Глава 29 гпк: Глава 29 Гражданского процессуального кодекса Российской Федерации

Содержание

Глава 29 ГПК РФ. Усыновление (удочерение) ребенка

Глава 29 ГПК РФ. Усыновление (удочерение) ребенка

Актуально на:

25 февраля 2022 г.

Гражданский процессуальный кодекс, N 138-ФЗ | глава 29 ГПК РФ

Постоянная ссылка на документ

  • URL
  • HTML
  • BB-код
  • Текст

URL документа [скопировать]

<a href=»»></a>

HTML-код ссылки для вставки на страницу сайта [скопировать]

[url=][/url]

BB-код ссылки для форумов и блогов [скопировать]

в виде обычного текста для соцсетей и пр. [скопировать]

Скачать документ в формате

Изменения документа

Постоянная ссылка на документ

  • URL
  • HTML
  • BB-код
  • Текст

URL документа [скопировать]

<a href=»»></a>

HTML-код ссылки для вставки на страницу сайта [скопировать]

[url=][/url]

BB-код ссылки для форумов и блогов [скопировать]

в виде обычного текста для соцсетей и пр. [скопировать]

Скачать документ в формате

Составить подборку

Анализ текста

Идет загрузка…

§ 3 Усыновление (удочерение) ребенка. Гражданское процессуальное право

§ 3

Усыновление (удочерение) ребенка

Гражданское судопроизводство по делам об усыновлении (удочерении) регулируется гл. 29 ГПК.

Усыновление (удочерение) производится судом в порядке особого производства по правилам гражданского процессуального законодательства (ст. 125 СК РФ).

Заявление об усыновлении или удочерении (далее — усыновление) ребенка подается в районный суд по месту жительства (нахождения) усыновляемого ребенка (ч.

 1 ст. 269 ГПК).

Граждане Российской Федерации, постоянно проживающие за пределами территории России, иностранные граждане или лица без гражданства, желающие усыновить ребенка, являющегося гражданином Российской Федерации, подают заявление об усыновлении в суд субъекта РФ по месту жительства или месту нахождения усыновляемого ребенка.

В заявлении кроме обычных реквизитов (ст. 131 ГПК) должны быть указаны обстоятельства, обосновывающие просьбу усыновителя (усыновителей) об усыновлении ребенка, и документы, подтверждающие эти обстоятельства. Кроме того, заявитель может включить в заявление просьбу об изменении фамилии, имени отчества усыновляемого ребенка, даты его рождения (при усыновлении ребенка в возрасте до одного года), места рождения усыновляемого ребенка, о записи усыновителей (усыновителя) в актовой записи о рождении ребенка в качестве родителя (родителей) — при желании усыновителей внести соответствующие изменения в актовую запись о рождении ребенка (ст. 270 ГПК).

Граждане, подающие в суд заявление об установлении усыновления, освобождаются от уплаты в доход государства судебных расходов.

В ходе подготовки дела к судебному разбирательству судья обязывает органы опеки и попечительства по месту жительства (нахождения) усыновляемого ребенка представить в суд заключение об обоснованности и о соответствии усыновления интересам усыновляемого ребенка.

С этой целью орган опеки и попечительства обследует условия жизни усыновителя (усыновителей) но месту жительства (нахождения) усыновляемого ребенка или по месту жительства усыновителя (усыновителей).

В соответствии со ст. 271 ГПК на заявителя возлагается обязанность по предоставлению необходимых документов, прилагаемых к заявлению об усыновлении.

Усыновителями могут быть совершеннолетние лица обоего пола при условии, что разница в возрасте между усыновителем, не состоящем в браке, и усыновляемым ребенком должна быть не менее шестнадцати лет.

По уважительным причинам разница в возрасте судом может быть сокращена.

При усыновлении ребенка отчимом (мачехой) наличие шестнадцатилетней разницы в возрасте не требуется.

Заявление об установлении усыновления ребенка суд рассматривает с обязательным участием самих усыновителей (усыновителя), представителя органа опеки и попечительства, прокурора, ребенка, достигшего возраста четырнадцати лет, а в необходимых случаях к участию в рассмотрении заявления суд может привлечь родителей (родителя) усыновляемого ребенка, других заинтересованных лиц и самого ребенка в возрасте от десяти до четырнадцати лет (ст. 273 ГПК).

В ст. 127 СК содержится перечень лиц, которые не могут быть усыновителями. К ним относятся, например, лица недееспособные и ограниченно дееспособные; супруги, один из которых является недееспособным или ограниченно дееспособным; лица, лишенные родительских прав или ограниченные в родительских правах; лица, отстраненные от обязанностей опекуна (попечителя) за ненадлежащее исполнение обязанностей; бывшие усыновители, если усыновление отменено по их вине; лица, которые по состоянию здоровья не могут осуществлять родительские права.

Кроме того, лица, не состоящие между собой в браке, не могут совместно усыновить одного и того же ребенка.

