина (10 мкКи/мк, Hartmann Analytic ), и инкубировали в течение 60 мин при 27°С. После метаболического мечения клетки собирали, ресуспендировали в 1х буфере Лэммли и белки разделяли с помощью 10% SDS-PAGE. Включение радиоактивно меченого метионина измеряли методом фосфорной визуализации. Метаболическое мечение в H. volcanii и S. cerevisiae проводили, как описано ранее 6,8 .

                  Инактивация тРНК

                  Thr 3′-половину АСО

                  Для блокирования эндогенной тРНК Thr 3′-половину использовали модифицированные АСО (ASO_a: mG*mA*mA*mC*mC*C*C*C*C*G*A *C*C*T*C*C*mG*mT*mC*mT*mT и ASO_b mA*mG*mG*mC*mC*A*C*T*G*G*G*G*G*G* A*mT*mC*mG*mA*mA, Qiagen ). В качестве контроля специфичности использовали аналогичную цепь ASO с совершенно неродственной последовательностью (ASO_ctr: mG*mU*mA*mU*mU*T*A*C*A*A*T*T*G*A*C*mG*mU *mA*mU*mA. Все ASO были сконструированы как РНК/ДНК/РНК-химеры с фосфоротиоатным остовом (звездочки). Десять центральных дезоксирибонуклеотидов окружены пятью 2′-O-метил-модифицированными рибонуклеотидами. 500 пмоль ASO подвергали электропорации. в 4,5 × 10 7 кл. После двух часов восстановления в нормальных средах в течение четырех часов применяли питательный стресс, и в течение двухчасового периода восстановления оценивали глобальную трансляцию с помощью метаболической маркировки, как описано.

                  Препарат клеточного экстракта

                  Клетки, выращенные в различных условиях, собирали (см. выше) и клеточный осадок (1–3 × 10 9 клеток) ресуспендировали в 500 мкл рибосомного буфера А (120 мМ KCl, 20 мМ Трис/HCl). рН 7,6, 2 мМ MgCl 2 , 1 мМ ДТТ), содержащий 20 мМ рибонуклеозид-ванадилового комплекса (RVC, Bioconcept ) и 2,5 мкл RiboLock (40 ЕД/мкл, Thermo Scientific ) и мгновенной заморозки. Образцы пропускали 10 раз через иглу 25G и 10 раз через иглу 27G, экстракты очищали центрифугированием. Экстракты клеток разделяли на аликвоты, быстро замораживали и хранили при температуре -80°С до использования.

                  T. brucei трансляция in vitro

                  Одна трансляционная реакция in vitro общим объемом 30 мкл состоит из 6 мкл «переводной смеси» и 24 мкл «пробной смеси». 6 мкл трансляционной смеси содержали 3 мкл 10 x трансляционного коктейля (100 мМ Hepes/KOH, pH 7,4, 15 мМ Mg(OAc) 2 , 750 мМ KOAc, 4 мМ GTP, 10 мМ АТФ, 500 мкМ каждой аминокислоты, кроме метионина), 0,5 мкл Mg(OAc) 2 (100 мМ), 0,5 мкл креатинфосфокиназы мл, Roche ), 1 мкл креатинфосфата (0,6 М) и 1 мкл L- 35 S-метионина (10 мкКи/мкл). Смесь образцов объемом 24 мкл состояла из 3 мкл ДМСО, 7 мкл 90 707 клеточного экстракта T. brucei (экстракт приготовлен, как описано выше, и этот объем соответствует 2–4   × 10 90 602 7 90 603 клеточных эквивалентов), содержащего 20 мМ RVC, 7,5 мкл. рибосомный буфер B (120 мМ KCl, 20 мМ Трис/HCl, pH 7,6, 8 мМ MgCl 2 ), половинки тРНК по 500 пмоль в буфере для отжига (10 мМ Трис/HCl, pH 7,6 и 20 мМ NaCl). Реакция начиналась путем объединения трансляционной смеси со смесью образцов и продолжалась в течение 20 мин при 27°С. Реакцию останавливали добавлением 1х буфера Лэммли и инкубацией при 95°С в течение 2 мин. Затем белки разделяли на 10% геле SDS-PAGE и включение метионина контролировали с помощью фосфорной визуализации. Для тестирования 3′-половины тРНК Asp (антикодон GUC) во время трансляции in vitro использовали транскрибированную in vitro цепь РНК 5′ CACGCGGGUGACCCGGGUUCAAUUCCCGGCCGGGAAGCCA 3′, как указано выше. Чтобы проверить эффект эндогенной тРНК Thr 3′ половина 5 мкл (~ 1 пмоль) аффинно очищенных образцов (или эквивалентный объем соответствующего проточного) использовали с 3,5 мкл клеточного экстракта, приготовленного с RVC, 2,5 мкл рибосомного буфера B в общем объеме 10 мкл. Затем добавляли 3 мкл трансляционной смеси. Реакцию инкубировали и останавливали, как описано выше.

                  Для оценки ассоциации мРНК с рибосомой T. brucei проводили эквивалент четырех реакций трансляции in vitro (с использованием холодного L-метионина), как описано выше, и останавливали через 5 или 20 минут добавлением циклогексимида (конечная концентрация 100 мкг/мл). Образцы загружали на 800 мкл 1,1 М сахарозной подушки, приготовленной в рибосомном буфере А, содержащем 1 мМ ДТТ и 100 мкг/мл циклогексимида. После центрифугирования (2,5 ч при 200 000 ×  г , 4 °C) извлекали супернатант (S100), 2,5 об. Добавляли 100% этанол и инкубировали в течение ночи при -20°С. Образцы центрифугировали (16 000 ×  г , 45 мин, 4 °C), осадок ресуспендировали в 1 мл тризола и экстрагировали РНК в соответствии с инструкциями производителя. РНК также экстрагировали из фракции осадка (P100) на стадии центрифугирования 200 000 ×  г (см. выше) с использованием тризола и использовали для нозерн-блоттинга мРНК (см. ниже).

                  Аффинная очистка тРНК

                  Thr 3′-половина

                  Для аффинной очистки эндогенной тРНК Thr половину клеточных лизатов, полученных из клеток, подвергшихся питательному стрессу, сначала инкубировали в течение 1 часа при комнатной температуре перед выделением тотальной РНК. Гибридизацию с комплементарной цепью ДНК проводили путем инкубации 1 мкл (100 пмоль) 3′-концевого биотинилированного антисмыслового олигонуклеотида ДНК (биот-АСО) с 5 мкг выбранной по размеру (30–40 нт) тотальной РНК в 100 мкл 5x буфер SSC (750 мМ NaCl, 75 мМ тринатрийцитрат). Образец денатурировали в течение 3 мин при 90 °C с последующей гибридизацией в течение 10 мин при 65 °C. Гибрид РНК-ДНК иммобилизовали на предварительно промытых стрептавидиновых магнитных гранулах (25 мкл, Roche Diagnostics ) и инкубировали в течение 30 мин при комнатной температуре с вращением. Супернатант, содержащий несвязанный пул РНК (проточный), удаляли и сохраняли для использования в будущем. Гранулы промывали один раз 50 мкл 1 х SSC буфера и 3 раза 50 мкл 0,1 х SSC буфера. Половину тРНК Thr элюировали путем нагревания гранул в 100 мкл воды при 75°С в течение 3 мин. Загрязняющие биот-АСО удаляли обработкой ДНКазой I ( Thermo Scientific ). Половину аффинно очищенной тРНК экстрагировали с использованием Roti®-Aqua-P/C/I ( Roth ). Наконец, проточную РНК и половину аффинно очищенной тРНК осаждали 2,5 объемами 100% EtOH при -20°C в течение ночи. Образцы промывали 70% EtOH и ресуспендировали в 15 мкл воды. Для проверки качества процедуры аффинной очистки 200 нг РНК загружали в денатурирующий 8% полиакриламидный гель с последующим нозерн-блоттингом. Последовательность олигонуклеотида комплементарной ДНК (биот-АСО), использованного для аффинной очистки, была следующей:0707 Микросинтез ). Был добавлен 3′-выступ AAA для лучшего связывания с шариками. В качестве контроля всю процедуру аффинной очистки проводили и в отсутствие биот-АСО.

                  Профилирование полисом

                  Для профилирования полисом клеточные экстракты готовили, как описано ранее, без добавления RVC из экспоненциально растущих клеток или клеток, подвергшихся питательному стрессу. 50–100 OD 260 клеточного экстракта наносили поверх градиента 10–40% (масса/объем) сахарозы, приготовленного в рибосомном буфере А, в пробирках SW 32Ti (пробирки Beckman Polyallomer Centrifuge 25 × 89).мм). Градиенты центрифугировали в роторе Beckman SW 32Ti (6 ч при 25 000 об/мин при 4°С). Градиенты откачивали и фракции собирали каждые 16 с, постоянно контролируя поглощение при 260 нм. Для последующего нозерн-блоттинга нужные фракции объединяли и осаждали EtOH перед экстракцией РНК 1 мл реагента TRI ( Zymo Research ). Для приготовления 80S рибосом фракции, содержащие моносомы, объединяли в пробирки из полиалломера Beckman Optiseal (объем 32,4 мл) и заполняли 1x рибосомным буфером А.0707 г  ) в течение 17 ч при 4 °C (тип ротора 60 Ti, Beckman ). После центрифугирования осадок ресуспендировали в 200 мкл рибосомного буфера А. Концентрацию рибосом определяли по поглощению при 260 нм (1 A 260  = 18 пмоль 80S).

                  Нозерн-блоттинг

                  Для нозерн-блоттинга 3–40 мкг общей РНК, экстрагированной с помощью реагента TRI ( Zymo Research ) в соответствии с протоколом производителя, дополняли 1 объемом 2x РНК-загрузочного красителя и разделяли на 8% денатурирующем полиакриламиде. гель (7M мочевина, в 1x буфере TBE). Затем гель подвергали электроблотингу на нейлоновой мембране (Amersham Hybond N 9).0602 + , GE Healthcare ), как описано 7 . Полный список используемых олигонуклеотидов ДНК см. в дополнительных методах.

                  Для нозерн-блоттинга мРНК тубулина 1,6–3,1 мкг РНК фракций S100 и 4,4–6,0 мкг РНК P100 (см. процедуру трансляции in vitro выше) анализировали на 1% агарозном геле в 20 мМ буфере MOPS (pH 7,0), содержащем 1,5% формальдегид. Затем РНК наносили на нейлоновую мембрану (Amersham Hybond N + , GE Healthcare 9).0632) пассивным переносом. ДНК-зонды готовили из гель-очищенных ПЦР-продуктов гена тубулина и радиоактивно метили с использованием протокола мечения Prime-a-Gene ( Promega ). 2,5 мкл смеси статистических гексамеров (100 мкМ; Thermo ) и 5 ​​нг продукта ПЦР в общем объеме 17,5 мкл нагревали до 95 °С в течение пяти минут для диссоциации двухцепочечной ДНК. После повторного отжига случайные гексамерные праймеры были расширены 1,5 мкл полимеразы Кленова (3 ед.) путем добавления 2,5 мкл буфера Кленова, 1 мкл dNTP (конечная концентрация dATP, dTTP, dGTP 20 мкМ), 2,5 мкл [α- 32 P]CTP на 1 ч при 37 °C. Реакцию останавливали добавлением 2 мкл 0,5 М ЭДТА и 70 мкл H 2 O. Нозерн-блот-зонд нагревали до 95°C в течение пяти минут и затем добавляли к прегибридизированной мембране. См. дополнительные рисунки 13–17 для необрезанных пятен и полноразмерных гелей.

                  Вестерн-блот-анализ

                  Фракции (16 s) были собраны из эксперимента по профилированию полисом экспоненциального или подвергнутого стрессу PBS клеточного лизата, меченного DHh2-YFP (60 OD 260 клеточный экстракт на градиент). Десять микролитров каждой третьей фракции смешивали с 2x буфером Лэммли, денатурировали при 95°С в течение 2 мин, загружали в гель 10% SDS-PAGE и анализировали в течение 1 ч при 160° В. Гель переносили на нитроцеллюлозную мембрану ( Amersham Biosciences ) и блокировали на 1 час в 1x PBS, содержащем 0,1% Tween-20, в 5% обезжиренном сухом молоке. Мембраны инкубировали с мышиным антителом против GFP (1:1000, Roche; , номер по каталогу: 1181446000 1 ) при 4 °C в течение ночи. После промывки (3 ×10 мин каждый с 1 x PBS, 0,1% Tween-20) были добавлены вторичные антитела, конъюгированные с пероксидазой хрена, на 1 ч при комнатной температуре (1:3000; 9). 0707 Рош ). Мембраны промывали, как и раньше, и результаты визуализировали с использованием субстрата максимальной чувствительности SuperSignal West Femto с усиленной хемилюминесценцией ( ThermoFisher Scientific ).

                  Исследования связывания in vitro

                  Исследования связывания тРНК Thr 3′-половину с рибосомными частицами, очищенными от подвергшихся стрессу или не подвергнутых стрессу клеток (как описано выше), проводили с использованием метода дот-блоттинга. Для анализа связывания с фильтром 5  пмоль T. brucei 80S рибосомы инкубировали с 1 мкл 5′-[ 32 P]-концевой меченной тРНК Thr наполовину (4 пмоль/мкл) в 25 мкл рибосомного буфера В в течение 30 мин при 27°С. После инкубации реакционные смеси фильтровали через нитроцеллюлозную мембрану (диаметр 0,45 мкМ) с использованием вакуумного устройства с последующими двумя этапами промывки ледяным буфером B. Мембраны выставляли на экраны для получения фосфорных изображений в течение 1 ч и количественно определяли с помощью фосфоимиджера.

                  Сводка отчетов

                  Дополнительную информацию о планах экспериментов можно найти в сводке отчетов об исследованиях в природе, связанной с этой статьей.

                  Доступность данных

                  Все данные секвенирования, полученные в этом исследовании, были депонированы в Европейском архиве нуклеотидов (ENA), и к ним можно получить доступ под номером PRJEB24915. Все остальные данные можно получить у соответствующих авторов по запросу. Сводка отчетов для этой статьи доступна в виде файла с дополнительной информацией.

                  Ссылки

                  1. Fenn, K. & Matthews, K.R. Клеточная биология дифференцировки Trypanosoma brucei. Курс. мнение микробиол. 10 , 539–546 (2007).

                    КАС Статья Google ученый

                  2. Clayton, CE Экспрессия генов в кинетопластидах. Курс. мнение микробиол. 32 , 46–51 (2016).

                    КАС Статья Google ученый

                  3. Паленчар, Дж. Б. и Беллофатто, В. Транскрипция генов в трипаносомах. Мол. Биохим. Паразитол. 146 , 135–141 (2006).

                    КАС Статья Google ученый

                  4. Чуди, К., Ши, Х., Франклин, Дж. Б. и Уллу, Э. Небольшие интерферирующие РНК-продуцирующие локусы у древней паразитической эукариоты Trypanosoma brucei. BMC Геном. 13 , 427 (2012).

                    КАС Статья Google ученый

                  5. Vasquez, J. J., Hon, C. C., Vanselow, J. T., Schlosser, A. & Siegel, T. N. Сравнительное профилирование рибосом выявляет обширную трансляционную сложность на разных стадиях жизненного цикла Trypanosoma brucei. Рез. нуклеиновых кислот. 42 , 3623–3637 (2014).

                    КАС Статья Google ученый

                  6. Gebetsberger, J., Zywicki, M., Kunzi, A. & Polacek, N. Фрагменты тРНК нацелены на рибосому и функционируют как регуляторная некодирующая РНК у Haloferax volcanii. Археи 2012 , 260909 (2012).

                    Артикул Google ученый

                  7. Пирчер А., Баковска-Живицка К., Шнайдер Л., Живицкий М. и Полачек Н. Некодирующая РНК, полученная из мРНК, нацелена на рибосому и регулирует ее. Мол. Cell 54 , 147–155 (2014).

                    КАС Статья Google ученый

                  8. Пирчер А., Гебетсбергер Дж. и Полачек Н. Ассоциированные с рибосомами нкРНК: новый класс регуляторов трансляции. РНК Биол. 11 , 1335–1339 (2014).

                    Артикул Google ученый

                  9. Живицки М., Баковска-Живицка К. и Полачек Н. Выявление стабильных продуктов процессинга малых РНК, ассоциированных с рибосомами, с помощью анализа данных глубокого секвенирования. Рез. нуклеиновых кислот. 40 , 4013–4024 (2012).

                    КАС Статья Google ученый

                  10. Чех А., Венде С., Морл М., Пан Т. и Игнатова З. Обратимая и быстрая дезактивация транспортной РНК как механизм репрессии трансляции при стрессе. Генетика PLoS. 9 , e1003767 (2013).

                    КАС Статья Google ученый

                  11. Emara, M.M. et al. Стресс-индуцированные РНК, производные ангиогенин-индуцированной тРНК, способствуют индуцированной стрессом сборке стрессовых гранул. J. Biol. хим. 285 , 10959–10968 (2010).

                    КАС Статья Google ученый

                  12. Lyons, S.M., Achorn, C., Kedersha, N.L., Anderson, P.J. & Ivanov, P. YB-1 регулирует индуцированное tiRNA образование стрессовых гранул, но не репрессию трансляции. Рез. нуклеиновых кислот. 44 , 6949–6960 (2016).

                    КАС Статья Google ученый

                  13. Mahboubi, H. & Stochaj, U. Цитоплазматические стрессовые гранулы: динамические модуляторы клеточных сигналов и заболеваний. Биохим. Биофиз. Acta 1863 , 884–895 (2017).

                    КАС Статья Google ученый

                  14. Kramer, S. et al. Тепловой шок вызывает уменьшение количества полисом и появление стрессовых гранул в трипаносомах независимо от фосфорилирования eIF2(альфа) по Thr169. . Дж. Сотовый. науч. 121 , 3002–3014 (2008 г.).

                    КАС Статья Google ученый

                  15. Best, A., Handoko, L., Schluter, E. & Goringer, H.U. Синтезированные in vitro малые интерферирующие РНК вызывают интерференцию РНК в африканских трипаносомах: анализ in vitro и in vivo. J. Biol. хим. 280 , 20573–20579 (2005 г.).

                    КАС Статья Google ученый

                  16. Ngo, H., Tschudi, C., Gull, K. & Ullu, E. Двухцепочечная РНК индуцирует деградацию мРНК у Trypanosoma brucei. Проц. Натл акад. науч. США 95 , 14687–14692 (1998).

                    ОБЪЯВЛЕНИЕ КАС Статья Google ученый

                  17. Nachtergaele, S. & He, C. Новая биология посттранскрипционных модификаций РНК. РНК Биол. 14 , 156–163 (2017).

                    Артикул Google ученый

                  18. Тьюринг К., Шмид К., Келлер П. и Хелм М. Анализ модификаций РНК с помощью жидкостной хроматографии и тандемной масс-спектрометрии. Methods 107 , 48–56 (2016).

                    Артикул Google ученый

                  19. Rubio, M. A. et al. Редактирование и метилирование в одном сайте функционально взаимозависимыми действиями. Природа 542 , 494–497 (2017).

                    ОБЪЯВЛЕНИЕ КАС Статья Google ученый

                  20. Hashem, Y. et al. Структура криоэлектронной микроскопии высокого разрешения рибосомы Trypanosoma brucei. Природа 494 , 385–389 (2013).

                    ОБЪЯВЛЕНИЕ КАС Статья Google ученый

                  21. Gunzl, A. Механизм сплайсинга пре-мРНК трипаносом: сложный или упрощенный? Эукариот. Cell 9 , 1159–1170 (2010).

                    КАС Статья Google ученый

                  22. Garcia-Silva, M. R. et al. Популяция малых РНК, полученных из тРНК, активно продуцируется в Trypanosoma cruzi и рекрутируется в специфические цитоплазматические гранулы. Мол. Биохим. Паразитол. 171 , 64–73 (2010).

                    КАС Статья Google ученый

                  23. Ли, С. Р. и Коллинз, К. Вызванное голоданием расщепление антикодоновой петли тРНК у Tetrahymena thermophila. J. Biol. хим. 280 , 42744–42749 (2005 г.).

                    КАС Статья Google ученый

                  24. Fu, H. et al. Стресс индуцирует расщепление тРНК ангиогенином в клетках млекопитающих. ФЭБС Письмо. 583 , 437–442 (2009).

                    КАС Статья Google ученый

                  25. Ямасаки С., Иванов П., Ху Г. Ф. и Андерсон П. Ангиогенин расщепляет тРНК и способствует индуцированной стрессом репрессии трансляции. J. Cell Biol. 185 , 35–42 (2009).

                    КАС Статья Google ученый

                  26. Thompson, D.M., Lu, C., Green, P.J. & Parker, R. Расщепление тРНК представляет собой консервативный ответ на окислительный стресс у эукариот. РНК 14 , 2095–2103 (2008).

                    КАС Статья Google ученый

                  27. Bayer-Santos, E., Lima, F.M., Ruiz, J.C., Almeida, I.C. & da Silveira, J.F. Характеристика содержания малых РНК во внеклеточных везикулах Trypanosoma cruzi. Мол. Биохим. Паразитол. 193 , 71–74 (2014).