Дела об установлении усыновления суд рассматривает в закрытом судебном заседании.

Рассмотрев заявление об усыновлении ребенка, суд выносит решение об удовлетворении заявления либо об отказе в его удовлетворении полностью или в части.

Права и обязанности усыновителя и усыновленного ребенка возникают со дня вступления в законную силу решения суда об усыновлении ребенка.

Копия решения суда об усыновлении ребенка направляется судом в течение трех дней со дня вступления решения суда в законную силу в орган записи актов гражданского состояния по месту принятия решения суда для государственной регистрации усыновления ребенка.

Усыновление прекращается с его отменой в соответствии со ст. 14CК в судебном порядке по правилам искового производства.

Субъектами права требования отмены усыновления являются родители ребенка, усыновители, ребенок, достигший четырнадцати лет, органы опеки и попечительства, прокурор.

Дела об отмене усыновления рассматриваются с участием представителя органа опеки и попечительства, а также прокурора.

Закон предусматривает следующие основания к отмене усыновления:

— уклонение от выполнения возложенных на усыновителя обязанностей;

— злоупотребление родительскими правами;

— жестокое обращение с усыновленными;

— болезнь усыновителя, алкоголизм, наркомания.

С учетом интересов ребенка возможны и другие основания к отмене усыновления.

Усыновление прекращается со дня вступления в законную силу решения об отмене усыновления.

Выписка из решения в течение трех дней направляется в орган записи актов гражданского состояния по месту регистрации усыновления.

Последствия отмены усыновления:

1. Прекращаются взаимные права и обязанности усыновителя (усыновителей) и усыновленного ребенка и восстанавливаются права и обязанности ребенка и его родителей.

2. Ребенок по решению суда передается родителям (либо на попечение органу опеки и попечительства).

3. Суд решает также вопрос о сохранении за ребенком присвоенных ему фамилии, имени, отчества (в отношении ребенка, достигшего десяти лет, с его согласия).

4. Суд вправе обязать бывшего усыновителя выплачивать алименты на содержание ребенка.

Отмена усыновления по достижении ребенком совершеннолетия по общему правилу не допускаются.

В Брестской области планируют в этом году отремонтировать 135 домов

Фото из архива

21 февраля, Брест /Корр. БЕЛТА/.

В Брестской области в этом году планируют капитально отремонтировать около 135 многоквартирных домов, сообщили корреспонденту БЕЛТА в областном управлении ЖКХ.

В юго-западном регионе в прошлом году после капремонта ввели в эксплуатацию 133 дома. На проведение работ было направлено Br56,5 млн. Из местных бюджетов выделили Br29,5 млн, остальные деньги перечислили жильцы. В этом году коммунальщики планируют капитально отремонтировать около 135 домов. В местных бюджетах для этого зарезервировано Br34,1 млн, еще Br28,5 млн — это деньги граждан.

Также в Брестской области в прошлом году заменили 192 лифта на современные. На эти цели направили Br8,3 млн. В планах на этот год обновить 237 лифтов, в том числе 208 в домах товариществ собственников и организаций застройщиков. «По объектам, которые находятся на балансе ЖКХ, в этом году осталось заменить около 30 лифтов. Основная же часть находится в кооперативах. По алгоритму товарищества собственников изготавливают проектно-сметную документацию. Бюджет покрывает закупку лифтов и часть строительно-монтажных работ. Устанавливаются лифты отечественного производства», — отметил начальник управления ЖКХ Александр Максимчук.

Кроме того, в Брестской области разработан региональный план по ремонту и реконструкции придомовых территорий многоквартирных домов. В прошлом году во дворах проводились работы по сплошному асфальтированию, ямочному ремонту, ремонту пешеходных дорожек и малых архитектурных форм. Работники ЖКХ занимались озеленением, устанавливали песочницы, скамейки, урны, качели и другое игровое оборудование. В этом году намечено благоустроить не менее 84 дворов. Основные работы проведут весной и летом.-0-

Вижте какво реши Министерски съвет днес

Благомир Коцев е назначен за областен управител на област Варна

Министерският съвет прие решение, с което назначава Благомир Коцев за областен управител на област Варна и освобождава досега заемащия длъжността Марио Смърков.

Благомир Коцев притежава образователно-квалификационна степен „магистър“ по специалността „Корабоплаване, търговия и финанси“, придобита от „Сити юнивърсити — Лондон“, Великобритания. Притежава дългогодишен управленски опит в частния сектор — в сферата на управлението на кораби и корабособственост, както и на ресторантьорството и хотелиерството.

Вицепремиерът Калина Константинова е определена за председател на Националната комисия за борба с трафика на хора

Правителството определи Калина Константинова, заместник министър-председател по ефективното управление, за председател на Националната комисия за борба с трафика на хора към Министерския съвет.

Националната комисия за борба с трафика на хора към Министерския съвет е създадена на основание чл. 4, ал. 1 от Закона за борба с трафика на хора. Съгласно чл. 4, ал. 2 от същия закон председател на Националната комисия е заместник министър-председател, определен от Министерския съвет.