                    КАС Статья Google ученый

                  28. Garcia-Silva, M. R. et al. Внеклеточные везикулы, выделяемые Trypanosoma cruzi, связаны с путями малых РНК, регуляцией жизненного цикла и восприимчивостью к инфекции клеток млекопитающих. Паразитол. Рез. 113 , 285–304 (2014).

                    Артикул Google ученый

                  29. Lambertz, U. et al. Малые РНК, полученные из тРНК и рРНК, сильно обогащены экзосомами Leishmania как старого, так и нового мира, что свидетельствует о консервативной упаковке экзосомальной РНК. БМС Геном. 16 , 151 (2015).

                    Артикул Google ученый

                  30. Zheng, L.L. et al. Сравнительный транскриптомный анализ малых некодирующих РНК разных стадий Trypanosoma brucei. РНК 19 , 863–875 (2013).

                    КАС Статья Google ученый

                  31. Лайонс С.М., Гуданис Д., Койн С.М., Гданец З. и Иванов П. Идентификация функциональных тетрамолекулярных РНК G-квадруплексов, полученных из транспортных РНК. Нац. коммун. 8 , 1127 (2017).

                    ОБЪЯВЛЕНИЕ Статья Google ученый

                  32. Смит, Т. К., Бринго, Ф., Нолан, Д. П. и Фигейредо, Л. М. Метаболическое перепрограммирование во время жизненного цикла Trypanosoma brucei. F1000Res . 6 , 683 (2017). https://doi.org/10.12688/f1000research.10342.2.

                  33. Martinez, G., Choudury, S.G. & Slotkin, R.K. Малые РНК, полученные из тРНК, нацелены на транскрипты мобильных элементов. Рез. нуклеиновых кислот. 45 , 5142–5152 (2017).

                    КАС Статья Google ученый

                  34. Томпсон, Д. М. и Паркер, Р. РНКаза Rny1p расщепляет тРНК и способствует гибели клеток во время окислительного стресса у Saccharomyces cerevisiae. J. Cell Biol. 185 , 43–50 (2009).

                    КАС Статья Google ученый

                  35. Кристодеро, М. и Полачек, Н. Многогранный регуляторный потенциал фрагментов, полученных из тРНК. Исследование некодирующих РНК 1 , 7 (2017).

                  36. Gebetsberger, J. & Polacek, N. Нарезка тРНК для повышения функционального разнообразия нкРНК. РНК Биол. 10 , 1798–1806 (2013).

                    КАС Статья Google ученый

                  37. Cognat, V. et al. Популяция ядерных и органелларных фрагментов РНК, полученных из тРНК, у Arabidopsis thaliana очень динамична. Рез. нуклеиновых кислот. 45 , 3460–3472 (2017).

                    КАС Статья Google ученый

                  38. Соарес, А. Р. и Сантос, М. Открытие и функция фрагментов, полученных из транспортной РНК, и их роль в заболевании. Междисциплинарная редакция Wiley RNA 8 , e1423 (2017). https://doi.org/10.1002/wrna.1423.

                  39. Kim, H.K. et al. Малая РНК, полученная из транспортной РНК, регулирует биогенез рибосом. Природа 552 , 57–62 (2017).

                    ОБЪЯВЛЕНИЕ КАС Статья Google ученый

                  40. Виртц, Э., Лил, С., Очатт, К. и Кросс, Г. А. Строго регулируемая индуцируемая система экспрессии для условного нокаута генов и доминантно-негативной генетики у Trypanosoma brucei. Мол. Биохим. Паразитол. 99 , 89–101 (1999).

                    КАС Статья Google ученый

                  41. Брун, Р. и Шоненбергер. Культивирование и клонирование in vitro или проциклические культуральные формы Trypanosoma brucei в полуопределенной среде. Краткое сообщение. Акта Троп. 36 , 289–292 (1979).

                    КАС пабмед Google ученый

                  42. Hirumi, H. & Hirumi, K. Непрерывное культивирование форм кровотока Trypanosoma brucei в среде, содержащей низкую концентрацию сывороточного белка без питающих клеточных слоев. Ж. Паразитол. 75 , 985–989 (1989).

                    КАС Статья Google ученый

                  43. Беверли, С. М. и Клейтон, К. Э. Трансфекция Leishmania и Trypanosoma brucei путем электропорации. Методы Мол. биол. 21 , 333–348 (1993).

                    КАС пабмед Google ученый

                  44. Гебетсбергер Дж., Фрикер Р. и Полачек Н. Создание библиотеки кДНК для анализа малых РНК методом высокопроизводительного секвенирования. Методы Мол. биол. 1296 , 139–149 (2015).

                    КАС Статья Google ученый

                  45. Luidalepp, H., Berger, S., Joss, O., Tenson, T. & Polacek, N. Отключение рибосом путем фрагментации 16S рРНК в стационарной фазе Escherichia coli. Дж. Мол. биол. 428 , 2237–2247 (2016).

                    КАС Статья Google ученый

                  46. Aslett, M. et al. TriTrypDB: функциональный геномный ресурс для Trypanosomatidae. Рез. нуклеиновых кислот. 38 , Д457–Д462 (2010).

                    КАС Статья Google ученый

                  47. Добин А. и др. STAR: сверхбыстрый универсальный выравниватель RNA-seq. Биоинформатика 29 , 15–21 (2013).

                    КАС Статья Google ученый

                  48. Лоу, Т. М. и Эдди, С. Р. tRNAscan-SE: программа для улучшенного обнаружения генов транспортной РНК в геномной последовательности. Рез. нуклеиновых кислот. 25 , 955–964 (1997).

                    КАС Статья Google ученый

                  49. Лангенбергер, Д. и др. Доказательства существования РНК с компенсацией микроРНК человека в данных секвенирования малых РНК. Биоинформатика 25 , 2298–2301 (2009).

                    КАС Статья Google ученый

                  50. Робинсон, М. Д., Маккарти, Д. Дж. и Смит, Г. К. edgeR: пакет Bioconductor для дифференциального анализа экспрессии данных цифровой экспрессии генов. Биоинформатика 26 , 139–140 (2010).

                    КАС Статья Google ученый

                  51. Эрлахер, М. Д., Чиркова, А., Фогеле, П. и Полачек, Н. Создание химически сконструированных рибосом для исследований атомного мутагенеза биосинтеза белков. Нац. протокол 6 , 580–592 (2011).

                    КАС Статья Google ученый

                  52. Благодарности

                    Мы благодарим Изабель Родити за конструкции миРНК, нацеленные на TbDCL1 и TbDCL2, Марка Кэррингтона и Сюзанну Крамер за конструкции DHh2, Анну Стокер за экспериментальную помощь во время ее бакалаврского проекта, Юлию Гонских и Бернда Шиман за помощь. с трансляцией HeLa in vitro и северянами мРНК соответственно. Мы благодарим Юлию Ройтер за опыт работы с дрожжами. Работа была в основном поддержана NCCR «RNA & Disease», финансируемой Швейцарским национальным научным фондом. Благодарим за дополнительную поддержку гранта Швейцарского национального научного фонда 31003A_166527 [для Н.П.].

                    Информация об авторе

                    Примечания автора

                    1. Эти авторы внесли равный вклад: Роджер Фрикер, Ребекка Брогли.

                    Авторы и аффилированные лица

                    1. Кафедра химии и биохимии, Бернский университет, Freiestrasse 3, 3012, Берн, Швейцария

                      Роджер Фрикер, Ребекка Брогли, Ханнес Йохель, Ханнес Йохель, Фаливер Мисна Висс, Шнайдер, Марина Кристодеро и Норберт Полачек

                    2. Высшая школа клеточных и биомедицинских наук, Бернский университет, 3012, Берн, Швейцария

                      Роджер Фрикер, Ребекка Брогли, Леандер Висс и Мишель Фаснахт

                    3. Кафедра вычислительной биологии, Институт молекулярной биологии и биотехнологии, Адам Университет Мицкевича, Умультовска 89, 61-614, Познань, Польша

                      Марек Живицки

                    4. Институт фармации и биохимии, Университет им. Иоганна Гутенберга, Майнцский университет, Штаудингервег 5, D-55128, Майнц, Германия

                      Марк Хелм

                    Авторы

                    1. Роджер Фрикер

                      Посмотреть публикации автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    2. Rebecca Brogli

                      Просмотр публикаций автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    3. Hannes Luidalepp

                      Просмотр публикаций автора

                      Вы также можете искать этого автора в PubMed Google Академия

                    4. Leander Wyss

                      Просмотр публикаций автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    5. Michel Fasnacht

                      Посмотреть публикации автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    6. Oliver Joss

                      Просмотр публикаций автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    7. Marek Zywicki

                      Просмотр публикаций автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    8. Mark Helm

                      Посмотреть публикации автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    9. André Schneider

                      Просмотр публикаций автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    10. Марина Кристодеро

                      Просмотр публикаций автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    11. Norbert Polacek

                      Просмотр публикаций автора

                      Вы также можете искать этого автора в PubMed Google Scholar

                    Contributions

                    R. F. и Р. Б. провели большую часть экспериментов и проанализировали данные. М.Ф. и Л.В. участвовал в экспериментах по метаболической маркировке. М.З. и HL провели биоинформатический анализ. Р.Б., М.К. и О.Дж. выполнил все эксперименты для исправленной версии этой работы. М.Х. выполнили и проанализировали эксперименты ЖХ-МС/МС. В КАЧЕСТВЕ. при условии T. brucei экспертизы, проанализировали данные и прокомментировали рукопись. Н.П. задумал исследование и вместе с М.К. разработал эксперименты, руководил исследованием, проанализировал данные и написал окончательную версию рукописи.

                    Авторы переписки

                    Переписка с Марина Кристодеро или Норберт Полачек.

                    Заявление об этике

                    Конкурирующие интересы

                    Авторы не заявляют об отсутствии конкурирующих интересов.

                    Дополнительная информация

                    Примечание издателя: Springer Nature остается нейтральной в отношении юрисдикционных претензий в опубликованных картах и ​​институциональной принадлежности.

                    Дополнительная информация

                    Дополнительная информация

                    Файл рецензирования

                    Описание дополнительных дополнительных файлов

                    СОЗВОДИТЕЛЬНЫЕ ДАННЫЕ 1

                    9000.

                    СОЗДАНИЕ ДАННЫ 1

                    9000.

                    .0655

                    Открытый доступ Эта статья находится под лицензией Creative Commons Attribution 4.0 International License, которая разрешает использование, совместное использование, адаптацию, распространение и воспроизведение на любом носителе или в любом формате при условии, что вы укажете автора(ов) оригинала. и источник, предоставьте ссылку на лицензию Creative Commons и укажите, были ли внесены изменения. Изображения или другие сторонние материалы в этой статье включены в лицензию Creative Commons для статьи, если иное не указано в кредитной строке материала. Если материал не включен в лицензию Creative Commons статьи, а ваше предполагаемое использование не разрешено законом или выходит за рамки разрешенного использования, вам необходимо получить разрешение непосредственно от правообладателя. Чтобы просмотреть копию этой лицензии, посетите http://creativecommons.org/licenses/by/4.0/.

                    Перепечатка и разрешения

                    Об этой статье

                    Дополнительная литература

                    • Малая РНК, полученная из транспортной РНК: новая малая некодирующая РНК, играющая ключевую роль в развитии рака

                      • Синьлян Гу
                      • Ю Чжан
                      • Шаоцин Цзюй

                      Экспериментальная гематология и онкология (2022)

                    • Фрагмент тРНК TRF365 регулирует метаболизм клеток передней крестообразной связки путем нацеливания на IKBKB

                      • Дайанбо Лонг
                      • Иян Сюй
                      • Ян Кан

                      Обнаружение гибели клеток (2022)

                    • piRNA-подобные малые РНК нацелены на мобильные элементы паразитической нематоды Clade IV

                      • Мона Сулейман
                      • Аска Коносу
                      • Вики Л. Хант

                      Научные отчеты (2022)

                    • Изучение расширяющейся вселенной малых РНК

                      • Цзюньчао Ши
                      • Тун Чжоу
                      • Ци Чен

                      Nature Cell Biology (2022)

                    • Фрагменты тРНК как новые потенциальные биомаркеры рецидивирующей/рефрактерной множественной миеломы

                      • Конг Сюй
                      • Тин Лян
                      • Юнфэн Фу

                      Биоинформатика BMC (2021)

                    Комментарии

                    Отправляя комментарий, вы соглашаетесь соблюдать наши Условия и Правила сообщества. Если вы обнаружите что-то оскорбительное или не соответствующее нашим условиям или правилам, отметьте это как неприемлемое.

                    Медицинская информатика JMIR — Улучшение клинического перевода подходов машинного обучения с помощью визуального отображения алгоритмов черного ящика, адаптированного для врачей: разработка и проверка

                    Оригинальная статья
                    • Shannon Wongvibulsin 1 , кандидат медицинских наук;
                    • Кэтрин С Ву 2 , доктор медицины;
                    • Scott L Zeger 3 , PhD

                    1 Факультет биомедицинской инженерии, Медицинский факультет Университета Джона Хопкинса, Балтимор, Мэриленд, США

                    , Медицинский факультет Джона Хопкинса 3 2 Медицинский факультет Университета Хопкинса, Балтимор, Мэриленд, США

                    3 Кафедра биостатистики, Школа общественного здравоохранения Блумберга имени Джона Хопкинса, Балтимор, Мэриленд, США

                    Автор -корреспондент:

                    Scott L Zeger, PhD

                    Департамент биостатистики

                    Johns Hopkins Bloomberg School of Public Health

                    615 N. Wolfe Street

                    Room E3650

                    Baltimor Телефон: 1 410 502 9054

                    Эл. минимальная интерпретируемость и черный ящик природа этих алгоритмов.

                    Цель: исследование было направлено на то, чтобы продемонстрировать общую и простую основу для создания клинически значимых и интерпретируемых визуализаций прогнозов черного ящика , чтобы помочь в клиническом переводе машинного обучения.

                    Методы. Для повышения прозрачности машинного обучения можно создавать упрощенные модели и визуальные изображения с использованием общепринятых методов из клинической практики, таких как деревья решений и графики эффектов. Мы проиллюстрировали подход, основанный на постобработке прогнозов машинного обучения, в данном случае прогнозов случайного леса, и применили метод к данным из Реестра структурных предикторов внезапной сердечной смерти (ВСС) левого желудочка (ЛЖ) для индивидуального прогнозирования риска ВСС, ведущего причина смерти.

                    Результаты. С помощью данных LV Structural Predictors of SCD Registry прогнозы риска SCD получаются с помощью алгоритма случайного леса, который определяет наиболее важные предикторы, нелинейности и взаимодействия между большим количеством переменных, естественно учитывая отсутствующие данные. Прогнозы черного ящика подвергаются постобработке с использованием деревьев классификации и регрессии в клинически значимую и интерпретируемую визуализацию. Этот метод также позволяет количественно оценить относительную важность отдельного человека или комбинации предикторов. Несколько факторов риска (госпитализация по поводу сердечной недостаточности, показатели магнитно-резонансной томографии сердца и концентрация системного воспаления в сыворотке) можно четко визуализировать в виде точек ветвления дерева принятия решений, позволяющего различать пациентов с низким, средним и высоким риском.

                    Выводы: С помощью клинически важного примера мы иллюстрируем общий и простой подход к увеличению клинической трансляции машинного обучения с помощью адаптированных для врачей визуальных отображений результатов алгоритмов черного ящика. Мы иллюстрируем эту общую модельно-независимую структуру, применяя ее к прогнозированию риска внезапной сердечной смерти. Хотя мы иллюстрируем методы, использующие прогнозирование SCD с помощью случайного леса, представленные методы более широко применимы для улучшения клинического перевода ML, независимо от конкретного алгоритма ML или клинического применения. Поскольку любая обученная прогностическая модель может быть обобщена таким образом до заданного уровня точности, мы рекомендуем использовать упрощенные визуальные дисплеи в качестве дополнения к сложной прогностической модели. В целом, эта структура может позволить клиницистам заглянуть внутрь черного ящика и глубже понять наиболее важные особенности модели, чтобы обрести доверие к прогнозам и уверенность в их применении в клинической практике.

                    JMIR Med Inform 2020;8(6):e15791

                    doi:10.2196/15791

                    Ключевые слова

                    машинное обучение; интерпретируемость; клинический перевод; модели предсказания; визуализация 



                    Введение

                    Справочная информация

                    Растет интерес к использованию прогностических возможностей машинного обучения (МО) для улучшения результатов медицинского обслуживания по более доступным ценам. Несмотря на то, что они известны своей впечатляющей прогностической способностью, ML 9Прогнозы 0707 черного ящика часто характеризуются минимальной интерпретируемостью, что ограничивает их клиническое применение, несмотря на их обещание улучшить здравоохранение [1-6]. В результате все большее внимание уделяется области интерпретируемого машинного обучения или объяснимого искусственного интеллекта для объяснения того, как модели принимают свои решения [6-8]. Однако отсутствие понимания того, как генерируются прогнозы ML, и сложные отношения между предикторами и результатами по-прежнему являются препятствиями для внедрения ML в клиническую практику.

                    Было разработано множество подходов для объяснения прогнозов и определения важности и эффекта функций машинного обучения, но они имеют ограниченное применение в реальных клинических приложениях [9-12]. Ранее были предложения объединить методы ML или использовать извлечение правил с выводом ML для создания более простых сводок, но из-за присущей им сложности или отсутствия клинического применения эти инструменты редко используются в медицине [13-16].

                    Цели

                    Для ускорения интеграции машинного обучения в клиническую помощь крайне важно сделать упор на персонализацию этих инструментов для конечного пользователя. Наша работа мотивирована хорошо известной клинической задачей измерения индивидуального риска внезапной сердечной смерти (ВСС), ведущей причины смерти со сложной патофизиологией, которая поддается новым подходам [17-22]. Хотя мы фокусируемся здесь на SCD в качестве иллюстративного примера, представляемые нами методы применимы в более широком смысле для улучшения клинического перевода ML, независимо от конкретного алгоритма ML или клинического применения. Вклад этой работы — общая основа для перевода комплекса черный ящик прогнозов в легко понятные представления с помощью часто встречающихся клинических резюме. В целом, мы подчеркиваем необходимость того, чтобы междисциплинарные команды создавали визуальные дисплеи, ориентированные на клиницистов, которые обеспечивают интерпретируемость способами, персонализированными в соответствии с предпочтениями клинициста для понимания прогнозов ML, чтобы помочь в эффективном клиническом переводе ML.


                    Методы

                    Источник данных

                    Реестр структурных предикторов ВСС левого желудочка (LV) представляет собой проспективный наблюдательный регистр (clinicaltrials.gov, NCT01076660), в который включено 382 пациента для первичной конечной точки признанного подходящего имплантируемого кардиовертера-дефибриллятора. возбуждение по поводу желудочковой тахикардии или фибрилляции желудочков или ВСС, не прерванное устройством [23-29]. В течение 8 лет наблюдения у 75 человек был первичный результат.

                    Моделирование

                    Наш подход ML основан на алгоритме случайного леса (RF), реализованном в R-пакете randomForestSRC [30] и расширенном для прогнозирования риска внезапной сердечной смерти [31]. RF — это ансамблевый метод обучения, основанный на наборе деревьев решений, где общий прогноз RF представляет собой среднее значение по ансамблю или большинство голосов. Случайная выборка переменных-предикторов в каждом узле дерева решений и самозагрузка исходных обучающих данных уменьшают корреляцию между деревьями в лесу, обеспечивая впечатляющую прогностическую эффективность [32,33]. Для нашего RF предикторы включали демографические данные, сопутствующие заболевания, лекарства, электрофизиологические параметры, лабораторные показатели, фракцию выброса ЛЖ по данным эхокардиографии и показатели кардиальной магнитно-резонансной томографии (CMR), обобщенные в таблице 1.

                    Таблица 1. Характеристики пациентов в Регистре структурных предикторов внезапной сердечной смерти левого желудочка (N = 382). 9 9 . .55 5 CTNT (NG/MR/MR/ML) 5. 99968968968968968968968968968968968968968968968968968. .
                    Variables No. of SCD a event (n=307) Patient with SCD event (n=75) P value b
                    Демографические и клинические характеристики

                    Возраст (годы), среднее (SD) 57 (13) 57 (12) . 63 (84) . 01

                    Race, n (%) .66


                    White 200 (65.1) 51 (68)


                    African American 99 (32) 21 (28)


                    Other 8 (3) 3 (4)

                    Body surface area (m 2 ), mean (SD) 1. 98 (0.28) 2.05 (0.28) .07

                    Ischemic cardiomyopathy etiology, п (%) 149 (48,5) 44 (59) .15

                    лет от инцидента MI C OR Cardiomopath .02

                    NYHA d functional class, n (%) .55


                    I 64 (21) 20 (27)


                    II 137 (44. 6) 31 (41)


                    III 106 (34.5 ) 24 (32)

                    One or more heart failure hospitalizations, n (%) 0 (0) 19 (25.3) <.001
                    Cardiac risk factors, n (%)

                    Hypertension 180 (58.6) 44 (59) >. 99

                    Hypercholesterolemia 180 (58.6 ) 45 (60) .93

                    Diabetes 85 (28) 19 (25) .79

                    Nicotine use 133 (43.3) 44 (59) .02
                    Medication usage, n (%)

                    ACE e -inhibitor or ARB f 275 (89. 6) 66 (88) .85

                    Beta-blocker 288 (93.8) 68 (91) .48

                    Lipid-lowering 199 (64.8 ) 56 (75) .14

                    Antiarrhythmics (amiodarone) 18 (6) 8 (11) .22

                    Diuretics 173 (56. 4) 54 (72 ) .02

                    Digoxin 50 (16) 16 (21) .39

                    Aldosterone inhibitor 80 (26) 21 ( 28) .85

                    Aspirin 215 (70.0) 55 (73) .67
                    Electrophysiologic variables

                    Prior atrial fibrillation, n (% 51 (17) 14 (19) . 80

                    ПРОМЕСТКОВОЙ СТРОКА (BPM).

                    Продолжительность QRS (MS), среднее (SD) 118 (31) 122 (27) .30








                    . 79 (26)
                    14 (19) . 26

                    Biventricular ICD h , n (%) 90 (29) 17 (23) .31
                    Лабораторные показатели или биомаркеры

                    натрия (MEQ/L), среднее (SD) 139 (3) 139 (3) .73

                    8. 4.26 (0.42) 4.27 (0.39) .87

                    Creatinine (mEq/L), mean (SD) 1. 07 (0.59) 1.09 (0.33) .81

                    рСКФ i (мл/мин/1,73 м 2 ), среднее (SD) 81 (24) 80 (21)

                    Глюкоза (мг/дл), среднее (SD) 120 (53) 113 (34) . SD) 40 (4) 41 (5) .03

                    hsCRP j (µg/mL), mean (SD) 6.89 (12.87) 9.10 (16.29) . 22

                    NT-proBNP k ( ng/L), mean (SD) 2704 (6736) 2519 (1902) .82

                    IL-6 l (pg/mL), mean (SD) 3,05 (5,36) 4,32 (6,28) ,12

                    IL-10 M (PG/мл), среднее (SD) 10,74 (49,67) 13,67 (59,94) ,70

                    ,70

                    .

                    70

                    .70

                    .70

                    99

                    .70

                    . ,), среднее (SD) 3425 (1700) 3456 (1671) .90

                    CTNT O (NG/MR/ML) (NG/MLS/ML) (NG/MLEN)
                    0,02 (0,05) ,62

                    cTnI p (нг/мл), среднее (SD) 0.10 (0.28) 0.10 (0.25) . 98

                    CK-MB q (ng/mL), mean (SD) 3.94 (5.77) 3.87 (3.86 ) .93

                    Myoglobin (ng/mL), mean (SD) 31.37 (30.80) 37.13 (41.53) .31
                    LVEF r : NonCMR с ФВ ЛЖ (%), среднее (СО) 24,2 (7,6) 23,0 (7,4) .19
                    CMR structural and functional indices

                    LVEF (%), mean (SD) 27. 8 (10.3) 25.1 (8.8) .04

                    LV t end-diastolic volume index (ml/m 2) , mean (SD) 122.3 (39.9) 136.2 (48.4) .01

                    Индекс конечного систолического объема ЛЖ (мл/м 2 ), среднее значение (SD) 91,5 (39,1) 104,3 (45,2) .02

                    75.1 (24.4) 80.3 (21.2) .09
                    CMR hyperenhancement

                    LGE u present (%), mean (SD) 176 ( 66) 56 (86) .002

                    Gray zone (g), mean (SD) 8.8 (11.6) 13.8 (12.2) .002

                    Core (g), mean ( SD) 12.4 (14.9) 17. 7 (15.1) .01

                    Total scar (g), mean (SD) 21.1 (25.4) 31.3 (25.6) .004

                    a ВСС: внезапная сердечная смерть.

                    b P значения <.05 выделены курсивом.

                    c ИМ: инфаркт миокарда.

                    d NYHA: Нью-Йоркская кардиологическая ассоциация.

                    e АПФ: ангиотензинпревращающий фермент.

                    f БРА: блокатор рецепторов ангиотензина II.

                    г БЛНПГ: блокада левой ножки пучка Гиса.

                    h ИКД: имплантируемый кардиовертер-дефибриллятор.

                    i рСКФ: расчетная скорость клубочковой фильтрации.

                    j вчСРБ: высокочувствительный С-реактивный белок.

                    k NT-proBNP: N-концевой натрийуретический пептид про-b-типа.

                    l ИЛ-6: интерлейкин-6.

                    м ИЛ-10: интерлейкин-10.

                    n TNF-αRII: фактор некроза опухоли альфа R II.

                    o cTnT: сердечный тропонин T.

                    p cTnI: сердечный тропонин I.

                    q CK-MB: креатинкиназа MB.

                    r ФВ ЛЖ: фракция выброса левого желудочка.

                    s МРТ: магнитно-резонансная томография сердца.

                    t ЛЖ: левый желудочек.

                    u LGE: позднее усиление гадолинием.

                    Интерпретируемость

                    Для передачи результатов моделей машинного обучения, таких как наш RF для прогнозов SCD, мы разрабатываем репрезентативные интерпретируемые сводки. Как показано на рис. 1, следующие общие шаги можно использовать для создания упрощенных представлений любых черный ящик прогноз:

                    (P) входных результатов. Исходные переменные X и предсказания черного ящика (P) являются входными данными для простой модели или алгоритма, например, для одного дерева, чьи предсказания (S) достаточно близки к (P), но их легче понять и объяснить. Посмотреть этот рисунок
                    1. Обучите модель машинного обучения с входными функциями ( X ) и интересующим результатом ( Y ).
                    2. Получите прогнозные значения ( P ) из модели машинного обучения с помощью перекрестной проверки, отдельного тестового набора данных или другого подхода к разделению данных, чтобы гарантировать, что прогнозы не будут получены из того же набора данных, который использовался для обучения модели.
                    3. Обучение простой, интерпретируемой и понятной с клинической точки зрения модели, такой как дерево решений [34] или модель линейной или логистической регрессии [35], с использованием прогнозируемых значений ( P ) из модели ML в качестве интересующего результата и соответствующих входных переменных ( X ) из исходного набора обучающих данных.
                    4. Получите предсказанные значения ( S ) из модели интерпретации. Рассчитайте, насколько близко S к P , то есть насколько хорошо упрощенная модель представляет модель машинного обучения, используя такую ​​меру, как R 2 , определенную, как показано на рисунке 2.
                    ‎Рисунок 2. R 2 Уравнение , где i = от 1 до n оцениваемых наблюдений. С (i) обозначает прогноз для i -го наблюдения с использованием упрощенной модели, P (i) обозначает прогноз для i-го наблюдения с использованием модели ML, а P avg обозначает средний прогноз из ML модель. Посмотреть этот рисунок

                    Обратите внимание, что интерпретационное дерево может быть достаточно большим, чтобы R 2 было сколь угодно близко к 1. Если простое дерево имеет маленькое R 2 , следует проявлять особую осторожность, чтобы избежать чрезмерной интерпретации упрощенной модели. Напротив, если R 2 высок, упрощенную модель можно рассматривать как альтернативу фактической модели ML для упрощенного получения прогнозов на будущее [36,37]. Этот независимый от модели подход к получению упрощенной сводки модели ML показан на рисунке 1.

                    Используя одно дерево в качестве сводки прогнозов RF, мы можем количественно оценить важность отдельных переменных или групп переменных. Полезная мера общего влияния на исход Y предиктора (или группы предикторов) X 1 получается путем суммирования улучшений ошибки предсказания (отклонения) по всем X 1 разбиениям в интерпретативном дереве.

                    Для представления результатов другими способами, знакомыми клиницистам, предикторные эффекты могут быть представлены на графиках, где представлены отношения рисков [38]. Мы создали графики на основе взаимосвязи между предикторными переменными и прогнозируемыми рисками. Для категориальных переменных отношения рисков рассчитываются путем сравнения рисков для различных уровней категориальной переменной (например, отношение рисков = [средний прогнозируемый риск для мужчин]/[средний прогнозируемый риск для женщин]). Для непрерывных переменных коэффициенты риска рассчитываются путем сравнения рисков для разных диапазонов непрерывной переменной (например, отношение рисков = [средний прогнозируемый риск для верхней трети возраста]/[средний прогнозируемый риск для нижней терцили возраста]). ДИ для этих соотношений рисков были созданы с помощью непараметрических подходов начальной загрузки [39].]. Все анализы проводились с использованием R 3.5.1 (R Foundation) [40].


                    Результаты

                    Глобальная сводная визуализация

                    Используя данные из реестра структурных предикторов ЛЖ в реестре ВСС, глобальная сводка для прогнозирования риска ВСС получается путем подгонки одного дерева решений к прогнозам РФ с использованием в качестве входных данных тех же ковариат, которые используются в РФ и результат как предсказания RF. На рисунке 3 показано глобальное сводное дерево модели RF для прогнозирования SCD. Несколько факторов риска появляются в виде ранних разделенных узлов в дереве решений, представляющих ключевые переменные, которые различают пациентов с низким, средним и высоким риском, включая историю госпитализаций по поводу сердечной недостаточности (СН), индексы МРТ (например, конечно-диастолический объем ЛЖ). индекс и общая масса рубца и серой зоны), а также показатель системного воспаления, интерлейкин-6 (ИЛ-6).

                    ‎Рисунок 3. Глобальное сводное дерево модели случайного леса (RF) для прогнозирования внезапной сердечной смерти (ВСС): несколько факторов риска (а именно госпитализация по поводу сердечной недостаточности, несколько показателей магнитно-резонансной томографии сердца и интерлейкин-6 [ИЛ-6], маркер воспаления) различают пациентов с низким, средним и высоким риском. Правила принятия решений в дереве выделены жирным курсивом. Годовые риски внезапной сердечной смерти показаны в ячейках в нижней части дерева решений. Ячейки окрашены в соответствии с величиной риска в процентах в год: белый цвет соответствует подгруппе с самым низким риском, а темно-красный — подгруппе с самым высоким риском. Проценты в круглых скобках в нижней части полей представляют собой пропорции общих данных обучения, которые принадлежат каждой из подгрупп риска. р 2 равно 0,88 того, насколько хорошо это глобальное сводное дерево представляет модель RF. СН: сердечная недостаточность; ЛЖ: левый желудочек. Просмотрите этот рисунок
                    Соотношение рисков и важность переменных

                    На рисунке 4 показан график отношения рисков для предикторов, определенных как переменные разделения в глобальной древовидной сводной модели для нашего примера прогнозирования внезапной сердечной смерти при РЧ, представленного на рисунке 3. Наибольшее отношение рисков относится к госпитализации по поводу СН в анамнезе. перед аритмическим событием, что указывает на то, что у лиц с 1 или более предшествующими госпитализациями по поводу СН показатель 4,06 (95% ДИ 2,82-5,30) раза выше риск ВСС, чем у лиц без госпитализаций по поводу СН. Сравнение риска для лиц с верхним и нижним терцилем для переменных МРТ-визуализации и IL-6 показывает, что более высокие значения этих переменных предполагают более высокий риск ВСС. В частности, отношение рисков составило 1,54 (95% ДИ 1,14–1,93) для индекса конечного диастолического объема ЛЖ выше 133 мл/м 2 по сравнению с показателем ниже 102 мл/м 2 ; 1,48 (95% ДИ 1,04-1,92) для общей массы рубца более 30,79 г по сравнению с менее 1,48 г; 1,48 (95% ДИ 1,04-1,91) для массы серой зоны выше 11,37 г по сравнению с менее 0,40 г и 1,38 (95% ДИ 1,11-1,66) для ИЛ-6 выше 2,15 пг/мл по сравнению с ниже 1,04 пг/мл.

                    В таблице 2 перечислены переменные-предикторы в порядке их важности в одном интерпретационном дереве, показанном на рисунке 3. Их ранжирование основано на доле общей вариации (отклонения) в прогнозах МО, которые они объясняют в 1 или более разбиениях в одном дереве. показано на рисунке 3. Хотя в дереве всего 8 конечных узлов, дерево объясняет 88% информации в предсказаниях из черный ящик РФ. Кроме того, деревья по своей сути идентифицируют взаимодействия. Обратите внимание, что после первого разделения на то, был ли человек ранее госпитализирован по поводу СН, переменная визуализации предсказывала риск только среди людей без предшествующей госпитализации. Эта асимметрия указывает на то, что отсутствие предшествующей госпитализации по поводу СН сильно взаимодействует с переменными визуализации сердца.

                    ‎Рисунок 4. Визуализация эффектов предикторов в модели случайного леса (RF) для прогнозирования внезапной сердечной смерти (ВСС): точечные оценки соотношения рисков и 95% доверительные интервалы, полученные из 500 бутстреп-репликаций, показаны для RF-модели для прогнозирования риска внезапной сердечной смерти. Наибольшее соотношение риска наблюдается между людьми, которые никогда не подвергались госпитализации по поводу сердечной недостаточности, и теми, кто перенес одну или несколько госпитализаций по поводу сердечной недостаточности. Другие сравнения отношения рисков показывают отношения рисков между людьми, сгруппированными в разные категории, на основе переменных воспаления или магнитно-резонансной томографии сердца (CMR), указывающих на структурные и функциональные свойства сердца. СН: сердечная недостаточность; ИЛ-6: интерлейкин 6; ЛЖ: левый желудочек. Посмотреть этот рисунокТаблица 2. В этой таблице обобщается глобальное сводное дерево (показано на рисунке 3) с анализом вариации (отклонения) прогнозируемых значений (P) из модели машинного обучения (ML), объясненной предикторами в глобальном сводном дереве. Количество расщеплений, внесенных каждой переменной в глобальное сводное дерево, перечисляется вместе с отклонением и процентом объясненного отклонения. Ранжированная важность предикторов (в порядке от наиболее важного к наименее важному слева направо в таблице) определяется на основе процента объясненного отклонения. 9,2 а СН 9:2 а СН 9000

                    б LV: левый желудочек.

                    c IL-6: интерлейкин 6.

                    d ML: машинное обучение.

                    e Н/Д: неприменимо.

                    f Это соответствует значению R 2 (0,88), полученному при использовании уравнения, показанного на рисунке 3, для расчетов.


                    Обсуждение

                    Основные результаты

                    Мы продемонстрировали возможность повышения прозрачности машинного обучения путем создания упрощенных моделей и визуальных дисплеев, адаптированных из тех, которые обычно используются в клинической практике. В качестве конкретного примера этой структуры мы используем RF, расширенный для анализа выживаемости с изменяющимися во времени ковариатами для индивидуального прогнозирования риска ВСС. Обычно используемые методы прогнозирования риска ВСС, такие как регрессия пропорциональных рисков Кокса, не учитывают автоматически нелинейные и интерактивные эффекты и не облегчают применение для индивидуального прогнозирования риска [41,42]. В отличие от традиционных стратегий регрессии или параметрических подходов, которые делают предположения о базовой модели, машинное обучение, такое как радиочастота, использует непараметрические алгоритмы, позволяющие анализировать данные.0707 говорят сами за себя и выступают в качестве мощных методов для индивидуальных прогнозов [32,43-45]. RF, как ансамбли деревьев решений, нелегко интерпретировать, хотя одиночные деревья решений популярны в медицине из-за их интуитивности и сопоставимости с тем, как клиницист склонен обдумывать случай. Структура, представленная в этой работе, обеспечивает методологию повышения прозрачности машинного обучения за счет репрезентативных интерпретируемых сводок.

                    Поскольку эта структура интерпретируемости не зависит от модели, пользователь может извлечь выгоду из высокой эффективности прогнозирования ML, а также получить представление о том, как были созданы прогнозы. Несмотря на сложность исходного алгоритма, эти методы интерпретируемости зависят только от вводит , на котором был обучен черный ящик , и соответствующий выводит из черного ящика , а именно его предсказания. Таким образом, любой метод предсказания может быть объяснен до некоторой степени упрощенно. В ситуации, когда невозможно зафиксировать изменение прогнозов МО с помощью простой сводки, предлагаемый метод сигнализирует об этой проблеме посредством естественного сравнения сходства между прогнозируемыми значениями МО и его аппроксимирующей интерпретационной моделью. Этот подход расширяет предшествующие исследования в области мимического обучения и апостериорных объяснений черного ящика предсказаний [46,47]. В этой статье подчеркивается точка зрения клинициста как конечного пользователя, сталкивающегося с рассуждениями на основе дерева как естественным коррелятом клинических рассуждений.

                    Для внедрения машинного обучения в клиническую практику необходимо предоставить ориентированные на пользователя инструменты, которые позволяют клиницистам лучше понимать свои прогнозы и доверять им [48]. Разработка визуализаций, которые легко интерпретировать и основаны на знакомых клиницистам способах понимания алгоритмов или результатов, может помочь сообщить прогнозы машинного обучения. Например, упрощение RF в единое дерево решений дает визуализацию, отражающую принятие решений о лечении или диагностике в клинической практике. Хотя мы иллюстрируем упрощенную модель с помощью дерева решений, также могут быть представлены и другие модели, такие как линейная регрессия. Кроме того, визуальное отображение оценок соотношения рисков, аналогичное тому, которое представлено в медицинской литературе, может помочь клиницистам понять прогнозы машинного обучения.

                    Разработка интерпретируемых прогнозов особенно важна при применении ML в здравоохранении из-за уникальных проблем, связанных с медицинской этикой и нормативными или юридическими соображениями [48]. Объяснения, которые описывают прогнозы, могут способствовать доверию, особенно когда объяснения согласуются со знаниями предметной области или расширяют то, что известно в настоящее время [48]. Например, в нашем иллюстративном примере прогнозирования ВСС в LV Structural Predictors of SCD Registry ключевыми факторами риска являются история госпитализаций по поводу СН, индексы визуализации CMR (т. е. индекс конечно-диастолического объема LV, общий рубец и масса серой зоны), и показатель воспаления (т.е. IL-6). Предикторы, указанные в нашем упрощенном резюме, согласуются с опубликованной литературой по ВСС. Известно, что среди пациентов с СН ВСС является основной причиной смерти из-за сложных взаимодействий между лежащим в основе миокардиальным субстратом и триггерами, такими как воспаление [22,49].,50]. Показатели МРТ визуализации были независимо связаны с желудочковыми аритмиями в нескольких когортах [22, 51-54]. Это исследование выдвигает гипотезу о взаимодействии, согласно которой предикторы визуализации сердца в основном полезны у пациентов без предшествующей госпитализации по поводу СН. Визуальное наблюдение того, что прогнозы основаны на правилах принятия решений, совпадающих с клиническими и биомедицинскими знаниями (рис. 3), может помочь перевести прогнозы машинного обучения для понимания конечным пользователем. Кроме того, представление сводной визуализации модели ML вместе с информацией об оценках эффекта предикторов (рис. 4) может облегчить дальнейшее понимание.

                    Ограничения и сравнение с предыдущей работой

                    Хотя любую сложную модель можно упростить до сводной модели, возможно, что сводные и исходные предсказания модели сильно различаются, что отражено в небольшом R 2 . Этого не произошло в мотивирующем исследовании, где 5 переменных и 7 разбиений объясняли 88% вариации прогнозируемых значений RF. Мы можем ожидать аналогичных результатов во многих задачах, потому что интерпретирующее дерево обучается на предсказанных значениях из сложного алгоритма ML, предназначенного для поиска сводок относительно меньшей размерности, чем исходные данные. Когда маленькое интерпретационное дерево имеет плохой R 2 , при необходимости его можно увеличить для достижения заданного более высокого значения. Затем пользователь может искать более простые сводки, группируя классы предикторов и взаимодействий между ними. Наконец, подход имеет значение R 2 как меру точности предсказаний более простой модели предсказаниям ML. Когда это значение слишком мало для данного дерева, пользователь знает, что простое дерево имеет ограниченную интерпретационную ценность.

                    Тесно связанная область машинного обучения активно занимается этой темой, сравнивая различные алгоритмы обучения и выбирая окончательную модель [55]. Кроме того, поскольку общий подход к получению упрощенной модели обобщает сложную модель на глобальном уровне, упрощенная модель считается глобальной суррогатной моделью и может не быть репрезентативной для определенных подгрупп (например, разные подгруппы могут демонстрировать разные отношения между предикторными переменными). и предсказания) [37]. Чтобы учесть эту возможность, можно создать несколько упрощенных моделей для каждой интересующей подгруппы. Например, можно создать два разных сводных дерева решений для мужчин и женщин. Другой областью активных исследований является разработка моделей локального объяснения, где интерпретируемыми моделями являются локальные суррогатные модели, которые объясняют отдельные прогнозы машинного обучения, а не все 9 прогнозов.Черный ящик 0707 в целом [56]. Кроме того, хотя мы подчеркивали здесь адаптацию визуальных дисплеев к клиницистам, исследования в фокус-группах как с клиницистами, так и с пациентами могут еще больше ускорить прогресс в направлении клинически значимых разработок машинного обучения, которые переводятся в уход за пациентами.