Правителството предлага генерал-майор Тодор Дочев да бъде назначен на длъжността Началник на Военна академия „Г.С.Раковски”

Министерският съвет прие Решение за предложение до Президента на република България за издаване на указ, с който да назначи генерал-майор Тодор Дочев на длъжността „Началник на Военна академия „Г.С.Раковски”.

Правителството предлага на Президента да бъде издаден и указ, с който да бъде освободен генерал-майор Груди Ангелов от длъжността „Началник на Военна академия „Г. С. Раковски“ и от военна служба, поради упражнено право на пенсия, на основание чл.166 от ЗОВСРБ.

Правителството прие решение за освобождаване на извънредния и пълномощен посланик на Република България в Кралство Саудитска Арабия и Кралство Бахрейн

Правителството прие решение за освобождаване на извънредния и пълномощен посланик на Република България в Кралство Саудитска Арабия и Кралство Бахрейн, със седалище в Рияд. Г-н Димитър Абаджиев е първият посланик на България в Саудитска Арабия, назначен на 5 декември 2018 г.

Оттеглянето му е по лични причини.

Уреждат се правоотношенията във връзка със закриването на Държавната агенция „Електронно управление”

Правителството одобри проект на Решение на Министерския съвет за уреждане на правоотношенията във връзка със закриването на Държавната агенция „Електронно управление”.

Предложеният проект е свързан с Решение № 26 на Министерския съвет от 25 януари 2022 година за одобряване на Закон за изменение и допълнение на Закона за електронното управление и с Решение на Народното събрание на Република България за приемане на структура на Министерския съвет на Република България от 13.12.2021 г, с което се определя министър на електронното управление и се създава Министерство на електронното управление.

Проектът на Решение предвижда създаване на ликвидационна комисия, която да уреди правоотношенията във връзка със закриването на Държавната агенция „Електронно управление“ в срок от 3 месеца от назначаването й. Председател на комисията ще бъде главният секретар на Министерството на електронното управление, а поименният състав на членовете на комисията ще бъде определен със заповед на министъра на електронното управление.

Ликвидационната комисия следва да уреди всички правоотношения, свързани със закриването на Държавната агенция „Електронно управление“, в т. ч. въпросите, свързани с имуществото, правата и задълженията на закритата Държавната агенция и други необходими дейности, свързани с ликвидацията. В проекта на Решение са предвидени и правомощията на председателя на ликвидационната комисия.

Правителството прие промени в състава на Националния икономически съвет

Правителството прие промени в състава на Националния икономически съвет, имащи организационен характер. Постановлението е във връзка с прието на 13 декември 2021 г. 47-то Народно събрание Решение за приемане на структура на Министерски съвет на Република България. Народното събрание възлага на Министерския съвет в едномесечен срок да уреди всички правоотношения във връзка със създаването и преобразуването на министерства, включително функциите им.

В тази връзка от 30 декември 2021 г. е възложено на министрите предприемането на спешни действия. Те са ангажирани с изработването на предложения за съответни промени в закони, нормативни административни актове и други актове на Министерския съвет за осъществяването на структурните и други промени в централната администрация на изпълнителната власт, произтичащи от приетата структура на Министерския съвет на Република България и Споразумението за съвместно управление на Република България за периода 2021 г. — 2025 г.

Правителството прие Постановление за изменение на списъка на държавите с пазарен риск

Правителството прие Постановление за изменение на списъка на държавите с пазарен риск по чл. 5, ал. 1 от Закона за експортното застраховане.

Основната цел на Постановлението е хармонизиране на срока с последните промени в Съобщението на Комисията до държавите членки относно прилагането на членове 107 и 108 от Договора за функционирането на Европейския съюз към застраховането на краткосрочни експортни кредити,

Удължаването на срока до 31 март 2022 г. съответства на 6-то изменение на Временната рамка на Европейската комисия за мерки за държавна помощ в подкрепа на икономиката в условията на сегашния епидемичен взрив от COVID-19.

Правителството определи министъра на иновациите и растежа да упражнява правата на държавата в капитала на „СОФИЯ ТЕХ ПАРК“

Министерският съвет с Разпореждане определи министъра на иновациите и растежа да упражнява правата на държавата в капитала на „СОФИЯ ТЕХ ПАРК» АД, гр. София.

Разпореждането е във връзка с приетото на 13 декември 2021 г. 47-то Народно събрание Решение за приемане на структура на Министерски съвет на Република България. В т. 5 от същото решение Народното събрание възлага на Министерския съвет в едномесечен срок да уреди всички правоотношения във връзка със създаването и преобразуването на министерства, включително функциите им.