                    Выводы

                    В настоящее время ограниченная интерпретируемость остается основным препятствием для успешного перевода прогнозов ML в клиническую область [1-5]. Несмотря на то, что ранее были разработаны многочисленные инструменты, такие как инструменты для определения важности признаков, эффекта признаков и объяснения прогнозов, для облегчения интерпретируемости [9].-12,56,57], клиническое сообщество в целом до сих пор в целом рассматривает ML как поле, которое генерирует предсказаний черного ящика [1-5]. Хотя необходимы дальнейшие исследования, чтобы полностью понять проблемы, ограничивающие клиническое применение этих инструментов, мы считаем, что акцент на адаптации объяснений и визуальных отображений для конечного пользователя имеет важное значение. Здесь мы расширяем набор инструментов для открытия черного ящика клиническому сообществу посредством представления клинически значимых и интерпретируемых визуализаций, чтобы помочь в продвижении к внедрению МО в здравоохранение. В конечном счете, междисциплинарные команды, обладающие совместным клиническим опытом и опытом работы с данными, необходимы для продолжения исследований для решения проблем, ограничивающих клиническое внедрение этих мощных и информативных инструментов машинного обучения.

                    Благодарности

                    Эта работа была поддержана грантами Национального института здравоохранения № R01HL103812, F30HL142131 и 5T32GM007309. Содержание является исключительной ответственностью авторов и не обязательно отражает официальную точку зрения Национальных институтов здравоохранения.

                    Вклад авторов

                    SW, KW и SZ задумали и сформулировали план исследования. SW и SZ разработали методы и провели анализ данных. KW получила данные пациентов для исследования и предоставила информацию об аналитическом подходе. SW составил рукопись. SW, KW и SZ внесли свой вклад в критический пересмотр рукописи и одобрили окончательный вариант рукописи.

                    Конфликт интересов

                    Не объявлено.

                    Ссылки
                    1. Maddox TM, Rumsfeld JS, Payne PR. Вопросы к искусственному интеллекту в здравоохранении. J Am Med Assoc 1 января 2019 г .: 321 (1): 31–32. [CrossRef] [Medline]
                    2. Beam AL, Kohane IS. Большие данные и машинное обучение в здравоохранении. J Am Med Assoc 3 апреля 2018 г.; 319 (13): 1317-1318. [CrossRef] [Medline]
                    3. Cabitza F, Rasoini R, Gensini GF. Непреднамеренные последствия машинного обучения в медицине. J Am Med Assoc 2017 8 августа; 318 (6): 517-518. [CrossRef] [Medline]
                    4. Shortliffe EH, Sepúlveda MJ. Поддержка принятия клинических решений в эпоху искусственного интеллекта. J Am Med Assoc 2018 Dec 4;320(21):2199-2200. [CrossRef] [Medline]
                    5. Ван Ф., Казалино Л.П., Хуллар Д. Глубокое обучение в медицине: перспективы, прогресс и вызовы. JAMA Intern Med 2019 1 марта; 179 (3): 293-294. [CrossRef] [Medline]
                    6. Lipton Z. Доктор просто не примет это!. Препринт arXiv 2017 Препринт от 24 ноября; arXiv:1711.08037v2 [БЕСПЛАТНЫЙ полный текст]
                    7. Доши-Велес Ф., Ким Б. На пути к строгой науке интерпретируемого машинного обучения. препринт arXiv 2017, препринт от 2 марта; arXiv:1702.08608v2 [БЕСПЛАТНО Полный текст] [CrossRef]
                    8. Адади А., Беррада М. Заглядывая внутрь черного ящика: обзор объяснимого искусственного интеллекта (XAI). Доступ IEEE 2018; 6: 52138-52160. [CrossRef]
                    9. Greenwell BM, Boehmke BC, McCarthy AJ. Простая и эффективная мера важности переменной на основе модели. Препринт arXiv 2018 12 мая Препринт; arXiv:1805.04755 [БЕСПЛАТНЫЙ полный текст]
                    10. Ишваран Х. Важность переменных в деревьях и лесах бинарной регрессии. Electron J Statist 2007; 1: 519-537. [CrossRef]
                    11. Гольдштейн А., Капельнер А., Блайх Дж., Питкин Э. Заглядывая внутрь черного ящика: визуализация статистического обучения с графиками индивидуального условного ожидания. J Comput Graph Stat 2015;24(1):44-65. [Перекрестная ссылка]
                    12. Apley DW, Zhu J. Визуализация эффектов предикторных переменных в моделях обучения под наблюдением Black Box. препринт arXiv 2019, препринт от 19 августа; arXiv:1612.08468v2 [БЕСПЛАТНЫЙ полный текст]
                    13. Martens D, Huysmans J, Setiono R, Vanthienen J, Baesens B. Извлечение правил из машин опорных векторов: обзор проблем и применение в кредитном скоринге. В: Дидерих Дж, редактор. Извлечение правил из машин опорных векторов. Берлин: Спрингер; 2008.
                    14. Стиглич Г., Мертик М., Подгорелец В., Кокол П. Использование визуальной интерпретации малых ансамблей в анализе микрочипов. В: Труды 19Симпозиум IEEE по компьютерным медицинским системам. 2006 Представлено на: CBMS’06; 22-23 июня 2006 г.; Солт-Лейк-Сити, Юта, США. [CrossRef]
                    15. Вулперт Д.Х. Стековое обобщение. Нейронная сеть 1992;5(2):241-259. [CrossRef]
                    16. Тинг К.М., Виттен И.Х. Проблемы в обобщении с накоплением. J Artif Intel Res 1999 1 мая; 10: 271-289. [CrossRef]
                    17. Fishman GI, Chugh SS, Dimarco JP, Albert CM, Anderson ME, Bonow RO, et al. Прогнозирование и предотвращение внезапной сердечной смерти: отчет Национального института сердца, легких и крови и семинара Общества сердечного ритма. Тираж 2010 г. 30 ноября; 122 (22): 2335-2348 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    18. Хаяши М. , Симидзу В., Альберт К.М. Спектр эпидемиологии, лежащей в основе внезапной сердечной смерти. Circ Res 2015 Jun 5;116(12):1887-1906 [FREE Full text] [CrossRef] [Medline]
                    19. Wellens HJ, Schwartz PJ, Lindemans FW, Buxton AE, Goldberger JJ, Hohnloser SH, et al. Стратификация риска внезапной сердечной смерти: текущее состояние и задачи на будущее. Eur Heart J 1 июля 2014 г.; 35 (25): 1642-1651 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    20. Кандала Дж., Ооммен С., Керн К.Б. Внезапная сердечная смерть. Br Med Bull 2017 Jun 1; 122 (1): 5-15. [CrossRef] [Medline]
                    21. Майербург Р. Дж., Голдбергер Дж. Дж. Оценка риска внезапной остановки сердца: популяционная наука и мандат на индивидуальный риск. JAMA Cardiol 1 июня 2017 г .; 2 (6): 689-694. [CrossRef] [Medline]
                    22. Ву Кей Си. Субстрат внезапной сердечной смерти, визуализируемый магнитно-резонансной томографией: от исследовательского инструмента до клинического применения. Circ Cardiovasc Imaging 2017 Jul;10(7) [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    23. Wu KC, Gerstenblith G, Guallar E, Marine JE, Dalal D, Cheng A, et al. Комбинированная магнитно-резонансная томография сердца и уровни С-реактивного белка позволяют выявить когорту с низким риском срабатывания дефибриллятора и смерти. Circ Cardiovasc Imaging 2012 Mar;5(2):178-186 [FREE Full text] [CrossRef] [Medline]
                    24. Шмидт А., Азеведо С.Ф., Ченг А., Гупта С.Н., Блюмке Д.А., Фу Т.К. и др. Неоднородность ткани инфаркта по данным магнитно-резонансной томографии позволяет выявить повышенную предрасположенность к сердечной аритмии у пациентов с дисфункцией левого желудочка. Тираж 2007 г., 17 апреля; 115 (15): 2006-2014 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    25. Tao S, Ashikaga H, Ciuffo LA, Yoneyama K, Lima JA, Frank TF, et al. Нарушение функции левого предсердия является предиктором неадекватных разрядов у кандидатов на имплантацию кардиовертера-дефибриллятора для первичной профилактики. J Cardiovasc Electrophysiol 2017 июль; 28 (7): 796-805 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    26. Zhang Y, Guallar E, Weiss RG, Stillabower M, Gerstenblith G, Tomaselli GF, et al. Взаимосвязь между характеристиками рубца с помощью магнитного резонанса сердца и изменениями фракции выброса левого желудочка у реципиентов дефибриллятора для первичной профилактики. Heart Rhythm 2016 Aug;13(8):1661-1666 [FREE Full text] [CrossRef] [Medline]
                    27. Cheng A, Dalal D, Butcher B, Norgard S, Zhang Y, Dickfeld T, et al. Проспективное обсервационное исследование имплантируемых кардиовертеров-дефибрилляторов для первичной профилактики внезапной сердечной смерти: дизайн исследования и описание когорты. J Am Heart Assoc 2013 Feb 22;2(1):e000083 [FREE Full text] [CrossRef] [Medline]
                    28. Ченг А., Чжан Ю., Бласко-Кольменарес Э., Далал Д., Мясник Б., Норгард С. и др. Белковые биомаркеры выявляют пациентов, которым вряд ли будет полезна первичная профилактика имплантируемых кардиовертер-дефибрилляторов: результаты проспективного обсервационного исследования имплантируемых кардиовертер-дефибрилляторов (PROSE-ICD). Circ Arrhythm Electrophysiol 2014 Dec;7(6):1084-1091 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    29. Zhang Y, Guallar E, Blasco-Colmenares E, Dalal D, Butcher B, Norgard S, et al. Клинические и сывороточные маркеры связаны со смертью в течение 1 года после имплантации de novo у реципиентов ИКД для первичной профилактики. Heart Rhythm 2015 Feb;12(2):360-366 [FREE Full text] [CrossRef] [Medline]
                    30. Ишваран Х, Когалур УБ. Комплексная сеть архивов R. 2020. randomForestSRC: быстрые унифицированные случайные леса для выживания, регрессии и классификации (RF-SRC) URL: https://cran.r-project.org/package=randomForestSRC [дата обращения: 10 марта 2017 г.]
                    31. Вонгвибулсин С., Ву К.С., Зегер С.Л. Прогнозирование клинического риска с помощью случайных лесов для выживания, продольного и многомерного (RF-SLAM) анализа данных. BMC Med Res Methodol 2019 Dec 31;20(1):1 [FREE Full text] [CrossRef] [Medline]
                    32. Фернандес-Дельгадо М., Сернадас Э., Барро С., Аморим Д., Фернандес-Дельгадо А. Нужны ли нам сотни классификаторов для решения реальных задач классификации? J Mach Learn Res 2014 Jan;15(1) [БЕСПЛАТНЫЙ полный текст]
                    33. Брейман Л. Случайные леса. Mach Learn 2001, октябрь; 45: 5-32. [CrossRef]
                    34. Брейман Л., Фридман Дж. Х., Олшен Р. А., Стоун С. Дж. Деревья классификации и регрессии. Бока-Ратон, Флорида: Международная группа Уодсворт; 1993.
                    35. Харрелл Ф.Е. Стратегии регрессионного моделирования: с приложениями к линейным моделям, логистической регрессии и анализу выживания. Нью-Йорк: Спрингер; 2001.
                    36. Молнар К. Интерпретируемое машинное обучение. Сан-Франциско: GitHub; 2019.
                    37. Холл П., Фан В., Амбати С. O’Reilly Media. Бостон: О’Рейли; 15 марта 2017 г. Идеи по интерпретации машинного обучения URL: https://www.oreilly.com/radar/ideas-on-interpreting-machine-learning/ [дата обращения: 23 марта 2020 г.]
                    38. Льюис С., Кларк М. Лесные участки: пытаемся увидеть лес и деревья. Br Med J 2001 16 июня; 322(7300):1479-1480 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    39. Эфрон Б. Введение в Bootstrap. Нью-Йорк: Chapman & Hall Crc Press; 1994.
                    40. Р Фонд. Проект R для статистических вычислений. URL: https://www.r-project.org/ [дата обращения: 23 марта 2020 г.]
                    41. Бу-Хамад И., Ларок Д., Бен-Амер Х. Обзор деревьев выживания. Statist Surv 2011; 5:44-71. [CrossRef]
                    42. Yu C, Greiner R, Lin H, Baracos V. Изучение распределений выживаемости у пациентов с раком как последовательности зависимых регрессоров. В: Материалы 24-й Международной конференции по нейронным системам обработки информации. 2011 Представлено на: NIPS’11; 16 — 17 декабря 2011 г.; Гранада, Испания.
                    43. Гольдштейн Б.А., Навар А.М., Картер Р.Э. Выход за рамки методов регрессии в прогнозировании риска сердечно-сосудистых заболеваний: применение машинного обучения для решения аналитических задач. Eur Heart J 2017 Jun 14;38(23):1805-1814 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    44. Бздок Д. Классическая статистика и статистическое обучение в нейробиологии изображений. Front Neurosci 2017;11:543 [FREE Full text] [CrossRef] [Medline]
                    45. Bzdok D, Krzywinski M, Altman N. Важные моменты: Машинное обучение: учебник. Nat Methods 2017 30 ноября; 14 (12): 1119-1120 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    46. Рибейро М., Сингх С., Гестрин С. Модельно-независимая интерпретируемость машинного обучения. препринт arXiv 2016, препринт от 16 июня; arXiv:1606.05386v1 [БЕСПЛАТНЫЙ полный текст]
                    47. Du M, Liu N, Hu X. Методы интерпретируемого машинного обучения. Commun ACM 2019 Dec;63(1):68-77. [CrossRef]
                    48. Ахмад М.А., Тередесай А., Эккерт С. Интерпретируемое машинное обучение в здравоохранении. В: Материалы Международной конференции IEEE 2018 г. по информатике в здравоохранении. 2018 Представлено на: ICHI’18; 4-7 июня 2018 г.; Нью-Йорк, штат Нью-Йорк, США. [Перекрестная ссылка]
                    49. Hussein AA, Gottdiener JS, Bartz TM, Sotoodehnia N, DeFilippi C, See V, et al. Воспаление и внезапная сердечная смерть среди пожилых людей, проживающих в сообществе: исследование здоровья сердечно-сосудистой системы. Ритм Сердца 2013 Окт;10(10):1425-1432. [CrossRef] [Medline]
                    50. Steinberg BA, Mulpuru SK, Fang JC, Gersh BJ. Механизмы внезапной смерти при неишемических кардиомиопатиях: результаты клинических испытаний имплантируемых кардиовертер-дефибрилляторов. Ритм Сердца 2017 Dec;14(12):1839-1848. [CrossRef] [Medline]
                    51. Disertori M, Rigoni M, Pace N, Casolo G, Masè M, Gonzini L, et al. Оценка миокардиального фиброза с помощью LGE является мощным предиктором желудочковых тахиаритмий при ишемической и неишемической дисфункции ЛЖ: метаанализ. JACC Cardiovasc Imaging 2016 Sep;9(9):1046-1055 [FREE Full text] [CrossRef] [Medline]
                    52. Jablonowski R, Chaudhry U, van der Pals J, Engblom H, Arheden H, Heiberg E, et al. Сердечно-сосудистый магнитный резонанс для прогнозирования надлежащей терапии имплантируемого кардиовертера-дефибриллятора у пациентов с ишемической и неишемической кардиомиопатией с использованием пограничной зоны с поздним усилением гадолиния: сравнение четырех методов анализа. Circ Cardiovasc Imaging 2017 Сентябрь; 10 (9)) [БЕСПЛАТНЫЙ Полный текст] [CrossRef] [Medline]
                    53. Скотт П. А., Розенгартен Дж.А., Керзен Н.П., Морган Дж.М. Магнитно-резонансная томография сердца с поздним усилением гадолиния для прогнозирования желудочковых тахиаритмий: метаанализ. Eur J Heart Fail 2013 Sep;15(9):1019-1027 [БЕСПЛАТНЫЙ полный текст] [CrossRef] [Medline]
                    54. Rayatzadeh H, Tan A, Chan RH, Patel SJ, Hauser TH, Ngo L, et al. Неоднородность рубцов на кардиоваскулярном магнитном резонансе как предиктор адекватной терапии имплантируемым кардиовертер-дефибриллятором. J Cardiovasc Magn Reson 2013 Apr 10;15:31 [FREE Full text] [CrossRef] [Medline]
                    55. Bouckaert RR, Frank E. Оценка воспроизводимости тестов значимости для сравнения алгоритмов обучения. В: Материалы Тихоокеанской азиатской конференции по обнаружению знаний и интеллектуальному анализу данных. 2004 г. Представлено на: ПАКДД’04; 26-28 мая 2004 г.; Сидней, Австралия с. 3-12. [CrossRef]
                    56. Рибейро М.Т., Сингх С., Гестрин К. «Почему я должен вам доверять?»: объяснение предсказаний любого классификатора. В: Материалы 22-й Международной конференции ACM SIGKDD по обнаружению знаний и интеллектуальному анализу данных. Нью-Йорк, Нью-Йорк, США: ACM Press; 2016 авг Представлено на: KDD’16; 13 — 17 августа 2016 г.; Сан-Франциско, Калифорния с. 1135-1144.
                    57. Штрумбель Э., Кононенко И. Объяснение моделей прогнозирования и индивидуальных прогнозов с вкладом признаков. Knowl Inf Syst 2014;41(3):647-665. [CrossRef]


                    Abbreviations
                    Split variable HF a hospitalization history LV b end-diastolic volume index Total scar Inflammation (IL-6 c ) Gray zone Tree total ML d total
                    Number of splits 1 2 2 1 1 7 N/A e
                    Deviance explained 1. 26 0.255 0.100 0.034 0.020 1.67 1.89
                    Percentage of deviance explained 66.6 13,5 5,2 1,7 1,1 0,88 ж 100
                    CMR: cardiac magnetic resonance
                    HF: heart failure
                    IL-6: interleukin-6
                    LV : левый желудочек
                    ML: машинное обучение
                    RF: random forest
                    SCD: внезапная сердечная смерть

                    9090 Под редакцией Lovis0 9090 подан 07.08.19; рецензировано Т. Мэддоксом, Г. Стигликом, Д. Карвалью; комментарии к автору 16.10.19; исправленная версия получена 10.12.19; принят 01. 02.20; опубликовано 06.09.20

                    Copyright

                    © Шеннон Вонгвибулсин, Кэтрин С. Ву, Скотт Л. Зегер. Первоначально опубликовано в JMIR Medical Informatics (http://medinform.jmir.org), 09..06.2020.

                    Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе, при условии, что оригинальная работа, впервые опубликованная в JMIR Medical Informatics, правильно процитирована. Должны быть включены полная библиографическая информация, ссылка на оригинальную публикацию на http://medinform.jmir.org/, а также информация об авторских правах и лицензии.


                    Метод синтеза изображений глазного дна сетчатки на основе генеративно-состязательной сети

                    На этой странице слепота у лиц молодого и среднего возраста. Для ускорения диагностики ДР использовалась масса методов глубокого обучения для выявления этого заболевания, но они не дали отличных результатов из-за несбалансированных обучающих данных, т. е. отсутствия изображений глазного дна ДР. Чтобы решить проблему дисбаланса данных, в этой статье предлагается метод, названный генеративными состязательными сетями изображений глазного дна сетчатки (RF-GAN), который основан на генеративной состязательной сети для синтеза изображений глазного дна сетчатки. RF-GAN состоит из моделей двух поколений: RF-GAN1 и RF-GAN2. Во-первых, RF-GAN1 используется для перевода изображений глазного дна сетчатки из исходного домена (домена наборов данных семантической сегментации) в целевой домен (домен набора данных EyePACS, подключенного к Kaggle (EyePACS)). Затем мы обучаем модели семантической сегментации с переведенными изображениями и используем обученные модели для извлечения структурных масок и масок повреждений (далее мы называем их масками) EyePACS. Наконец, мы используем RF-GAN2 для синтеза изображений глазного дна сетчатки с использованием меток оценки Masks и DR. В этом документе проверяется эффективность метода: RF-GAN1 может сузить разрыв домена между различными наборами данных, чтобы повысить производительность моделей сегментации. RF-GAN2 может синтезировать реалистичные изображения глазного дна сетчатки. При использовании синтезированных изображений для увеличения данных точность и квадратичная взвешенная каппа современной модели оценки DR на тестовом наборе EyePACS увеличиваются на 1,53% и 1,70% соответственно.

                    1. Введение

                    ДР является частым осложнением диабета. Заболевание вызывается блокированием кровеносных капилляров, питающих сетчатку, когда в крови так много сахара, а затем перекрытием кровоснабжения сетчатки. В соответствии с международным протоколом ДР можно разделить на 5 степеней тяжести (нормальная, легкая, умеренная, тяжелая непролиферативная диабетическая ретинопатия (НПДР) и пролиферативная диабетическая ретинопатия (ПДР)) [1]. Офтальмологи обычно идентифицируют и оценивают тяжесть ДР на основе количества и размера различных поражений, связанных с ДР. Короче говоря, микроаневризмы являются самыми ранними клинически видимыми признаками ДР, которая является основным поражением легкой формы НПДР. Умеренная НПДР содержит не только микроаневризмы, но и твердые экссудаты и кровоизлияния, но практически не содержит мягких экссудатов. Тяжелая НПДР характеризуется наличием интраретинальных микрососудистых аномалий и мягкого экссудата, а также отсутствием симптомов ПДР. Из-за ишемии сетчатки существенным фактором ПДР является неоваскуляризация. По мере ухудшения ДР это может привести к серьезным последствиям для зрения человека или даже к слепоте. Поэтому раннее выявление ДР важно для защиты зрения. Но из-за ограниченных медицинских ресурсов и затрат времени на обнаружение ДР в последнее время преобладают методы, основанные на глубоком обучении.