В тази връзка, с Решение № 892 на Министерския съвет от 30 декември 2021 г. е възложено на министрите предприемането на спешни действия за изработването на предложения за съответни промени в закони, нормативни административни актове и други актове на Министерския съвет за осъществяването на структурните и други промени в централната администрация на изпълнителната власт, произтичащи от приетата структура на Министерския съвет на Република България и Споразумението за съвместно управление на Република България за периода 2021 г. — 2025 г.

Министърът на иновациите и растежа ще организира дейността на контактната точка във връзка с европейския регламент относно преките чуждестранни инвестиции

Министерският съвет прие Решение за определяне на реда за изпълнение на задължения, произтичащи от Регламент (ЕС) 2019/452 на Европейския парламент и на Съвета от 19 март 2019 г. за създаване на рамка за скрининг на преки чуждестранни инвестиции в Съюза. За целта се възлага на Министъра на иновациите и растежа, провеждащ държавна политика в областта на чуждестранните инвестиции, да организира дейността на контактната точка за осъществяване на механизма за сътрудничество за прилагане на Регламента, във връзка с функционалната компетентност по политиката за преките чуждестранни инвестиции.

С Решението също се упълномощава пълномощния министър и ръководител сектор „Търговска политика и ЕАСТ” в Постоянното представителство на Република България в ЕС да подпише с ЕК Договореност за съвместно администриране по отношение на обработването на лични данни в контекста на механизма за сътрудничество съгласно Регламент (ЕС) 2019/452 на Европейския парламент и на Съвета от 19 март 2019 г. за създаване на рамка за скрининг на преки чуждестранни инвестиции в Съюза.

Правителството прие промени в Програмата за портфейлни гаранции в подкрепа на ликвидността на предприятията, изпълнявана от ББР

Министерски съвет със свое решение прие изменение на Програмата за портфейлни гаранции в подкрепа на ликвидността на предприятията, пострадали от извънредната ситуация и епидемията от COVID-19.

Промените ще позволят оползотворяване на свободния лимит по Програмата. Това ще даде възможност за финансиране на още предприятия, което ще способства за преодоляване на икономическите последствия, предизвикани от пандемията и за по-бързото възстановяване на бизнес средата, в която осъществяват своята стопанска дейност. Приетите промени в Програмата, ще бъдат включени в процедурата за трето блоково уведомяване на Европейската комисия, с цел промени в Програмата за възстановяване.

Удължава се действието на Програмата и предоставяните по нея гаранции до 30. 06.2022 г. Ще бъде извършена промяна в срокове относно допустимите за гарантиране кредити, като последица от удължаването до 30.06.2022 г. допълнение на Програмата с конкретен текст, изясняващ рамковия ред и условията, по които може да се удължават сроковете на гаранцията и кредитите, гарантирани от ББР ЕАД. Това се прави с цел по-ефективно управление на гарантираните портфейли и след срока на валидност на Временна рамка за мерки за държавна помощ в подкрепа на икономиката в условията на сегашния епидемичен взрив от COVID-19.

Отпуснатите 45 млн. лева за модернизация на жп линията Волуяк-Драгоман ще бъдат възстановени към държавата до края на март 2022 г.

Одобрено е удължаване на срока за погасяване на отпуснатите от правителството 45 млн. лева, за стартиране на дейностите по проект „Модернизация на жп линия София — Драгоман — сръбска граница, жп участък Волуяк — Драгоман“. Със свое решение №267/05.08.2021 г. кабинетът отпусна временен финансов ресурс със срок за възстановяване в Държавния бюджет до 31. 01.2022 г. С настоящите изменения той се удължава до 31.03.2022 г.

Проектът е предвиден за финансиране по ОП „Транспорт и транспортна инфраструктура“ 2014- 2020 и в момента тече неговото одобрение от Управляващия орган на програмата. Удължаването на срока с два месеца се налага поради възникнали допълнителни дейности при изработването на проекта, които са забавили процеса по неговото одобрение.

Правителството одобри позицията на България за редовното заседание на Съвета на Европейския съюз по конкурентоспособност

Правителството одобри позицията на България за редовното заседание на Съвета на Европейския съюз по конкурентоспособност (вътрешен пазар и индустрия). То ще се проведе на 24 февруари 2022 г. в Брюксел. Ръководител на българската делегация ще бъде заместник-постоянният представител на Република България към Европейския съюз г-жа Иванка Ташева.

Съветът ще проведе ориентационен дебат по Регламента относно чуждестранните субсидии, които нарушават функционирането на вътрешния пазар. С приемането му ще се стимулира конкурентната среда на пазарите в ЕС, ще се осигури защита на компаниите от Съюза от нелоялни практики, ще се възстановят и запазят равнопоставени условия за конкуренция на единния пазар.

По темата за бъдещето на индустриалната екосистема на мобилността в контекста на зеления преход ще се дискутират необходимите мерки за улесняване и ускоряване на този преход, по-специално в областта на иновациите, инфраструктурата и обучението, както и инструментите за укрепване на устойчивостта и конкурентоспособността в тази област.

Република България е изготвила проект на Стратегически план за развитие на земеделието и селските райони за програмен период 2023 — 2027 г.