                    В работах [2–8] для оценки DR была применена сверточная нейронная сеть, и были достигнуты определенные результаты. Однако из-за несбалансированного распределения EyePACS [9] (на долю нормального приходится 73,48 %, на легкий NPDR приходится 6,96 %, на средний NPDR приходится 15,07 %, на тяжелый NPDR приходится 2,48 % и на PDR приходится 2,01 %), производительность была не идеальной. Хотя увеличение данных (традиционное увеличение данных и расширенное увеличение данных [10,11]), передискретизация (случайная передискретизация [12], SMOTE [13], Borderline-SMOTE [14]), недостаточная выборка (Easy Ensemble [15], Balance Cascade [ 15]), и другие традиционные методы могут в некоторой степени смягчить проблему, плохое разнообразие изображений по-прежнему ограничивает производительность модели.

                    Генеративно-состязательная сеть (GAN) [16] получила распространение и стала основной в области генерации изображений с тех пор, как она была предложена Гудфеллоу. GAN оптимизируется генератором G и дискриминатором D во взаимных играх для получения идеальных результатов. В частности, генератор G нацелен на создание реальных изображений для обмана дискриминатора D , в то время как D пытается различать реальные изображения и сгенерированные изображения. DCGAN [17] расширяет GAN, используя транспонированные сверточные операции для повышения дискретизации; CGAN [18] добавляет метки к генератору и дискриминатору для управления категорией синтезируемых изображений; ВГАН [19] использует штраф за градиент во время обучения и улучшает функцию потерь, снижая сложность обучения модели и смягчая проблему коллапса режима; BigGAN [20] сочетает в себе различные новые методы и умножает количество параметров и размер пакета, что значительно повышает производительность модели. Основываясь на хороших характеристиках GAN при создании изображений, мы используем GAN для синтеза изображений глазного дна сетчатки.

                    В частности, предлагаемая RF-GAN состоит из двух моделей генерации: RF-GAN1 и RF-GAN2. RF-GAN1 переводит изображения из исходного домена в целевой домен, затем RF-GAN2 синтезирует изображения глазного дна сетчатки с помощью масок (функции сегментации включают диск зрительного нерва, сосуд, микроаневризму, кровоизлияния, твердые экссудаты и мягкие экссудаты), извлеченные с помощью моделей семантической сегментации и DR. оценочные этикетки. Мы используем двухэтапную генерацию изображений глазного дна сетчатки по трем причинам. Во-первых, объем известного в настоящее время набора данных DR-классификации невелик. Если мы применим только RF-GAN1 для преобразования другого набора данных DR-классификации, мы не сможем получить достаточно синтезированных изображений глазного дна сетчатки для увеличения данных. Во-вторых, в наборах данных семантической сегментации очень мало изображений глазного дна сетчатки и масок, которые RF-GAN2 не может полностью обучить маскам и изображениям в наборах данных сегментации. Итак, мы должны извлечь достаточно масок с помощью моделей семантической сегментации. В-третьих, если мы обучаем модель сегментации исключительно с помощью исходных наборов данных сегментации, производительность сегментации в EyePACS не идеальна (особенно для некоторых небольших поражений и сосудов) из-за различий в доменах, что, в свою очередь, влияет на качество изображений глазного дна сетчатки, генерируемых RF-GAN2. . Поэтому мы применяем RF-GAN1 для адаптации домена, чтобы помочь модели сегментации извлечь более точные маски. Обучение RF-GAN2 с более точными масками повышает чувствительность RF-GAN2 к информации об поражениях и меткам DR, что позволяет RF-GAN2 точно контролировать тип и количество поражений в соответствии с заданными метками DR при синтезе изображений глазного дна сетчатки. Поэтому мы используем комбинацию моделей RF-GAN1 и сегментации для извлечения достаточного количества масок из EyePACS; затем мы используем извлеченные маски, соответствующие изображения глазного дна сетчатки и метки оценки DR для обучения RF-GAN2.

                    Основные вклады этой статьи можно резюмировать по трем направлениям: (1) RF-GAN1 предлагается сузить доменный разрыв между наборами данных семантической сегментации и EyePACS. RF-GAN1 расширяет CycleGAN [21] за счет интеграции с сиамской сетью (SiaNet) и принятия дополнительной потери идентичности [22] для оптимизации. Номер того же класса SiaNet установлен равным 1. Насколько нам известно, мы первыми выполнили адаптацию предметной области, чтобы уменьшить различия в предметной области между наборами данных семантической сегментации и EyePACS для обучения моделей сегментации, предоставляя большое количество более Точные маски для обучения модели генерации изображений глазного дна сетчатки. (2) Мы предлагаем модель генерации изображений глазного дна сетчатки RF-GAN2, которая точно контролирует уровень тяжести ДР. RF-GAN2 использует многомасштабный дискриминатор и двухступенчатый генератор для синтеза более реалистичных локальных деталей. Кроме того, модель оптимизируется за счет состязательной потери, потери сопоставления признаков, потери восприятия и потери классификации одновременно. (3) Мы проводим как качественные, так и количественные эксперименты для оценки нашего метода. И мнение офтальмологов, и количественная оценка показывают, что этот метод может синтезировать реалистичные изображения глазного дна сетчатки. Кроме того, при использовании синтезированных изображений глазного дна сетчатки для увеличения данных наблюдается значительное улучшение производительности модели классификации DR.

                    2.1. GAN в синтезе медицинских изображений

                    Применение GAN для синтеза изображений для решения проблемы нехватки больших и разнообразных наборов данных широко используется в обработке медицинских изображений. Куанг и др. [23] использовали кодировщик для картирования латентного пространства доброкачественных узлов в легких и злокачественных узлов в легких, чтобы направлять генератор для синтеза соответствующих КТ-изображений легких. Ян и др. [24] предложили дополнительную потерю согласованности структуры, основанную на модальности независимого дескриптора соседства, чтобы улучшить CycleGAN для неконтролируемого синтеза MR-to-CT. Zunair и Hamza [25] внедрили противоборствующее обучение и перенесли обучение, чтобы преобразовать нормальную рентгенограмму грудной клетки и рентгенографию пневмонии в COVID-19.рентгенограмма грудной клетки. Цзян и др. [26] расширили CGAN за счет использования двойных генераторов и двойных дискриминаторов, которые представили механизм динамической связи для улучшения CGAN для синтеза изображений компьютерной томографии (КТ) легких, а затем объединили сгенерированные КТ-изображения легких с внелегочной КТ для получения рентгенографии грудной клетки COVID-19. . Джин и др. [27] использовали новый, более богатый сверточный генератор с расширенными воротами (RicherDG) для синтеза 3D-опухолевых поражений на КТ-изображениях.

                    2.2. GAN в синтезе изображений глазного дна сетчатки

                    В последние годы появился интерес к использованию GAN для синтеза изображений глазного дна сетчатки. Коста и др. [28] внедрили состязательный автокодер для задачи синтеза деревьев сосудов сетчатки, а затем они использовали сгенерированные деревья сосудов в качестве промежуточного этапа для создания изображений глазного дна сетчатки, что было выполнено с помощью GAN. Использование состязательного автокодировщика может синтезировать больше морфологических деревьев сосудов, увеличивая разнообразие генерируемых изображений глазного дна сетчатки. Но они не принимали во внимание поражения при синтезе изображений глазного дна сетчатки, поэтому информация о поражении не очевидна в сгенерированных изображениях глазного дна сетчатки. Чжао и др. [29] предложили расширить передачу стилей генератору, чтобы увеличить разнообразие синтезируемых изображений глазного дна сетчатки. Этот метод был способен синтезировать несколько изображений на основе одного дерева сосудов. Однако уровень серьезности DR для синтезированного изображения был установлен таким же, как и для входного изображения, что вносило бы шум, когда синтезированные изображения применялись к задаче оценки DR. Диас-Пинто и др. [30] предложили новый синтезатор изображений глазного дна сетчатки и полууправляемый метод обучения для оценки глаукомы на основе DCGAN. Однако сгенерированные изображения содержали только периферическую часть диска зрительного нерва и имели ограниченное применение. Ниу и др. [31] использовали патологические дескрипторы, извлеченные из эталонных изображений, в качестве руководства для создания изображений глазного дна сетчатки. Этот метод позволял манипулировать расположением и количеством поражений, но не позволял точно контролировать степень тяжести ДР. Бурлина и др. [32] использовали две отдельные прогрессивно растущие генеративно-состязательные сети (ProGAN) для синтеза референтных и нереферентных изображений возрастной макулярной дегенерации (AMD) соответственно. Эта отдельная структура помогла генератору лучше изучить потенциальное пространство референтной и нереферентной AMD, улучшив качество синтезированных изображений глазного дна сетчатки. Но в этом исследовании были получены только два типа изображений глазного дна сетчатки AMD (референтная AMD и нереферентная AMD). Ю и др. [33] использовали CycleGAN для уменьшения артефактов на изображениях глазного дна сетчатки для улучшения качества изображения. Но в некоторых случаях по мере того, как артефакт становился более неясным, артефакт в виде шахматной доски становился более заметным на сгенерированных изображениях. Тавакколи и др. [34] использовали двухэтапный генератор на основе CGAN и использовали изображения глазного дна сетчатки в качестве входных данных для генерации флуоресцентной ангиографии (ФА). Этот метод мог давать высококачественные изображения FA, даже когда качество их аналогов было относительно низким. Но они не проводили лонгитюдных исследований преимуществ предложенного метода в оценке прогрессирования заболевания. Лим и др. [35] использовали StyleGAN [36] в качестве генератора и ResNet-50 в качестве дискриминатора для синтеза изображений глазного дна сетчатки со скрытой переменной. Сначала они обучили модель GAN, используя все изображения глазного дна сетчатки с уровнем DR, затем провели точную настройку с желаемыми изображениями глазного дна сетчатки с высоким уровнем DR и, наконец, выбрали вероятные синтетические изображения с помощью существующего дискриминатора. Этот подход повысил чувствительность модели к изображениям глазного дна сетчатки с высоким уровнем оценки DR, но уменьшил способность генерировать нормальные изображения глазного дна сетчатки. Ван и др. [37] предложили многоканальную GAN (MGAN), которая могла генерировать серию изображений подфундального отдела, включая эффективные локальные признаки, и все изображения подфундального отдела были объединены для получения наиболее репрезентативных характеристик всего изображения глазного дна. Таким образом, их метод может решить проблему, заключающуюся в том, что эффективные функции DR размыты на изображениях глазного дна с высоким разрешением. Но в основном они стремились получить хороший дискриминатор для полуконтролируемой оценки DR, и сгенерированные изображения иногда не были однородны с реальными изображениями. Ян и др. [38] добавили структуру коротких связей в генератор и заменили сверточный слой блоками плотных связей в дискриминаторе для сегментации сосудов сетчатки. Добавление структуры коротких соединений решило проблему деградации сети и исчезновения градиента, что сделало обучение генератора более стабильным, а добавление блоков плотных соединений усилило передачу признаков. Но модель обучалась на небольших наборах данных, и обобщаемость модели была плохой. Предыдущие методы создания изображений глазного дна сетчатки чрезмерно полагались на аннотированные вручную деревья сосудов (они не могут автоматически генерировать точные деревья сосудов), но существующие наборы данных деревьев сосудов невелики. Кроме того, они не могут контролировать уровень серьезности DR синтезированных изображений. Чтобы компенсировать вышеуказанные ограничения, мы используем RF-GAN1 для преобразования изображений из исходного домена в целевой домен, чтобы модели семантической сегментации могли извлекать более точные маски для обучения RF-GAN2. Затем мы используем обученный RF-GAN2 для синтеза высокоточных изображений глазного дна сетчатки с использованием меток оценки Masks и DR.

                    3. Предлагаемый метод

                    RF-GAN, предложенные в этом документе, состоят из двух моделей генерации, RF-GAN1 и RF-GAN2. В этом разделе сначала представлена ​​общая структура RF-GAN, а затем представлены RF-GAN1 и RF-GAN2 соответственно.

                    3.1. Общая структура

                    RF-GAN состоит из двух моделей поколения: RF-GAN1, которая направлена ​​на преодоление разрыва между наборами данных семантической сегментации и EyePACS, и RF-GAN2, которая используется для синтеза изображений глазного дна сетчатки с помощью масок, извлеченных семантикой. модели сегментации и метки оценки DR. Общая схема показана на рисунке 1.9.0003

                    Конвейер включает два этапа; На первом этапе мы используем RF-GAN1 для перевода изображений глазного дна сетчатки из исходного домена в целевой домен. Затем мы принимаем HR-Net [39] (HR-Net поддерживает представление с высоким разрешением, параллельно объединяя свертки с высоким разрешением и свертки с низким разрешением, и улучшает представление с высоким разрешением, многократно выполняя многомасштабное слияние через параллельные свертки. HR-Net добилась отличных результатов в оценке позы человека, и в наших экспериментах мы обнаружили, что HR-Net также имеет хорошую производительность для сегментации информации о структуре и повреждениях в изображениях глазного дна сетчатки) для извлечения масок изображений в EyePACS. На втором этапе мы применяем RF-GAN2 для синтеза изображений глазного дна сетчатки с помощью масок и меток оценки DR. Алгоритм 1 дает детали предлагаемых нами методов.

                    99

                    99996996.

                    99

                    66.
                    Требуется :
                    наборов данных семантической сегментации.
                    Процесс :
                       Этап 1 : Преодоление разрыва домена:
                       для m  = 0 до M до
                       Обучение RF-GAN1 с помощью и .
                    END для
                    для M = 0 до M DO 999999999999999999999999999999999999999 гг.
                       конец для
                      //Получаем .
                    Стадия 2 : Получить маски:
                    для N = от 0 до N DO
                    END для
                    для N = 0 до N DO
                       конец для
                      Объедините сегментированные маски структур и повреждений, чтобы получить маски.
                       Stage 3 : Train RF-GAN2 and synthesize retinal fundus images:
                       for epoch = 0 to EPOCH do
                        for i  = 0 to do
                        Поезд RF-GAN2 с , Масками, .
                        конец для
                       конец для
                      Используйте обученный RF-GAN2 для синтеза изображений глазного дна сетчатки с помощью масок и меток оценки DR.
                    3.
                    2. RF-GAN1

                    При переводе необходимо выполнить два специальных требования к RF-GAN1: (1) Переведенные наборы данных имеют стиль, аналогичный EyePACS. (2) Структуры (диск зрительного нерва, кровеносные сосуды глазного дна и т. д.) и поражения (микроаневризмы, твердые экссудаты, мягкие экссудаты, кровоизлияния и т. д.) изображений глазного дна сетчатки остаются неизменными после трансляции. Основываясь на приведенных выше обсуждениях, RF-GAN1 должен соответствовать двум ограничениям передачи стиля и сохранения подробной информации, поэтому функция потерь RF-GAN1 где обозначает потерю стиля при передаче, обозначает потерю информации при сохранении и является параметром баланса между две потери.

                    Поскольку изображения из наборов данных семантической сегментации и изображения из EyePACS не являются парными, перенос стиля можно рассматривать как задачу переноса непарного изображения в изображение. Благодаря отличной производительности CycleGAN в задаче передачи непарного изображения к изображению RF-GAN1 расширен на основе CycleGAN. Предположим, G обозначает генератор из исходного домена S в целевой домен T , F обозначает генератор из целевого домена T в исходный домен S , обозначает дискриминатор исходного домена S и обозначает дискриминатор целевого домена T . Функция потерь при передаче стиля равна

                    . В уравнении (2) обозначает потери со стороны противника, обозначает потерю согласованности цикла и обозначает ограничение идентичности целевого домена. делает распределение изображений глазного дна сетчатки, сгенерированных генератором, максимально приближенным к распределению реальных изображений глазного дна сетчатки, указывает направление передачи стиля изображений глазного дна сетчатки и способствует сохранению цвета переведенных изображений глазного дна сетчатки. Уравнения , , ,

                    В уравнениях (3)–(6) обозначает изображение из исходного домена, а обозначает изображение из целевого домена.

                    Из-за требований к высокому разрешению медицинских изображений RF-GAN1 заменяет генератор CycleGAN на двухступенчатый генератор от грубого к точному [40]. Структуры генератора и дискриминатора RF-GAN1 показаны на рисунке 2.

                    Как показано на рисунке 2, это генератор первого этапа, входами которого являются изображения размером 256 × 256. Он состоит из блоков кодирования, остаточные блоки и блоки декодирования. Структура полностью идентична структуре CycleGAN, за исключением того, что количество остаточных блоков равно девяти, а на последнем уровне блока декодирования нет сверточной операции 7 × 7. Конечными выходами являются карты признаков с формой 256   × 256   × 64. На втором этапе входными данными являются изображения размером 512   × 512. Состоят из блоков кодирования, остаточных блоков и блоков декодирования. В блоках кодирования размер ядра первого сверточного слоя равен 7, а размер ядра второго сверточного слоя равен 3. Мы настраиваем сверточные операции с шагом 2, чтобы заменить операции объединения. Чтобы позволить наследовать глобальные признаки, изученные , входы первого остаточного блока представляют собой поэлементную сумму выходов второго сверточного слоя и выходов последнего слоя . использует три остаточных блока. Настройки гиперпараметров транспонированных сверточных операций в блоках декодирования аналогичны настройкам сверточных операций в блоках кодирования. Наконец, RF-GAN1 синтезирует переданные изображения глазного дна сетчатки. Синтезированные изображения и изображения целевого домена вводятся в дискриминатор 9.0707 D для различения реального и синтезированного. Генератор и дискриминатор оптимизируются посредством состязательного процесса.

                    В обширных экспериментах мы обнаружили, что использование только вышеуказанного генератора и дискриминатора для передачи стиля приведет к потере деталей изображения глазного дна сетчатки. Чтобы решить эту проблему, мы интегрируем модель генерации с SiaNet, в которой номер идентичного класса равен 1, с одной стороны, и используем потерю идентичности для оптимизации модели генерации, с другой стороны. Общая структура RF-GAN1 показана на рисунке 3, а верхняя часть — это SiaNet. Структура SiaNet показана в таблице 1.

                    Функция потерь SiaNet — Contrastive Loss [41], которая помогает SiaNet сблизить переведенное изображение глазного дна сетчатки и его аналог в исходном домене и отодвинуть переведенное изображение глазного дна сетчатки и любые другие изображения глазного дна сетчатки в целевом домене. . Уравнение контрастных потерь:

                    Уравнение d равно

                    В уравнении (7) и представляет собой пару входных векторов. d измеряет сходство между двумя входными векторами и . Расчет d иллюстрируется уравнением (8), где ϵ — небольшая ненулевая константа. i — двоичная метка пары входных векторов и . Если и положительные пары, то i  =  1. Если и отрицательные пары, то i  =  0. Определим и , и как две пары положительных векторов, и , и как две пары отрицательных векторов. м представляет собой классификационную границу и . Для наилучшей работы модели положим м  = 2,

                    В дополнение к потере в уравнении (2), мы принимаем потерю идентичности для повышения стабильности сохранения информации. где G обозначает генератор от исходного домена к целевому домену, обозначает изображение из исходного домена, обозначает маски , а ⊙ обозначает произведение Адамара. Потеря идентичности заставляет генератор сохранять локальные детали изображений глазного дна сетчатки при выполнении переноса стиля.

                    Благодаря координации CycleGAN, SiaNet и потере идентичности RF-GAN1 может синтезировать изображения, которые не только обладают стилем целевого домена, но и сохраняют локальные детали. Функция потерь RF-GAN1 имеет вид где , , , и управляют весами различных потерь. Установим , , и . Первые три потери относятся к потерям при переносе стиля, а последние две потери относятся к потерям при сохранении информации.

                    3.3. RF-GAN2

                    Поскольку RF-GAN2 должен обеспечить точный контроль уровня серьезности DR синтезированных изображений, RF-GAN2 улучшен на основе CGAN. Структура RF-GAN2 показана на рис. 4.

                    Для синтеза изображений глазного дна сетчатки с высоким разрешением в RF-GAN2 используется двухступенчатый генератор грубого и точного преобразования. Как показано в верхней части рисунка 4, это генератор первой ступени, а входными данными являются маски размером 256 × 256 и метки оценки DR y . состоит из блоков кодирования, остаточных блоков и блоков декодирования. Блоки кодирования используют три сверточных слоя. Размер ядра первого сверточного слоя равен 7, а размер ядра двух других сверточных слоев равен 3. Мы настраиваем сверточные операции с шагом 2, чтобы заменить операции пула для понижения дискретизации, а ReLU и нормализация партии [42] принимаются после каждый слой. Количество остаточных блоков равно девяти, что используется для увеличения глубины сети и изучения глубоких представлений особенностей изображений глазного дна сетчатки. Блоки декодирования состоят из двух транспонированных сверточных слоев. Размер ядра транспонированных сверточных слоев равен 3, а настройки гиперпараметров такие же, как у сверточных слоев в блоках кодирования. Конечными выходами являются карты признаков с формой 256 × 256 × 64, это генератор второго этапа, а входами являются маски размером 512 × 512, состоящие из блоков кодирования, остаточных блоков и блоков декодирования. Блоки кодирования используют два сверточных уровня. Размер ядра первого сверточного слоя равен 7, а размер ядра второго сверточного слоя равен 3. Остальные настройки такие же, как у сверточных слоев в . Входы первого остаточного блока представляют собой поэлементную сумму выходов последнего слоя и выходов второго сверточного слоя приобретают глобальную информацию, полученную с помощью . использует три остаточных блока. В блоках декодирования мы сначала используем транспонированный сверточный слой с размером ядра 3, а затем применяем сверточный слой с размером ядра 7 для синтеза изображений глазного дна сетчатки. Другие настройки такие же, как у сверточных слоев, соответствующих блокам кодирования файлов .