Правителството одобри проект на Стратегически план за развитие на земеделието и селските райони за програмен период 2023 — 2027 г., съфинансиран от Европейския земеделски фонд за развитие на селските райони, Европейския фонд за гарантиране на земеделието и от държавния бюджет.

Страната ни ще разполага с финансови средства по Стратегическия план за развитие на земеделието и селските райони за програмен период 2023 — 2027 г., изготвен съгласно Регламент (ЕС) 2021/2115 на Европейския парламент и на Съвета от 2 декември 2021 година за установяване на правила за подпомагане за стратегическите планове, които трябва да бъдат изготвени от държавите членки по линия на общата селскостопанска политика (стратегически планове по ОСП) и финансирани от Европейския фонд за гарантиране на земеделието и от Европейския земеделски фонд за развитие на селските райони и за отмяна на регламенти (ЕС) № 1305/2013 и (ЕС) № 1307/2013.

Средствата ще бъдат насочени към подпомагане чрез предоставяне на директни плащания и подпомагане на инвестиционни производствени и непроизводствени дейности в сектор „Земеделие”, сектор „Животновъдство», сектор „Плодове и зеленчуци», Лозаро-винарски сектор, сектор „Пчеларство», сектор „Гори», както и за подпомагане на преработватели на първична земеделска продукция, на общини и дейности в неселскостопанския сектор в селските райони. Прилагането на Стратегическия план ще стартира през 2023 г. Създадена е и възможност да се подпомогнат селските райони при провеждането на необходимите структурни промени в изпълнение на Европейския зелен пакт. Именно те ще имат жизненоважна роля за прехода към екологична устойчивост, а финансирането ще им позволи да постигнат амбициозните цели за климата и околната среда на новите стратегии.

С решението се гарантира балансирано и ефективно насочване на финансовият ресурс по Стратегическия план за развитие на земеделието и селските райони за периода 2023 — 2027 г. в съответствие със заложените стратегически цели и приоритети на национално и европейско ниво.

Променя се статутът на държавен имот в област Враца

Правителството обяви имот — публична държавна собственост за частна държавна собственост и даде съгласие за премахването му. Той се намира в с. Дърманци, област Враца и представлява Контролно-пропускателен пункт за проверка на моторни превозни средства със застроена площ 18 кв. м.

Управляваният досега от Министерството на вътрешните работи имот е с отпаднала за ведомството необходимост и трябва да бъде премахнат, тъй като попада в сервитута и трасето на проекта за модернизация на участък от път I-I /Е—79/ „Мездра — Ботевград“, ЛОТ 2, от км 161+367 до км 174+800“.

Контролно-пропускателният пункт ще бъде премахнат по реда на Закона за устройство на територията.

За ратификация е предложени споразумението с МБВР, свързано с оттеглянето на Банката от използването на ЛИБОР като референтен лихвен процент

Със свое решение правителството одобри и предложи на Народното събрание да ратифицира със закон Споразумение, съдържащо се в уведомление на Световната банка от 11 август 2021 г. и писмо-отговор на българската страна от 4 февруари 2022 г., с което тя да уведоми, че не възразява по изменения на заемните споразумения на Република България с Международната банка за възстановяване и развитие (МБВР), свързани с оттеглянето на Банката от използването на ЛИБОР като референтен лихвен процент. На заместник министър- председателя по еврофондовете и министър на финансите е възложено да представи законопроекта пред Народното събрание, а след влизане в сила на закона за ратифициране — да изпрати писмото-отговор до Световната банка по съответния ред, както и да обнародва в „Държавен вестник“ споразумението в 15-дневен срок от датата на влизането му в сила за Република България.

Уведомлението на Световната банка е в контекста на инициатива за преход на референтния й лихвен процент в посока оттегляне от използване на ЛИБОР. От 1 януари 2022 г. ЛИБОР не се изисква да се котира от референтните банки на междубанковия пазар в Лондон. Според Световната банка подобно прекратяване може да се очаква по отношение на EURIBOR в бъдеще. За да запази съответствието между разходите за финансиране и отпускане на заеми, Банката е одобрила инициатива за преход на референтния лихвен процент, изпълнението на която изисква изменение на всички заемни споразумения, за да се включат разпоредби за замяна на ЛИБОР или EURIBOR в съществуващите заеми при обстоятелства, когато ЛИБОР или EURIBOR престанат да съществуват или вече не са търговски приемливи за целите на управление на нейните активи и пасиви.

Към момента Република България е страна по девет заемни споразумения с МБВР, според които по заемите е дължима лихва, базирана на ЛИБОР в евро. Предвидените в уведомлението изменения включват замяна на понятието ЛИБОР с ново определение за референтен лихвен процент — за заеми в евро за такъв се определя EURIBOR или друг определен от Банката референтен лихвен процент. Измененията предвиждат Банката незабавно да уведомява заемополучателя, а съответните промени да влизат в сила от датата на съответното уведомление.

От гледна точка на взаимоотношенията с МБВР, в която Република България членува, липсата на възражение би представлявала подкрепа за реализирането на инициативата на международната финансова институция за прехода, свързан с ЛИБОР.

Правителството предлага за ратифициране изменение на Финансовия договор между Република България и ЕИБ

Със свое решение правителството предложи на Народното събрание да ратифицира изменение на Финансовия договор между Република България и Европейската инвестиционна банка (проект „България — съфинансиране по Фондовете на ЕС 2014 — 2020 г. (СПЗ)“) от 27 ноември 2014 г.

Финансовият договор между Република България и ЕИБ за структурен програмен заем в размер до 500 млн. евро има за цел да подпомага усвояването на средствата от Фондовете на ЕС. Средствата от заема се използват за покриване на националното съфинансиране по проектите, изпълнявани по оперативните програми „Транспорт и транспортна инфраструктура 2014-2020 г“, „Околна среда 2014-2020 г.“ и „Региони в растеж 2014-2020 г“, приоритетни оси 1 и 7, както и по Механизма за свързване на Европа (МСЕ).

Изменението е инициирано във връзка с Решение на Министерския съвет от 2020 г. за прехвърляне на средства между оперативните програми от периода 2014-2020 г. в подкрепа на мерки за минимизиране на отрицателните последици от епидемичното разпространение на Ковид-19, което е подписано от ЕИБ и от страната ни през 2021 г. С изменението в обхвата на Финансовия договор се включва оперативна програма „Иновации и конкурентоспособност 2014-2020 г.“, което ще помогне българското правителство да се справи с нуждите от национално съфинансиране за изпълнението на проектите по програмата и по този начин ще допринесе за успешното изпълнение на мерките за преодоляване на икономическите последици от пандемията.

Също така в обхвата на Финансовия договор се включват и всички проекти в рамките на приоритетна ос 1 „Устойчиво и интегрирано градско развитие“ на ОПРР, в рамките на която се реализират широк спектър от проекти. Понастоящем, само проектите, изпълнявани по инвестиционен приоритет „Устойчив градски транспорт“ на тази приоритетна ос, са допустими за финансиране със средства от заема. Включването в обхвата на Финансовия договор на всички проекти в рамките на приоритетна ос 1 на ОПРР ще позволи ползването на средства от заема за покриване на националното съфинансиране по проектите в рамките на приоритетната ос и ще допринесе за тяхното успешно изпълнение и за подобряване на градската среда, качеството на живот и растежа в градовете в България и особено в настоящата предизвикателна ситуация.

Разширяването на обхвата на заема ще подпомогне правителството при осигуряването на средства за националното съфинансиране на проектите по двете оперативни програми и ще даде възможност за ефективното и ефикасно използване на средствата от заема.

За ратификация е предложен договор в сферата на отбраната

Министерският съвет на Република България одобри Договор (Писмо за предлагане и приемане на оферта/Letter of Offer and Acceptance — LOA) за допълнение и изменение № 1 (Amendment № 1) към Международен договор (LOA) BU-P-AAD «Sidewinder AIM 9Х Блок II ракети, свързани материали и услуги» (Sidewinder AIM 9Х Block II Missiles, associated material and services). C решението се предлага на Народното събрание на основание чл. 85, ал.1, т.4 от Конституцията на Република България да ратифицира със закон този договор.

Договорът не предвижда увеличаване на финансовите задължения за българската държава, но дава възможност за оптимизиране на доставките от страна на САЩ, свързани с изпълнение на договора по придобиване на многоцелеви изтребител.

Правителството одобри проект на Споразумение между правителството на България и на Швеция

Правителството одобри проект на Споразумение между правителството на България и на Швеция за прекратяване на Договора за взаимно насърчаване и защита на инвестициите, подписан в София на 19 април 1994 г.

Дългогодишна позиция на Европейската комисия (ЕК) е, че двустранните инвестиционни договори, сключени между държавите-членки на Европейския съюз (ДИД) се препокриват и влизат в противоречие със законодателството на Съюза, тъй като дискриминират инвеститорите в ЕС въз основа на националност. След влизането в сила на Договора от Лисабон (декември 2009 г.) Комисията стартира инициатива за прекратяването на двустранните инвестиционни договори (ДИД).

След подписването, Споразумението за прекратяване на инвестиционния договор между България и Швеция, следва да бъде ратифициран от Народното събрание на Република България.

Одобрена е позицията на страната ни за неформално заседание на ЕКОФИН

Правителството одобри позицията на страната ни за участие в неформалното заседание на Съвета на Европейския съюз по икономически и финансови въпроси (ЕКОФИН), което ще се проведе на 25 и 26 февруари, 2022 г. в Париж, Франция.