                    Чтобы отличить синтезированные изображения высокого разрешения от реальных изображений, мы используем многомасштабный дискриминатор. В частности, мы используем три дискриминатора с одинаковой структурой, но размер их входного изображения составляет 512 × 512, 256 × 256 и 128 × 128 соответственно. Хотя структура идентична, дискриминатор самого грубого масштаба имеет самое большое рецептивное поле и содержит больше информации о глобальной перспективе изображения, что может направлять генератор для синтеза целостной структуры изображений глазного дна сетчатки и некоторых крупных паттернов поражения, а также самых мелких Масштабный дискриминатор имеет наименьшее рецептивное поле, которое может направлять генератор для синтеза большего количества локальных деталей, особенно некоторых небольших поражений.

                    В этой статье мы разрабатываем многозадачную потерю для оптимизации генератора и дискриминатора, т. е. враждебную потерю, потерю сопоставления признаков, потерю восприятия и потерю классификации. Уравнение состязательной потери где и вместе называются G , x обозначает изображение глазного дна сетчатки, n представляет изображения различных размеров, а y обозначает метку оценки DR изображения глазного дна сетчатки. И, c обозначают Маски разного масштаба, вводимые в и , мы объединяем их в одну условную карту, обозначаемую как с . Чтобы повысить стабильность обучения, мы используем потерю сопоставления признаков. В частности, мы извлекаем признаки из средних слоев дискриминаторов и заставляем генератор сопоставлять промежуточные представления между реальными изображениями глазного дна сетчатки и синтезировать изображения глазного дна сетчатки. Потеря сопоставления признаков может обеспечить более точное руководство для генератора, повышая точность медицинских изображений сгенерированных изображений глазного дна сетчатки. Уравнение потери совпадения признаков: где n обозначает изображения разных размеров, а p обозначает промежуточный слой дискриминатора, . Из-за отличной производительности потери восприятия при генерации сверхвысокого разрешения и передаче стиля мы используем потерю восприятия для оптимизации дискриминатора и генератора. В таком контексте использование потери восприятия может улучшить локальные детали синтезированных изображений глазного дна сетчатки. Уравнение потери восприятия: где n обозначает изображения разного размера, F обозначает перцептивную сеть на основе магистрали VGG-19 [43], q обозначает промежуточный уровень перцептивной сети, . Мы принимаем потерю классификации, чтобы точно контролировать уровень серьезности DR синтезированных изображений глазного дна сетчатки, чтобы генератор мог контролировать тип и количество поражений в соответствии с метками классификации DR. Уравнение потери классификации: где обозначает перекрестную потерю энтропии. Объединяя вышеуказанные потери, функция потерь RF-GAN2 имеет вид где , , и обозначают веса различных потерь. Мы устанавливаем , , .

                    4. Эксперименты и результаты
                    4.1. Наборы данных и предварительная обработка

                    В этой статье мы в основном используем пять наборов данных: EyePACS, FGADR [44], IDRiD [45], DRIVE [46] и частный набор данных оценки DR, предоставленный местной больницей (мы называем его частным набором данных). . EyePACS используется для получения масок, чтобы RF-GAN2 мог синтезировать с ними изображения глазного дна сетчатки и мог использоваться в качестве набора для обучения и тестирования моделей оценки DR. Набор сегментов FGADR используется для обучения моделей сегментации поражений, а набор степеней FGADR используется для оценки моделей классификации DR. IDRID используется для обучения модели сегментации диска зрительного нерва. DRIVE используется для обучения модели сегментации сосудов глазного дна. Частный набор данных используется для оценки эффективности моделей классификации DR. Подробное введение в пять наборов данных приведено ниже. EyePACS : набор данных, предоставленный EyePACS, содержит 35126 обучающих изображений и 53576 тестовых изображений, все из которых имеют только метки оценки DR. FGADR : набор данных состоит из набора Grade, который содержит 1000 изображений глазного дна сетчатки только с метками оценки DR, и набора Seg, который содержит 1842 изображения глазного дна сетчатки с аннотациями повреждений на уровне пикселей — микроаневризмами, твердыми экссудатами, мягкими экссудатами, кровоизлияниями. и т. д. «IDRID»: набор данных содержит в общей сложности 81 изображение, каждое с аннотациями на уровне пикселей диска зрительного нерва и поражений DR, таких как микроаневризмы, твердые экссудаты, мягкие экссудаты, кровоизлияния. DRIVE :  Всего в набор данных включено 40 изображений, 33 из которых не показывают никаких признаков диабетической ретинопатии, а 7 из них демонстрируют признаки легкой диабетической ретинопатии. Каждое изображение имеет аннотации сосудов глазного дна на уровне пикселей. Частный набор данных : Набор данных получен из местной больницы и помечен тремя офтальмологами. Частный набор данных содержит 2758 изображений сетчатки с различными критериями оценки DR от 0 до 4.

                    С целью повышения контрастности изображений глазного дна сетчатки в EyePACS для повышения точности оценки DR мы проводим адаптивное выравнивание гистограммы с ограниченным контрастом (CLAHE) на изображениях глазного дна сетчатки. Количество изображений в наборах данных FGADR, IDRiD и DRIVE очень мало по сравнению с EyePACS, что снижает производительность адаптации домена. Мы выполняем отсечение, переворачивание, вращение наборов данных FGADR, IDRID и DRIVE, а также неполную выборку EyePACS.

                    4.2. Эксперименты и результаты RF-GAN1

                    В этом разделе наборы данных семантической сегментации (IDRID, DRIVE и FGADR) используются в качестве исходного домена, а EyePACS — в качестве целевого домена. Мы используем RF-GAN1 для перевода изображений из исходного домена в целевой домен и используем переведенные изображения для обучения HR-Net. Затем мы применяем обученную HR-Net (мы принимаем U-Net [47], PSPNet [48], DeepLab v3 [49] и HR-Net в качестве моделей сегментации, и, наконец, мы обнаруживаем, что использование HR-Net является лучшим для сегментации сосудов, дисков зрительных нервов и различных поражений) для извлечения масок из EyePACS.

                    Для визуального сравнения мы используем CycleGAN для перевода изображений из наборов данных сегментации в EyePACS. Затем мы выбираем 300 изображений глазного дна сетчатки, переведенных с помощью CycleGAN и RF-GAN1 соответственно, и просим двух профессиональных офтальмологов оценить изображения. Часть переведенных изображений показана на рисунке 5. Кроме того, мы используем наборы данных, переведенные CycleGAN, для обучения HR-Net и применяем обученную HR-Net для извлечения масок. Затем мы выбираем 300 масок, извлеченных HR-Net, обученных с использованием исходных наборов данных сегментации, наборов данных сегментации, переведенных с помощью CycleGAN, и наборов данных сегментации, переведенных с помощью RF-GAN1, и просим двух профессиональных офтальмологов также оценить маски. Часть извлеченных Масок показана на Рисунке 6.

                    Подводим итоги отзывов двух офтальмологов. Первый предназначен для оценки переведенных изображений. Стиль изображений, переведенных CycleGAN, почти не изменился и остается похожим на стиль оригинального FGADR. Кроме того, после трансляции происходит частичная потеря информации о мелких повреждениях (как показано на рисунке 5). Однако точность изображений глазного дна сетчатки, переведенных с помощью RF-GAN1, лучше. Стиль аналогичен стилю EyePACS, а локальные детали изображений после перевода сохраняются лучше, чем у CycleGAN. Хотя после перевода с помощью RF-GAN1 все еще есть ошибки, влияние на обучение HR-Net невелико.

                    Второй для оценки Масок. HR-Net, обученный на исходных наборах данных, может обнаруживать относительно очевидные кровоизлияния и твердые экссудаты, но не мягкие экссудаты. Кроме того, модели не чувствительны к некоторым небольшим структурам или повреждениям, таким как микроаневризмы, небольшие области твердого экссудата, кровоизлияния и некоторые мелкие сосуды (как показано во второй колонке рисунка 6, только доля явных кровоизлияний и твердых экссудаты извлекаются, но большинство поражений, а также мелкие сосуды не извлекаются HR-Net). HR-Net, обученный с помощью наборов данных, переведенных с помощью CycleGAN, более чувствителен к небольшим участкам твердого экссудата по сравнению с моделями, обученными непосредственно с помощью исходных наборов данных, но по-прежнему не может сегментировать мягкий экссудат, а также микроаневризмы и некоторые мелкие сосуды (как показано в третьем столбце). На рис. 6 мы можем видеть некоторые тонкие участки твердого экссудата, но почти не можем заметить микроаневризмы, мягкий экссудат и некоторые мелкие сосуды). Производительность сегментации HR-Net, обученной с помощью наборов данных, переведенных RF-GAN1, лучше. Модели могут успешно сегментировать мелкие участки твердого экссудата и кровоизлияний, а также мягкий экссудат. Кроме того, модели более чувствительны к микроаневризмам и мелким сосудам (как показано в четвертой колонке рисунка 6, HR-Net способна извлекать не только очевидные поражения, такие как твердый экссудат и кровоизлияния, но и такие поражения, которые нелегко сегментировать, такие как как микроаневризмы, мягкие экссудаты. Кроме того, HR-Net хорошо работает для сегментации тонких сосудов). Ошибки в Масках хоть и есть, но в допустимых пределах.

                    По оценке офтальмологов мы видим, что RF-GAN1 лучше подходит для передачи стиля изображений глазного дна сетчатки, чтобы улучшить производительность сегментации в EyePACS. И, мы анализируем следующие причины этой ситуации. Во-первых, причиной плохой адаптации CycleGAN к предметной области может быть то, что модель попадает в локальный минимум. Генератор может обмануть дискриминатор, синтезируя изображения, очень близкие к исходным изображениям глазного дна сетчатки, но у дискриминатора недостаточно дискриминационных способностей, чтобы различить их. Во-вторых, отличные характеристики адаптации RF-GAN1 к домену обусловлены двумя причинами. (1) SiaNet может извлекать различные изображения глазного дна, чтобы модель не попадала в локальный минимум, чтобы обеспечить благоприятный перенос стиля. (2) Включение SiaNet и потери идентичности в модель генерации увеличивает внимание модели к локальным деталям, так что синтезированные изображения могут лучше сохранять информацию о структурах и поражениях.

                    Поскольку EyePACS не имеет аннотаций на уровне пикселей, невозможно количественно оценить производительность сегментации моделей, обученных наборами данных, преобразованными RF-GAN1 в EyePACS. Таким образом, в дополнительном материале мы используем набор данных сегментации для проверки способности сегментации объединения HR-Net с RF-GAN1 для поражений, связанных с DR, и сосудов глазного дна, чтобы показать способность RF-GAN1 к адаптации домена для изображений глазного дна сетчатки.

                    4.3. Эксперименты и результаты RF-GAN2

                    В этом разделе мы обучаем RF-GAN2 с масками и соответствующими изображениями глазного дна сетчатки и метками оценки DR, пока они не сойдутся. Затем мы используем Маски и метки оценки DR для синтеза 10000 изображений глазного дна сетчатки с RF-GAN2 для каждого уровня тяжести DR (в сгенерированных изображениях глазного дна есть изображения низкого качества, но мы не обрабатываем их, потому что их количество мало и мало влияют на обучение модели оценки DR). Чтобы количественно оценить синтезированные изображения, мы используем начальное расстояние Фреше (FID) [50] и расслоенное вассертейновое расстояние (SWD) для оценки изображений. Кроме того, синтезированные изображения добавляются в обучающий набор EyePACS для увеличения данных, и мы оцениваем эффективность моделей оценки DR на тестовом наборе EyePACS, FGADR и частном наборе данных.

                    4.3.1. Демонстрация производительности

                    Часть синтезированных изображений показана на рисунке 7. Следует отметить, что EyePACS, принятый для обучения RF-GAN2, обрабатывается CLAHE, поэтому стиль синтезированных изображений напоминает стиль EyePACS, обработанный CLAHE. Как видно из верхней части рисунка 7, с учетом меток оценки Маски и DR, RF-GAN2 может синтезировать изображения глазного дна сетчатки с высокой точностью, а внешний вид и количество поражений на изображениях можно манипулировать с помощью меток оценки DR. В нижней части рисунка 7 показаны детали синтезированных изображений. Структурная информация, такая как диск зрительного нерва, сосуды глазного дна, макула, и патологическая информация, такая как микроаневризмы, кровоизлияния, мягкие экссудаты и твердые экссудаты, могут быть четко видны.

                    4.3.2. Сравнение с другими моделями

                    FID является широко используемой метрикой оценки качества изображения, которая представляет собой меру для расчета расстояния векторов признаков между реальными изображениями и синтезированными изображениями. FID рассчитывается путем вычисления расстояния Фреше распределения Гаусса, построенного по признакам, извлеченным из реальных и синтезированных изображений в Inception-v3 [51]. Чем ниже оценка, тем выше сходство между синтезированными изображениями и реальными изображениями и тем лучше качество изображения. SWD также является широко используемой метрикой оценки качества изображения. SWD обычно используется для оценки качества изображений с высоким разрешением. Он рассчитывается путем оценки статистического сходства реальных и синтезированных изображений. Чем ниже SWD, тем выше качество изображения. Мы количественно оцениваем изображения глазного дна сетчатки, синтезированные RF-GAN2, CGAN, Pix2Pix [52] и Tub-sGAN [29].] с FID и SWD. Результаты показаны в таблице 2, а синтезированные изображения с помощью различных моделей показаны на рисунке 8.

                    Из таблицы 2 видно, что изображения глазного дна сетчатки, синтезированные с помощью RF-GAN2, достигают оценки FID 7,03 и оценки SWD 11,28. , что лучше, чем у Tub-sGAN и других базовых моделей. С визуальной точки зрения на рисунке 8 два офтальмолога делают следующие комментарии к синтезированным изображениям глазного дна сетчатки с помощью различных моделей. Изображения глазного дна сетчатки, синтезированные с помощью CGAN, могут видеть только контур глазного дна и некоторые из основных сосудов глазного дна, но не могут видеть подробную информацию о структурах и поражениях. Pix2Pix может синтезировать сосуды глазного дна и информацию о поражениях, но не может генерировать мелкие сосуды глазного дна и четкое макулярное изображение. Изображения глазного дна сетчатки, полученные с помощью Tub-sGAN, в целом удовлетворительны, но иногда макулярные области менее точны. RF-GAN2 превосходит предыдущие три метода тем, что может создавать изображения глазного дна сетчатки с четкой структурной информацией, такой как мелкие сосуды глазного дна и области макулы, а также с реалистичной информацией о поражениях, таких как кровоизлияния и твердые экссудаты.

                    Есть несколько причин превосходства RF-GAN2 над другими моделями. Во-первых, обучение HR-Net с помощью наборов данных сегментации, переведенных RF-GAN1, повышает производительность сегментации HR-Net на EyePACS. Таким образом, мы получаем более точные маски для обучения RF-GAN2, повышая чувствительность RF-GAN2 к поражениям. Во-вторых, RF-GAN2 использует двухступенчатый генератор, от грубой до точной. Генератор второго этапа наследует глобальные признаки, извлеченные генератором первого этапа, для дальнейшего синтеза локальных деталей, что повышает качество изображения. Наконец, введение потери классификации может контролировать категорию и количество поражений в соответствии с метками классификации DR, синтезируя более разнообразные паттерны сетчатки.

                    4.3.3. Увеличение данных путем синтеза для оценки DR

                    В этом разделе проверяется, может ли добавление синтезированных изображений в обучающий набор для увеличения данных быть полезным для обучения моделей оценки DR. Мы обучаем 3 базовые модели (VGG-19, ResNet-50 [53], Inception-v3), две конкурирующие модели оценки DR AFN [54] и Zhou et al. (DenseNet-121) [44] с добавлением и без добавления данных синтезированными изображениями. Мы только изменяем выходной размер последнего полносвязного слоя на 5 для базовых моделей. Для оценки мы используем точность классификации и квадратично взвешенную каппу. Мы тестируем их на тестовом наборе EyePACS, и экспериментальные результаты показаны в таблице 3. Чтобы оценить способность моделей классификации к обобщению, мы тестируем обученные модели на FGADR и нашем частном наборе данных, и результаты показаны в таблице 3. Таблица 4. В таблице 5 показана точность классификации различных уровней серьезности DR с помощью ResNet-50 при тестировании на тестовом наборе EyePACS с добавлением данных путем синтеза и без него. Рисунок 9иллюстрирует AUC (для каждой серьезности DR мы рассматриваем текущий уровень серьезности DR как положительный класс, а другие уровни серьезности как отрицательные классы) ResNet-50 для каждой серьезности DR с увеличением данных путем синтеза и без него.

                    В таблицах 3–5 Fake обозначает 50 000 синтезированных изображений. В таблице 3 показано, что точность и квадратично-взвешенная каппа каждой модели оценки DR в тестовом наборе EyePACS увеличиваются в среднем на 1,63% и 1,82% соответственно. Точность и квадратично взвешенная каппа конкурирующих моделей классификации DR AFN и Zhou (DenseNet-121) увеличиваются на 1,49.%, 1,68% и 1,53%, 1,70% соответственно, что свидетельствует об эффективности нашего метода. Чтобы оценить способность обученных моделей к обобщению, мы тестируем модель на частном наборе данных и наборе оценок FGADR (ранее модели классификации не настраивались на этих двух наборах данных). Как показано в таблице 4, мы обнаружили, что точность и квадратично взвешенная каппа увеличиваются в среднем на 1,24%, 1,35% и 1,04%, 1,13% для частного набора данных и набора оценок FGADR, соответственно, при добавлении синтезированных изображений в обучающую выборку для аугментация данных, что доказывает обобщающую способность моделей DR, обученных синтезом. Как видно из таблицы 5, точность классификации каждого уровня серьезности DR ResNet-50 увеличивается на 1,35%, 1,73%, 1,43%, 2,38% и 1,78% соответственно. Аналогично, на рисунке 9, AUC каждого уровня серьезности DR ResNet-50 увеличивается на 0,0088, 0,0146, 0,0047, 0,0141 и 0,0089 соответственно. Точность и AUC каждого уровня серьезности DR увеличиваются, особенно для высокого уровня серьезности, где изображений немного. Кроме того, увеличение AUC для легкого NPDR также является значительным, и мы считаем, что аугментация данных путем синтеза позволяет модели классификации DR узнать больше о различительных особенностях между легким NPDR и нормальным изображением глазного дна сетчатки, что приводит к увеличению AUC. Основываясь на приведенных выше экспериментах, мы можем сделать вывод, что RF-GAN могут синтезировать реалистичные изображения глазного дна сетчатки и быть полезными для обучения моделей оценки DR.

                    5. Обсуждение
                    5.1. Стабильность обучения

                    Поскольку в RF-GAN1 и RF-GAN2 применяется множество функций потерь, мы хотели бы построить кривую потерь и показать изображения, созданные в разные эпохи, чтобы проверить стабильность обучения модели. На рисунке 10 показана кривая потерь RF-GAN1 (рисунок 10(a)) и RF-GAN2 (рисунок 10(b)), и мы наносим точки через каждые 20 итераций. На рисунке 11 показаны синтезированные изображения глазного дна сетчатки из разных эпох с помощью RF-GAN1 (рис. 11 (а)) и RF-GAN2 (рис. 11 (б)). На рисунке 10 (а) показана кривая потерь при переводе изображений из FGADR в EyePACS, а две другие кривые потерь RF-GAN1 (DRIVE в EyePACS и IDRiD в EyePACS) аналогичны рисунку 10 (а). Из рисунка 10 (а) видно, что модель сильно колеблется в начале, и модель сходится примерно после 14000 итераций, но все еще немного колеблется после сходимости. Как видно из рисунка 11(а), глобальные особенности, включая диск зрительного нерва, макулу и кровеносные сосуды на всем глазном дне, почти транслируются на 20-й эпохе (около 4000 итераций). Небольшие поражения и структуры, такие как кровоизлияния и мелкие сосуды, переносятся на 60-м этапе (около 12000 итераций). После 80 эпох (около 16000 итераций) изображения глазного дна в основном завершают трансляцию, после чего модель сходится. Из рисунка 10(b) видно, что обучение модели нестабильно, и модель сходится после 40 000 итераций, но все еще имеет некоторые колебания. Как видно из рисунка 11(b), синтезированные изображения приобретают глобальные стилизованные признаки и компоненты на 40-й эпохе (около 16000 итераций), такие как взаимное расположение диска зрительного нерва, сосудов. На 80-й эпохе (около 32000 итераций) появляются некачественные изображения, такие как аномальные области макулы и выпадение мелких сосудов, что свидетельствует о колебаниях RF-GAN2. От 100 до 120 эпох (примерно от 40 000 до 50 000 итераций) сгенерированные изображения глазного дна постепенно стабилизируются, и модель начинает сходиться. Мы видим, что применение большого количества функций потерь может вызвать нестабильность во время обучения модели, что неизбежно. Однако функции потерь, применяемые RF-GAN1 и RF-GAN2, полезны для повышения точности и разнообразия сгенерированных изображений глазного дна сетчатки. Поэтому мы решили использовать функции множественных потерь и внимательно следить за синтезированными изображениями и кривыми потерь.

                    5.2. Разнообразие

                    Мы подвергаем сомнению использование масок и меток оценки DR для создания изображений глазного дна сетчатки, чтобы увеличить разнообразие набора данных. В частности, мы хотим знать, идентичны ли сгенерированные изображения глазного дна сетчатки исходным изображениям, поэтому мы сравниваем синтезированные изображения с исходными изображениями. Как показано на рисунке 12, мы выбрали несколько примеров создания изображений глазного дна сетчатки из исходных изображений, чтобы проверить разнообразие синтезированных изображений. На рисунке 12 это исходные изображения, соответствующие маски, извлеченные обученной HR-Net, и синтезированные изображения сверху вниз. Серьезность DR синтезированных изображений составляет от 0 до 4 слева направо. Как исходное, так и сгенерированное изображения в первом столбце являются нормальными изображениями глазного дна сетчатки, и мы наблюдаем, что синтезированные изображения имеют более четкую информацию о деталях, чем исходные изображения, что очень полезно для оценки DR. Серьезность DR исходного и синтезированного изображений во втором и третьем столбцах — легкая NPDR и умеренная NPDR соответственно. Чтобы облегчить наблюдение, мы помечаем поражения ограничивающими рамками на исходных изображениях и сгенерированных изображениях соответственно. Мы видим, что синтезированные изображения имеют практически ту же структурную информацию, что и исходные изображения. Кроме того, мы наблюдаем, что категории поражений остаются практически такими же, но количество и внешний вид различных поражений и мест меняются, что увеличивает разнообразие набора данных, гарантируя, что тяжесть DR синтезированных изображений остается неизменной. Четвертый и пятый столбцы показывают, что мы используем маски нормальных изображений глазного дна сетчатки для синтеза изображений глазного дна тяжелой степени NPDR и PDR соответственно. Мы видим, что, хотя ни исходные изображения глазного дна сетчатки, ни маски не содержат информации о поражении, мы все же можем генерировать изображения глазного дна сетчатки соответствующего уровня серьезности DR, указав метки оценки DR при их синтезе. Из приведенных выше примеров мы видим, что наш метод способен синтезировать визуально разные изображения глазного дна сетчатки в зависимости от заданных меток и масок оценки DR, увеличивая разнообразие набора данных.

                    5.3. Ограничения

                    Хотя наш подход позволяет синтезировать высококачественные изображения глазного дна сетчатки, все еще существуют некоторые ограничения, которые необходимо устранить. На рис. 13 показаны три основных вида отказов, наблюдаемых на синтезированных изображениях. Рисунок 13(а) показывает, что изображение недостаточно круглое. Поскольку на форму сгенерированного изображения глазного дна сетчатки влияют деревья сосудов, полученные с помощью моделей сегментации, если распределение сосудов в масках недостаточно округлено, это также может повлиять на сгенерированные изображения глазного дна сетчатки. На рисунке 13(b) показан случай, когда информация о структурах и поражениях на изображении не может быть четко видна из-за низкой освещенности (как показано в нижней части рисунка 13(b)). Хотя мы используем CLAHE для повышения контрастности изображений глазного дна в EyePACS, некоторые изображения низкого качества все еще присутствуют. Под влиянием этих изображений RF-GAN2 иногда создает изображения глазного дна сетчатки низкого качества, как на рис. 13(b). На рисунке 13(с) граница диска зрительного нерва нечеткая, и это связано с двумя причинами. С одной стороны, маска диска зрительного нерва, которую мы получаем во время сегментации, недостаточно точна и, таким образом, влияет на форму диска зрительного нерва на сгенерированных изображениях глазного дна. С другой стороны, граница диска зрительного нерва на исходном изображении глазного дна нечеткая, поэтому генератор преобразует часть, которая не является диском зрительного нерва, в часть диска зрительного нерва в сгенерированном изображении. В дополнение к вышеперечисленным проблемам при создании изображений, двухэтапная генерация изображений глазного дна сетчатки этим методом также несколько громоздка, но это гарантирует, что мы можем генерировать высококачественные изображения глазного дна сетчатки.

                    6. Заключение

                    В этой статье предлагается метод генерации изображений глазного дна сетчатки RF-GAN на основе генеративно-состязательной сети, которая состоит из RF-GAN1 и RF-GAN2. RF-GAN1 переводит изображения из исходного домена в целевой домен, чтобы улучшить характеристики сегментации структур и поражений HR-Net для изображений из EyePACS. RF-GAN2 использует метки оценки Masks и DR для синтеза изображений глазного дна сетчатки. Эксперименты показывают, что HR-Net, обученный с помощью переведенных наборов данных, обеспечивает лучшую производительность сегментации структур и поражений, связанных с DR, в EyePACS, а изображения глазного дна сетчатки, синтезированные с помощью RF-GAN2, превосходят модель основного поколения и Tub-sGAN в FID и SWD. При добавлении синтезированных изображений в обучающую выборку для аугментации данных точность и квадратично-взвешенная каппа моделей оценки ДР (VGG-19, ResNet-50, Inception-v3, AFN, Zhou (DenseNet-121)) на тестовом наборе EyePACS увеличиваются в среднем на 1,63% и 1,82% соответственно. Мы также демонстрируем способность моделей к обобщению, используя набор оценок FGADR, а также частный набор данных для тестирования обученных моделей оценки DR. Кроме того, точность и AUC каждого уровня серьезности аварийного восстановления в ResNet-50 улучшаются. Результаты показывают, что RF-GAN обещают будущее. Однако мы также замечаем, что слабые изображения NPDR часто ошибочно классифицируются как нормальные изображения, поскольку они близки к нормальным изображениям глазного дна сетчатки, что значительно снижает точность классификации. В будущей работе мы рассмотрим, как повысить чувствительность моделей оценки DR для изображений глазного дна сетчатки легкой степени NPDR с помощью GAN.

                    Доступность данных

                    Частный набор данных, использованный для поддержки результатов этого исследования, не был доступен из-за конфиденциальности пациентов, а другие наборы данных взяты из ранее опубликованных исследований и наборов данных, которые были процитированы.

                    Конфликт интересов

                    Авторы заявляют об отсутствии конфликта интересов в отношении публикации данной статьи.

                    Благодарности

                    Эта работа была поддержана Национальным фондом естественных наук Китая (61300098), Фонд естественных наук провинции Хэйлунцзян (F201347) и Фонды фундаментальных исследований центральных университетов (2572015DY07).

                    Дополнительные материалы

                    Количественная оценка RF-GAN1. (дополнительные материалы)

                    Ссылки
                    1. Офтальмоскопия, расширенный и E.T.D.R.S. уровни. Международная клиническая шкала тяжести заболевания диабетической ретинопатией, подробная таблица , Американская академия офтальмологии, Сан-Франциско, США, 2002 г.

                    2. Z. Wang, Y. Yin, J. Shi, W. Fang, H. Li и X. Wang, «Zoom-in-net: глубокий анализ поражений для выявления диабетической ретинопатии», в Proceedings of the Международная конференция по обработке медицинских изображений и компьютерному вмешательству , стр. 267–275, Квебек, Канада, 2017 г. B. Cochener и M. Lamard, «Глубокий анализ изображений для скрининга диабетической ретинопатии», Анализ медицинских изображений , vol. 39, стр. 178–193, 2017.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    3. С. Ван, Ю. Лян и Ю. Чжан, «Глубокие сверточные нейронные сети для обнаружения диабетической ретинопатии с помощью классификации изображений», Computers & Electrical Engineering , vol. 72, стр. 274–282, 2018.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    4. M. T. Esfahani, M. Ghaderi и R. Kafiyeh, «Классификация диабетических и нормальных изображений глазного дна с использованием нового метода глубокого обучения», Leonardo Electronic Journal of Practices and Technologies , vol. 17, нет. 32, pp. 233–248, 2018.

                      Посмотреть по адресу:

                      Google Scholar

                    5. С. Куммар, Ф. Г. Хан, С. Шах и др., «Подход ансамбля глубокого обучения для обнаружения диабетической ретинопатии», IEEE Access , том. 7, стр. 150530–150539, 2019.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    6. Х. Цзян, К. Ян, М. Гао, Д. Чжан, Х. Ма и В. Цянь, «Интерпретируемая ансамблевая модель глубокого обучения для классификации заболеваний диабетической ретинопатии», в Материалы 41-й ежегодной международной конференции IEEE Engineering in Medicine and Biology Society (EMBC) , стр. 2045–2048, Берлин, Германия, июль 2019 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    7. Ю.-П. Лю, З. Ли, К. Сюй, Дж. Ли и Р. Лян, «Референтная идентификация диабетической ретинопатии по изображениям глазного дна с взвешенным путем для сверточной нейронной сети», Искусственный интеллект в медицине , том. 99, ID статьи 101694, 2019.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    8. «Конкурс Kaggle по обнаружению диабетической ретинопатии», 2015 г. , https://www.kaggle.com/c/diabetic-retinopathy-detection.

                      Посмотреть по адресу:

                      Google Scholar

                    9. Х. Иноуэ, «Увеличение данных путем объединения образцов для классификации изображений», 2018 г., https://arxiv.org/abs/1801.02929.

                      Посмотреть по адресу:

                      Академия Google

                    10. С. Юн, Д. Хан, С. Чун, С. Дж. О, Ю. Ю и Дж. Чоу, «CutMix: стратегия регуляризации для обучения сильных классификаторов с локализуемыми функциями», в Proceedings of the IEEE/CVF International Conference on Computer Vision , стр. 6023–6032, Сеул, Южная Корея, октябрь 2019 г.

                      Просмотр по адресу:

                      Сайт издателя | Google Scholar

                    11. А. Эстабрукс, Т. Джо и Н. Япкович, «Метод многократной повторной выборки для обучения на несбалансированных наборах данных», Computational Intelligence , том. 20, нет. 1, стр. 18–36, 2004 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    12. Н. В. Чавла, К. В. Бойер, Л. О. Холл и В. П. Кегельмейер, «SMOTE: метод избыточной выборки синтетического меньшинства», Journal of Artificial Intelligence Research , vol. 16, нет. 1, стр. 321–357, 2002.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    13. Х. Хан, В.-Ю. Ван и Б.-Х. Мао, «Borderline-SMOTE: новый метод избыточной выборки в обучении несбалансированным наборам данных», в Proceedings of the International Conference on Intelligent Computing , pp. 878–887, HeFei, Anhui, China, 2005.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    14. X. Y. Xu-Ying Liu, J. Jianxin Wu и Z. H. Zhou, «Исследовательская неполная выборка для изучения дисбаланса классов», IEEE Transactions on Systems, Man, and Cybernetics, Part B (Cybernetics) , vol. . 39, нет. 2, стр. 539–550, 2009 г.

                      Посмотреть по адресу:

                      Сайт издателя | Академия Google

                    15. И. Дж. Гудфеллоу, Дж. Пуже-Абади, М. Мирза и др., «Генеративные состязательные сети», 2014 г., https://arxiv.org/abs/1406.2661.

                      Посмотреть по адресу:

                      Google Scholar

                    16. А. Рэдфорд, Л. Мец и С. Чинтала, «Обучение без учителя с помощью глубоких сверточных генеративно-состязательных сетей», 2015 г., https://arxiv.org/abs/ 1511.06434.

                      Посмотреть по адресу:

                      Google Scholar

                    17. М. Мирза и С. Осиндеро, «Условные генеративные состязательные сети», 2014 г., https://arxiv.org/abs/1411.1784.

                      Посмотреть по адресу:

                      Google Scholar

                    18. М. Аржовски, С. Чинтала и Л. Боттоу, «Wasserstein GAN», 2017 г., https://arxiv.org/abs/1701.07875.

                      Посмотреть по адресу:

                      Google Scholar

                    19. А. Брок, Дж. Донахью и К. Симонян, «Крупномасштабное обучение GAN для высокоточного синтеза естественных изображений», 2018 г., https://arxiv.org/abs /1809.11096.

                      Посмотреть по адресу:

                      Google Scholar

                    20. Чжу Дж. Ю., Пак Т., Изола П. и Эфрос А. А. «Непарный перевод изображения в изображение с использованием согласованных по циклу состязательных сетей», в Proceedings of the IEEE International Conference on Computer Vision , стр. 2242–2251, Венеция, Италия, октябрь 2017 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    21. Л. Вей, С. Чжан, В. Гао и К. Тянь, «Передача данных по GAN для устранения разрыва домена для повторной идентификации личности», в Трудах конференции IEEE/CVF по компьютерному зрению и распознавание образов , стр. 79–88, Солт-Лейк-Сити, Юта, США, июнь 2018 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    22. Y. Kuang, T. Lan, X. Peng, GE Selasi, Q. Liu, and J. Zhang, «Неконтролируемая многодискриминационная генерирующая состязательная сеть для классификации злокачественных новообразований в легких», IEEE Access , об. 8, стр. 77725–77734, 2020.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    23. H. Yang, J. Sun, A. Carass et al., «Неконтролируемый синтез MR-to-CT с использованием структурно ограниченного CycleGAN», IEEE Transactions on Medical Imaging , том. 39, нет. 12, стр. 4249–4261, 2020.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    24. Х. Зунэйр и А. Б. Хамза, «Синтез рентгенограмм грудной клетки COVID-19 с использованием непарного перевода изображения в изображение», Анализ и анализ социальных сетей , том. 11, нет. 1, стр. 1–12, 2021.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    25. Ю. Цзян, Х. Чен, М. Лоу и Х. Ко, «Синтез КТ-изображений COVID-19 с условной генеративной состязательной сетью», IEEE Journal of Biomedical and Health Informatics , vol. 25, нет. 2, pp. 441–452, 2020.

                      Просмотр по адресу:

                      Google Scholar

                    26. Q. Jin, H. Cui, C. Sun, Z. Meng и R. Su, «Синтез опухоли в произвольной форме» в компьютерных томографических изображениях через более богатую генеративную состязательную сеть», , основанные на знаниях системы, , том. 218, ID статьи 106753, 2021.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    27. П. Коста, А. Галдран, М. И. Мейер и др., «Сквозной состязательный синтез изображений сетчатки глаза», IEEE Transactions on Medical Imaging , vol. 37, нет. 3, pp. 781–791, 2017.

                      Просмотр по адресу:

                      Google Scholar

                    28. Х. Чжао, Х. Ли, С. Маурер-Строг и Л. Ченг, «Синтез изображений сетчатки и нейронов с помощью генеративных противоборствующие сети», Анализ медицинских изображений , vol. 49, стр. 14–26, 2018 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    29. А. Диас-Пинто, А. Коломер, В. Наранхо, С. Моралес, Ю. Сюй и А. Ф. Франги, «Синтез изображений сетчатки и частично контролируемое обучение для оценки глаукомы», IEEE Transactions on Medical Imaging , vol. 38, нет. 9, стр. 2211–2218, 2019.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    30. Y. Niu, L. Gu, F. Lu et al., «Исследование патологических данных в глубокой диагностике изображений сетчатки», в Proceedings of the AAAI Conference on Artificial Intelligence , стр. 1093–1101, Гонолулу, Гавайи, США, 2019 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    31. П. М. Бурлина, Н. Джоши, К. Д. Пачеко, Т. Я. Лю и Н. М. Бресслер, «Оценка глубоких генеративных моделей для создания синтетических изображений сетчатки с высоким разрешением для возрастной дегенерации желтого пятна», JAMA офтальмология , том. 137, нет. 3, стр. 258–264, 2019.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    32. Т. К. Ю, Дж. Ю. Чой и Х. К. Ким, «Техника глубокого обучения на основе CycleGAN для уменьшения артефактов в фотографии глазного дна», Graefes Archive for Clinical and Experimental Ophthalmology , vol. 258, нет. 8, стр. 1631–1637, 2020.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    33. А. Тавакколи, С. А. Камран, К. Ф. Хоссейн и С. Л. Цукерброд, «Новая условная генеративно-состязательная сеть с глубоким обучением для создания ангиографических изображений из фотографий глазного дна сетчатки», Научные отчеты , том. 10, нет. 1, стр. 21580–21615, 2020.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    34. Г. Лим, П. Томбре, М. Л. Ли и В. Хсу, «Увеличение генеративных данных для классификации диабетической ретинопатии», в Трудах 32-й Международной конференции IEEE 2020 г. по инструментам с искусственным интеллектом (ICTAI) , стр. 1096–1103, Балтимор, штат Мэриленд, США, ноябрь 2020 г.

                      Посмотреть по адресу:

                      Сайт издателя | Академия Google

                    35. Т. Каррас, С. Лейн и Т. Айла, «Архитектура генератора на основе стилей для генеративно-состязательных сетей», в материалах Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition , стр. 4401 –4410, Лонг-Бич, Калифорния, США, июнь 2019 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    36. С. Ван, С. Ван, Ю. Ху и др., «Диагностика диабетической ретинопатии с использованием многоканальной генеративно-состязательной сети с полунаблюдением», IEEE Transactions on Automation Science and Engineering , vol. 18, нет. 2, pp. 574–585, 2020.

                      Просмотр по адресу:

                      Google Scholar

                    37. Т. Ян, Т. Ву, Л. Ли и К. Чжу, «SUD-GAN: генеративно-состязательная сеть с глубокой сверткой в сочетании с коротким соединением и плотным блоком для сегментации сосудов сетчатки», Journal of Digital Imaging , vol. 33, нет. 4, стр. 946–957, 2020.

                      Посмотреть по адресу:

                      Сайт издателя | Академия Google

                    38. К. Сунь, Б. Сяо, Д. Лю и Дж. Ван, «Глубокое обучение представлению с высоким разрешением для оценки позы человека», в Трудах конференции IEEE/CVF по компьютерному зрению и распознаванию образов , стр. 5693–5703, Лонг-Бич, Калифорния, США, июнь 2019 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    39. Т. К. Ван, М. Ю. Лю, Дж. Ю. Чжу, А. Тао, Дж. Каутц и Б. Катандзаро, «Синтез изображений с высоким разрешением и семантическая манипуляция с условными GAN», в Труды конференции IEEE/CVF по компьютерному зрению и распознаванию образов , стр. 9798–8807, Солт-Лейк-Сити, Юта, США, июнь 2018 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    40. Р. Хадселл, С. Чопра и Ю. ЛеКун, «Уменьшение размерности путем изучения инвариантного отображения», в Трудах конференции IEEE Computer Society по компьютерному зрению и распознаванию образов , стр. 1735– 1742, Нью-Йорк, США, 2006.

                      Вид:

                      Google Scholar

                    41. С. Иоффе и К. Сегеди, «Пакетная нормализация: ускорение глубокого обучения сети за счет уменьшения внутреннего ковариатного сдвига», в Proceedings of the International Conference on Machine Learning , стр. 448–456, Лилль , France, 2015.

                      Просмотр по адресу:

                      Google Scholar

                    42. Симонян К., Зиссерман А. Очень глубокие сверточные сети для крупномасштабного распознавания изображений, 2014, https://arxiv.org/abs /1409.1556.

                      Посмотреть по адресу:

                      Google Scholar

                    43. Y. Zhou, B. Wang, L. Huang, S. Cui и L. Shao, «Эталон для изучения диабетической ретинопатии: сегментация, классификация и переносимость». IEEE Transactions on Medical Imaging , vol. 40, нет. 3, pp. 818–828, 2020.

                      Просмотр по адресу:

                      Google Scholar

                    44. P. Porwal, S. Pachade, R. Kamble et al., «Индийский набор данных изображений диабетической ретинопатии (IDRID): база данных для скрининговых исследований диабетической ретинопатии» Данные , том. 3, нет. 3, 25 страниц, 2018 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    45. Дж. Стаал, М. Д. Абрамофф, М. Нимейер, М. А. Виргевер и Б. Ван Гиннекен, «Сегментация сосудов на основе гребня в цветных изображениях сетчатки», IEEE Transactions on Medical Imaging , vol. 23, нет. 4, стр. 501–509, 2004.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    46. О. Роннебергер, П. Фишер и Т. Брокс, «U-net: сверточные сети для сегментации биомедицинских изображений», в Материалы Международной конференции по обработке медицинских изображений и компьютерному вмешательству , стр. 234–241, Мюнхен, Германия, 2015 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    47. Х. Чжао, Дж. Ши, С. Ци, С. Ван и Дж. Цзя, «Сеть синтаксического анализа сцены пирамиды», в материалах Proceedings of the IEEE Conference on Computer Vision and Pattern Recognition , стр. 2881–2890, Гонолулу, Гавайи, США, июль 2017 г.

                      Посмотреть по адресу:

                      Сайт издателя | Академия Google

                    48. Л.-К. Чен, Г. Папандреу, Ф. Шрофф и Х. Адам, «Переосмысление сложной свертки для семантической сегментации изображений», 2017 г., https://arxiv.org/abs/1706.05587.