По време на срещата министрите на финансите и управителите на централните банки ще обсъдят предизвикателствата пред ЕС в контекста на геополитическото противопоставяне и засилената конкуренция между глобалните сили с цел заздравяване на икономическата позиция на Съюза, както и пътищата за излизане от кризата, възстановяването на фискалната и монетарната политика, запазвайки растежа в дългосрочен план.

Въз основа на оценка на силните и слабите страни, министрите ще обсъдят укрепването на европейския финансов сектор, така че той изцяло да финансира двойния преход и икономическия растеж.

През втория ден на заседанието министрите ще обменят мнения как да засилят иновациите и поемането на риск в ЕС, които са решаващи фактори за засилването на растежа в дългосрочен аспект и укрепването на стратегическата автономия на ЕС. Участниците ще обсъдят цената на климатичния преход и доколко тя е социално приемлива.

Внедряване на новите знания и иновации в образователните програми — акцент на българската позиция в Париж

Насърчаването и сътрудничеството на висшите училища с научни организации из цяла Европа и внедряването на новите знания и иновации в образователните програми бяха акцентите в позицията на България на неформалната среща на министрите на висшето образование, научните изследвания и иновациите. Министерският съвет одобри резултатите от участието на Република България в срещата, която се проведе в периода 24- 25 януари 2022 г. в Париж, Франция.

По време на събитието беше подчертана също необходимостта от допълнителни усилия от страна на висшите училища и научните организации, както и на местните и националните власти за борба с фалшивите новини и изобщо дезинформацията, базирана на псевдонаука.

Представена беше информация за създаването на Научноизследователски институт в областта на компютърните науки, определянето на българските висши училища с най-висок научен капацитет като „изследователски“ и очакваната за тях подкрепа по изпълнение на Стратегически научноизследователски и иновационни програми (Strategic R&I Agenda) чрез Плана за възстановяване и устойчивост.

Укрепването на транснационалното сътрудничество между университетите за бъдещето на Европа беше темата, по която се проведе дебат между министрите в рамките на срещата. Българската позиция беше представена от проф. Генка Петрова-Ташкова, заместник-министър на образованието и науката.

Одобрени са резултатите от българското участие в Неформалната среща на министрите на образованието и младежта

Министерският съвет се запозна с Доклада на министъра на младежта и спорта за резултатите от българското участие в Неформалната среща на министрите на образованието и младежта на 27 януари 2022 г. в гр. Страсбург, Франция. На срещата България бе представена от посланик Мария Спасова, постоянен представител на Република България към Съвета на Европа.

По време на политическия дебат на тема „Младите европейци като пълноправни актьори в Европа: за по-зелена и по-устойчива Европа“ всички държави членки изразиха подкрепа за по-активно ангажиране на младите хора в процеса на взимане на решения на местно, регионално, национално и европейско равнище. Подчертана бе взаимната свързаност между младежта, образованието (формално и неформално), вкл. физическото образование за ангажиране на младите хора от ранна възраст по въпросите с опазването на околната среда, борба с промените в климата и постигане на Целите за устойчиво развитие като бе отбелязана основната роля на програмата „Еразъм+“.

Представителят на България акцентира върху значението на Европейската година на младежта за ангажиране на младите хора като пълноценни участници в социалния и икономически живот и за постигане на една по-зелена и по-устойчива Европа; необходимостта от качествено гражданско образование, насърчаващо демократичните ценности, информираност, медийна грамотност, отсяване на фалшивите новини, така че младите хора да могат да взимат информирани решения за едно по-устойчиво бъдеще. Отбелязана беше ролята на Министерство на младежта и спорта, което осигурява възможност младите хора да реализират свои инициативи и кампании в сфери като опазване на околната среда и устойчивост, доброволчество, гражданско участие.

По време на срещата бяха обявени победителите в конкурса „Млади и еко- ангажирани“ — иновативни инициативи от страна на младите хора за опазване на околната среда и борба с промените в климата.

Правителството одобри резултатите от участието на българската делегация в неформалното заседание на Съвета на ЕС по конкурентоспособност

Правителството одобри резултатите от участието на българската делегация в неформалното заседание на Съвета на Европейския съюз по конкурентоспособност (вътрешен пазар и индустрия), което се проведе на 31 януари и 01 февруари 2022 г. в Ланс, Франция. Делегацията беше ръководена от извънредния и пълномощен посланик на Република България във Френската република и Княжество Монако г-н Николай Милков.

Министрите проведоха дискусия относно стратегическата автономност на европейската икономика, като поставиха акцент върху редица важни елементи и инициативи, които са от решаващо значение за справяне със съществуващите предизвикателства, намаляване на зависимостите от трети страни и укрепване на капацитета на ЕС за устойчивост на бъдещи кризи.

Държавите членки, включително и България, приветстваха използването на вече създадените индустриални алианси и форуми, и изразиха позитивни очаквания към важните проекти от общ европейски интерес и Европейския законодателен акт за чиповете, който се очаква да бъде публикуван през първата половина на 2022 г.