                      Посмотреть по адресу:

                      Google Scholar

                    49. М. Хойзел, Х. Рамзауэр, Т. Унтертинер, Б. Несслер и С. Хохрайтер, «GAN, обученные с помощью правила обновления с двумя временными масштабами, сходятся к локальному нэшу. равновесия», в Proceedings of the Advances in Neural Information Processing Systems , стр. 6626–6637, Лонг-Бич, Калифорния, США, 2017.

                      Посмотреть по адресу:

                      Google Scholar

                    50. C. Szegedy, V. Vanhoucke, S. Ioffe, J. Shlens и Z. Wojna, «Rethinking the inception architecture for computer Vision», в Proceedings of the IEEE. Conference on Computer Vision and Pattern Recognition , стр. 2818–2826, Лас-Вегас, Невада, США, 2016 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    51. П. Исола, Дж. Ю. Чжу, Т. Чжоу и А. А. Эфрос, «Перевод изображения в изображение с условными состязательными сетями», в Труды конференции IEEE по компьютерному зрению и распознаванию образов , стр. 5967–5976, Гонолулу, Гавайи, США, 2017 г.

                      Посмотреть по адресу:

                      Сайт издателя | Google Scholar

                    52. K. He, X. Zhang, S. Ren и J. Sun, «Глубокое остаточное обучение для распознавания изображений», в Proceedings of the IEEE Conference on Computer Vision and Pattern Recognition , стр. 770 –778, Лас-Вегас, Невада, США, 2016 г.

                      Посмотреть по адресу:

                      Сайт издателя | Академия Google

                    53. Z. Lin, R. Guo, Y. Wang et al., «Система выявления диабетической ретинопатии на основе обнаружения помех и слияния на основе внимания», в Proceedings of the International Conference on Medical Image Computing. и компьютерное вмешательство , стр. 74–82, Гранада, Испания, 2018 г.

                      Просмотр по адресу:

                      Сайт издателя | Google Scholar

                    Copyright

                    Copyright © 2021 Yu Chen et al. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего цитирования оригинальной работы.

                    Тоширо Осуми | Harvard Catalyst Profiles

                    Новейшие | Самый старый | Самые цитируемые | Самые обсуждаемые | График | Сводка полей | Простой текст

                    PMC Citations показывает, сколько раз публикация цитировалась в статьях в PubMed Central, а показатель Altmetric отражает цитирование в новостных статьях и социальных сетях. (Обратите внимание, что публикации часто цитируются дополнительными способами, которые здесь не показаны.) Поля основаны на том, как Национальная медицинская библиотека (NLM) классифицирует журнал публикации, и могут не отражать конкретную тему публикации. Теги перевода основаны на типе публикации и терминах MeSH, которые NLM присваивает публикации. Некоторым публикациям (особенно новым и публикациям не в PubMed) могут быть еще не назначены теги Field или Translation.) Щелкните тег «Поле» или «Перевод», чтобы отфильтровать публикации.

                    1. Адам С., Росси С.Е., Моатти Н., Де Марко Сомпит М., Сюэ Ю., Нг Т.Ф., Альварес-Куилон А., Дежардинс Дж., Бхаскаран В., Мартино Г., Сетиапутра Д., Ноордермеер С.М., Осуми Т.К., Хустедт Н., Сцилард Р.К., Чаудхари N, Munro M, Veloso A, Melo H, Yin SY, Papp R, Young JTF, Zinda M, Stucki M, Durocher D. Ось CIP2A-TOPBP1 защищает стабильность хромосом и является синтетической летальной мишенью для рака с мутацией BRCA. Нат Рак. 2021 12; 2(12):1357-1371. PMID: 35121901.

                      Цитаты: 5     Перевод:Люди

                    2. Уорд Х. Н., Ареггер М., Гонатопулос-Пурнацис Т., Биллманн М., Осуми Т.К., Браун К.Р., Бленкоу Б.Дж., Моффат Дж., Майерс С.Л. Анализ комбинаторных экранов CRISPR с конвейером оценки Orthrus. Нат Проток. 2021 10; 16(10):4766-4798. PMID: 34508259; PMCID: PMC19.

                      Цитаты: 1     Поля: 

                      Cli Clinical Laboratory TechniquesSci Science

                    3. Badran YR, Dedeoglu F, Leyva Castillo JM, Bainter W, Ohsumi TK, Bousvaros A, Goldsmith JD, Geha RS, Chou J. Гаплонедостаточность RELA человека приводит к аутосомно-доминантному хроническому кожно-слизистому изъязвлению. J Эксперт Мед. 03 июля 2017 г .; 214(7):1937-1947. PMID: 28600438; PMCID: PMC5502421.

                      Цитаты: 22     Поля: 

                      Вся аллергология и иммунология Медицина (общая)

                         Перевод: HumansAnimalsCells

                    4. Massaad MJ, Zhou J, Tsuchimoto D, Chou J, Jabara H, Janssen E, Glauzy S, Olson BG, Morbach H, Ohsumi TK, Schmitz K, Kyriacos M, Kane J, Torisu K, Nakabeppu Y, Notarangelo LD, Chouery E , Мегарбане А., Канг П.Б., Аль-Идрисси Э., Альдекри Х., Меффре Э., Мизуи М., Цокос Г.К., Манис Дж.П., Аль-Герц В. , Уоллес С.С., Геха Р.С. Дефицит базового фермента эксцизионной репарации NEIL3 приводит к повышенной предрасположенности к аутоиммунитету. Джей Клин Инвест. 2016 11 01; 126(11):4219-4236. PMID: 27760045; PMCID: PMC5096910.

                      Цитаты: 34     Поля: 

                      Медицина (общая)

                         Перевод: HumansAnimalsCells

                    5. Ханна С., Парди Д.С., Келли Ч.Р., Крафт К.С., Дере Т., Хенн М.Р., Ломбардо М.Дж., Вулич М., Осуми Т., Винклер Дж., Пиндар С., Макговерн Б.Х., Померанц Р.Дж., Аунинс Дж.Г., Кук Д.Н., Хохманн Э. Л. Новый терапевтический микробиом увеличивает микробное разнообразие кишечника и предотвращает рецидив инфекции Clostridium difficile. J заразить дис. 2016 07 15; 214(2):173-81. PMID: 262.

                      Цитаты: 111     Поля: 

                      Коммуникационные заболевания

                         Перевод: HumansCellsPHPublic Health

                    6. Джабара Х.Х., Бойден С.Э., Чоу Дж., Рамеш Н., Массаад М.Дж., Бенсон Х., Бейнтер В., Фраулино Д., Рахимов Ф., Сифф С., Лю З.Дж., Альшеммари С.Х., Аль-Рамади Б.К., Аль-Декри Х., Арнаут Р., Абу -Шукаир М. , Ватсаян А., Сильвер Э., Ахуджа С., Дэвис Э.Г., Сола-Виснер М., Осуми Т.К., Эндрюс Н.С., Нотаранжело Л.Д., Флеминг М.Д., Аль-Герц В., Кункель Л.М., Геха Р.С. Миссенс-мутация в TFRC, кодирующем рецептор трансферрина 1, вызывает комбинированный иммунодефицит. Нат Жене. 2016 янв; 48(1):74-8. PMID: 26642240.

                      Цитаты: 84     Поля: 

                      Gen Genetics

                         Перевод:HumansAnimalsCells

                    7. Yee CS, Massaad MJ, Bainter W, Ohsumi TK, Föger N, Chan AC, Akarsu NA, Aytekin C, Ayvaz DÇ, Tezcan I, Sanal Ö, Geha RS, Chou J. Рецидивирующие вирусные инфекции, связанные с гомозиготной мутацией CORO1A, которая нарушает олигомеризация и ассоциация цитоскелета. J Аллергия Клин Иммунол. 2016 март; 137(3):879-88.e2. PMID: 26476480; PMCID: PMC4783242.

                      Цитаты: 13     Поля: 

                      All Allergy and Immunology

                         Translation:HumansAnimalsCells

                    8. Доббс К., Домингес Конде С., Чжан С.Ю., Паролини С., Одри М., Чоу Дж., Хаапаниеми Э., Келес С., Билич И., Окада С., Массаад М.Дж., Руниоха С., Алвахадне А.М., Сервас Н.К., Капудер К. , Чифтчи Э., Фельгентрефф К., Осуми Т.К., Педергнана В., Буассон Б., Хаскологлу С., Энсари А., Шустер М., Моретта А., Итан Ю., Патризи О., Розенберг Ф., Лебон П., Саарела Дж., Книп М., Петровски С., Гольдштейн Д.Б., Паррот Р.Е., Савас Б., Шамбах А., Табеллини Г., Бок С., Чатила Т.А., Комо А.М., Геха Р.С., Абель Л., Бакли Р.Х., Икинчиогуллари А., Аль-Герц В., Хельминен М., Догу Ф., Казанова Д.Л., Бозтуг К., Нотаранжело Л.Д. Унаследованный дефицит DOCK2 у пациентов с ранними инвазивными инфекциями. N Engl J Med. 2015 18 июня; 372(25):2409-22. PMID: 26083206; PMCID: PMC4480434.

                      Цитаты: 78     Поля: 

                      Медицина (общая)

                         Перевод: HumanCells

                    9. Чоу Дж. , Бадран Ю.Р., Йи ЦСК, Бейнтер В., Осуми Т.К., Аль-Хаммади С., Пай С.Ю., Феске С., Геха Р.С. Новая мутация в ORAI1, проявляющаяся комбинированным иммунодефицитом и остаточной функцией Т-клеток. J Аллергия Клин Иммунол. 2015 авг; 136(2):479-482.e1. PMID: 26070885; PMCID: PMC4530045.

                      Цитаты: 14     Поля: 

                      All Allergy and Immunology

                         Translation:HumansCells

                    10. Шарбоннье Л.М., Янссен Э., Чоу Дж., Осуми Т.К., Келес С., Хсу Дж.Т., Массаад М.Дж., Гарсия-Льорет М., Ханна-Ваким Р., Дбайбо Г. , Алангари А.А., Алсултан А., Аль-Захрани Д., Геха Р.С., Чатила Т.А. . Дефицит регуляторных Т-клеток и иммунная дисрегуляция, полиэндокринопатия, энтеропатия, X-сцепленное заболевание, вызванное мутациями потери функции в LRBA. J Аллергия Клин Иммунол. 2015 янв; 135(1):217-27. PMID: 25468195; PMCID: PMC4289093.

                      Цитаты: 91     Поля: 

                      All Allergy and Immunology

                         Translation:HumansCells

                    11. Hedayat M, Massaad MJ, Lee YN, Conley ME, Orange JS, Ohsumi TK, Al-Herz W, Notarangelo LD, Geha RS, Chou J. Уроки охоты за генами: мутация RAG1, проявляющаяся агаммаглобулинемией и отсутствием B-клеток. J Аллергия Клин Иммунол. 2014 Октябрь; 134(4):983-5.e1. PMID: 24985406; PMCID: PMC4186892.

                      Цитаты: 5     Поля: 

                      All Allergy and Immunology

                         Translation:HumansCells

                    12. Филлипс К.М., Монтгомери Б.Э., Брин П.К., Руверс Э.Ф., Рим Ю.С., Осуми Т.К., Ньюман М.А., ван Вольфсвинкель Дж.К., Кеттинг Р.Ф., Рувкун Г., Монтгомери Т.А. Геликазы бокс-РНК MUT-14 и SMUT-1 DEAD играют перекрывающиеся роли в образовании РНКи зародышевой линии и эндогенной миРНК. Карр Биол. 2014 14 апреля; 24(8):839-44. PMID: 24684932.

                      Цитаты: 31     Поля: 

                      Биобиология

                         Перевод:AnimalsCells

                    13. Хикман С.Е., Кингери Н.Д., Осуми Т.К., Боровски М.Л., Ван Л.С., Минс Т.К., Эль Хури Дж. Сенсома микроглии, выявленная прямым секвенированием РНК. Нат Нейроски. 2013 декабрь; 16(12):1896-905. PMID: 24162652.

                      Цитаты: 614     Поля: 

                      Новая неврология

                         Перевод:AnimalsCells

                    14. Джабара Х. Х., Осуми Т., Чжоу Дж., Массаад М.Дж., Бенсон Х., Мегарбейн А., Чоуери Э., Михаэль Р., Горка О., Гьюис А., Порталес П., Накаяма Т., Хосокава Х., Реви П., Херрод Х., Ле Дейст Ф., Лефранк Г., Руланд Дж., Геха Р.С. Мутация гомозиготной лимфоидной ткани, ассоциированной со слизистой оболочкой 1 (MALT1), в семье с комбинированным иммунодефицитом. J Аллергия Клин Иммунол. 2013 июль; 132(1):151-8. PMID: 23727036; PMCID: PMC3700575.

                      Цитаты: 55     Поля: 

                      All Allergy and Immunology

                         Translation:HumansAnimalsCells

                    15. Апостолу Э. , Феррари Ф., Уолш Р.М., Бар-Нур О., Штадтфельд М., Челоуфи С., Стюарт Х.Т., Поло Дж.М., Осуми Т.К., Боровски М.Л., Харченко П.В., Парк П.Дж., Хохедлингер К. Полногеномные взаимодействия хроматина локуса Nanog в плюрипотентности, дифференцировке и репрограммировании. Клеточная стволовая клетка. 06 июня 2013 г .; 12(6):699-712. PMID: 23665121.

                      Цитаты: 109     Поля: 

                      Cel Cell Biology

                         Перевод: HumansAnimalsCells

                    16. Чен Л., Стюарт Л., Осуми Т.К., Берджесс С., Варшней Г.К., Дастур А., Боровски М. , Бенеш С., Лейси-Халберт А., Шмидт Э.В. Мутагенез активации транспозонов как инструмент скрининга для выявления устойчивости к противораковым препаратам. БМК Рак. 2013 27 февраля; 13:93. PMID: 23442791.

                      Цитаты: 17     Поля: 

                      Новообразования

                         Перевод: HumanCells

                    17. Чоу Дж., Осуми Т.К., Геха Р.С. Использование полноэкзомного и геномного секвенирования для выявления генетических причин первичных иммунодефицитов. Курр Опин Аллергия Клин Иммунол. 2012 декабрь; 12(6):623-8. PMID: 230

                      .

                      Цитаты: 27     Поля: 

                      All Allergy and Immunology

                         Translation:HumansAnimalsCells

                    18. Пинтер С.Ф., Садреев Р.И., Йилдирим Э., Чон И., Осуми Т.К., Боровски М., Ли Дж.Т. Распространение инактивации Х-хромосомы через иерархию определенных станций Polycomb. Геном Res. 2012 Октябрь; 22(10):1864-76. PMID: 22

                    19. 8.

                      Цитаты: 96     Поля: 

                      Gen Genetics

                         Перевод:AnimalsCells

                    20. Осуми Т. К., Боровский М.Л. MolBioLib: среда C++11 для быстрой разработки и развертывания задач биоинформатики. Биоинформатика. 01 октября 2012 г .; 28(19):2412-6. PMID: 22815363.

                      Цитаты: 6     Поля: 

                      Com Computational Biology

                    21. Тальковски М.Э., Розенфельд Дж.А., Блюменталь И., Пиллаламарри В., Чан С., Хейлбут А., Эрнст С., Хэнском С., Россин Э., Линдгрен А.М., Перейра С., Рудерфер Д., Кирби А., Рипке С., Харрис Д.Дж., Ли Дж. Х., Ха К. , Ким Х.Г., Соломон Б.Д., Гропман А. Л., Люсенте Д., Симс К., Осуми Т.К., Боровски М.Л., Лорангер С., Куэйд Б., Лаге К., Майлз Дж., Ву Б.Л., Шен И., Нил Б., Шаффер Л.Г., Дейли М.Дж., Мортон CC, Гузелла Дж. Ф. Секвенирование хромосомных аномалий выявляет локусы развития нервной системы, которые определяют риск, выходящий за рамки диагностики. Клетка. 2012 27 апреля; 149(3): 525-37. PMID: 22521361.

                      Цитаты: 273     Поля: 

                      Cel Cell Biology

                         Перевод: HumanCells

                    22. Чан С, Якобсен Дж. К., Эрнст С., Хэнском С., Хейлбут А., Блюменталь И. , Миллс Р. Е., Кирби А., Линдгрен А. М., Рюдигер С. Р., Маклафлан С. Дж., Боуден С. С., Рид С. Дж., Фолл Р. Л., Снелл Р. Г., Холл И. М., Шен И. , Осуми Т.К., Боровски М.Л., Дейли М.Дж., Ли С., Мортон К.С., Макдональд М.Е., Гузелла Д.Ф., Талковски М.Е. Сложная реорганизация и преобладающая негомологическая репарация после поломки хромосом при кариотипически сбалансированных перестройках зародышевой линии и трансгенной интеграции. Нат Жене. 04 марта 2012 г .; 44(4):390-7, С1. PMID: 22388000.

                      Цитаты: 123     Поля: 

                      Gen Genetics

                         Перевод:HumansAnimalsCells

                    23. Юань С. С., Мэтьюз А.Г., Джин И., Чен С.Ф., Чепмен Б.А., Осуми Т.К., Гласс К.С., Кутателадзе Т.Г., Боровски М.Л., Струль К., Оттингер М.А. Симметричное диметилирование гистона h4R2 и триметилирование гистона h4K4 тесно коррелируют в эукариотических геномах. Cell Rep. 23 февраля 2012 г.; 1(2):83-90. PMID: 22720264.

                      Цитаты: 34     Поля: 

                      Cel Cell BiologyMol Molecular Biology

                         Перевод:AnimalsCells

                    24. Sharp JA, Plant JJ, Ohsumi TK, Borowsky M, Blower MD. Функциональный анализ транскриптома, взаимодействующего с микротрубочками. Мол Биол Селл. 2011 ноябрь; 22(22):4312-23. PMID: 213.

                      Цитаты: 30     Поля: 

                      Cel Cell BiologyMol Molecular Biology

                         Перевод:AnimalsCells

                    25. Тальковски М.Э., Эрнст С., Хейлбут А., Чанг С., Хэнском С., Линдгрен А., Кирби А., Лю С., Муддукришна Б., Осуми Т.К., Шен Ю., Боровски М., Дейли М.Дж., Мортон К.С., Гузелла Д.Ф. Стратегии секвенирования нового поколения позволяют рутинно выявлять сбалансированные хромосомные перестройки для клинической диагностики и генетических исследований. Am J Hum Genet. 2011 08 апреля; 88(4):469-81. PMID: 21473983.

                      Цитаты: 82     Поля: 

                      Gen Genetics

                         Перевод: HumanCells

                    26. Чжао Дж., Осуми Т.К., Кунг Дж.Т., Огава Й., Грау Д.Дж., Сарма К., Сонг Дж.Дж., Кингстон Р.Э., Боровски М., Ли Дж.Т. Полногеномная идентификация поликомб-ассоциированных РНК с помощью RIP-seq. Мол Ячейка. 2010 22 декабря; 40(6):939-53. PMID: 21172659.

                      Цитаты: 516     Поля: 

                      Cel Cell BiologyMol Molecular Biology

                         Перевод: HumansAnimalsCells

                    27. Лау Н. К., Осуми Т., Боровски М., Кингстон Р.Э., Блоуэр М.Д. Систематический и одноклеточный анализ РНК, взаимодействующих с Xenopus Piwi, и Xiwi. EMBO Дж. 2009 г.07 октября; 28(19):2945-58. ПМИД: 19713941.

                      Цитаты: 39     Поля: 

                      Bio BiotechnologyMol Molecular Biology

                         Перевод:AnimalsCells

                    28. Нусбаум С., Осуми Т.К., Гомес Дж., Аквадро Дж., Виктор Т.С., Уоррен Р.М., Хунг Д.Т., Биррен Б.В., Ландер Э.С., Джаффе Д.Б. Чувствительное, специфическое обнаружение полиморфизма у бактерий с использованием массового параллельного секвенирования. Нат Методы. 2009 г.Ян; 6(1):67-9. PMID: 153.

                      Цитаты: 45     Поля: 

                      Cli Clinical Laboratory Techniques

                         Перевод: Клетки

                    29. Осуми Т.К., Флаэрти Дж. Э., Эванс М. С., Барокас В. Х. Трехмерное моделирование анизотропного уплотнения коллагенового геля, управляемого клетками. Биомех Модель Механобиол. 2008 г., февраль; 7(1):53-62. PMID: 17354006.

                      Цитаты: 10     Поля: 

                      Био-биомедицинская инженерия

                    30. Карако Т. , Главанаков С., Чен Г., Флаэрти Дж. Э., Осуми Т. К., Шимански Б. К. Стадийно-структурированная передача инфекции и пространственная эпидемия: модель болезни Лайма. Я Нат. 2002 сен; 160(3):348-59. PMID: 18707444.

                      Цитаты: 14     Поля: 

                      Bio BiologySci Science

                    31. Осуми Т.К., Флаэрти Дж.Э., Барокас В.Х., Аджерид С., Аиффа М. Адаптивный анализ методом конечных элементов анизотропной двухфазной теории тканеэквивалентной механики. Методы расчета Биомех Биомед Энгин.

Оставить комментарий

Ваш адрес email не будет опубликован.