Одобрени са резултатите от българското участие в неформалното заседание на Съвет „Правосъдие и вътрешни работи“, формат „Вътрешни работи“

Министерският съвет одобри резултатите от участие в неформалното заседание на Съвет „Правосъдие и вътрешни работи“, формат „Вътрешни работи“, проведено на 3 февруари 2022 г. в гр. Лил, Франция. В доклада са представени резултатите от дискусиите относно: реформа на Шенген; бъдещето на гражданската защита в Европа; миграция и убежище: за поетапен подход в полза на ЕС и всички държави членки; борба с радикализацията (тема на работния обяд).

Министерският съвет одобри резултатите от участието на България в заседанието на Съвет „Правосъдие и вътрешни работи”

Министерският съвет одобри резултатите от участието на България в заседанието на Съвета на Европейския съюз „Правосъдие и вътрешни работи”, част „Правосъдие“, което се проведе на 4 февруари в Лил, Франция.

Водеща тема на дискусиите беше включването на речта на омразата и престъпленията от омраза в списъка на така наречените «европейски престъпления». Целта е да се даде единен отговор на нарастващите заплахи за правата на европейските граждани, предизвикани от екстремистки, расистки и хомофобски изказвания.

В изказването си министър Надежда Йорданова подкрепи инициативата на Европейската комисия. Предложеното разширяване може да допринесе за хармонизирано подобряване на националната наказателноправна рамка относно речта на омразата и престъпленията от омраза, включително за защита на лицата от малцинствени групи. Бъдещите инструменти, които ще бъдат приети въз основа на това правно основание, следва да включват само защитените признаци, предвидени в Хартата на основните права.

Министрите обсъдиха и признаването между държавите членки на родителство, установено в рамките на Европейския съюз. Беше приветствана идеята за законодателна инициатива, тъй като само чрез законодателен акт ще може да се гарантира най-добрият интерес на детето при трансгранично движение и преместване. Според българската позиция при изготвянето на предложението следва да се подходи с особено внимание, за да бъде намерен необходимият баланс между гаранциите за упражняване на правата, регламентирани от европейското законодателство, и компетентността на държавите членки.

Разгледана беше и необходимостта от координиране на системите за сигнали за изчезнали и отвлечени деца. Навременното информиране на обществеността чрез специално създадени платформи в социалните мрежи ще подобри процеса на откриване на изчезналите деца и ще подпомогне правоохранителните органи за тяхното издирване и връщане в семействата им.

Министрите, отговорни за Кохезионната политика на ЕС, ще обсъдят Осмия доклад на Европейската комисия за сближаването

Правителството одобри позицията на България за неформалната среща на министрите, отговарящи за Кохезионната политика на ЕС, която ще се проведе на 28 февруари — 1 март 2022 г. по покана на Френското председателство. На събитието ще бъде иницииран политически дебат по наскоро представения Осми доклад за икономическо, социално и териториално сближаване под мотото „Сближаване в Европа до 2050 г. “.

Държавите-членки ще обсъдят възможностите за инвестиции в приоритетни области за подпомагане на сближаването на фона на днешните предизвикателства, пред които е изправен ЕС: демографски промени, риск от задълбочаване на разликите в развитието на отделните региони на Европа след икономическите кризи и пандемията от COVID-19, климатични промени, ограничени природни ресурси и ограничена свързаност на много европейски региони, в т.ч. селата.

България споделя всички тези предизвикателства и ще призове за по-координирана и целенасочена структурна подкрепа за слабо развитите региони и местните общности. Важно е да се гарантира устойчива помощ за ключови инвестиции, които ще доведат до подобряване на условията за живот и бизнес в страната ни. Страната ни ще потвърди подкрепата си за амбициите на ниво ЕС за осъществяване на „зеления“ и цифровия преход, като цената за тяхното реализиране следва да бъде справедливо разпределена между по-развитите и по-слабо развитите държави-членки на принципите на солидарност и еднакво третиране. България си поставя за цел да стимулира разпространението на иновации и предприемачеството в съчетание с политики, ориентирани към нуждите и особеностите на конкретните региони. Балансираното териториално развитие следва да се превърне в основен принцип и при провеждането на останалите европейски политики.

Необходимо е да се търси максимално хармонизиране на правилата и процедурите, чрез които се реализират отделните инструменти за финансиране, така че изпълнението да се осъществява в опростена рамка и с необходимата координация между фондове и програми, се казва още в позицията ни.

Министерството на правосъдието и Министерството на финансите предлагат промени в ГПК, с които дирекция „Съдебна защита“ на Министерството на финансите ще премине към Министерството на правосъдието

Министерство на правосъдието и Министерството на финансите предлагат промени в ГПК, с които дирекция „Съдебна защита“ на Министерството на финансите ще премине към Министерството на правосъдието. Предложението произтича от приетата структура на Министерския съвет на Република България с Решение на Народното събрание от 13 декември 2021 г. и Споразумението за съвместно управление на Република България за периода от 2021 г. до 2025 г.

С проект на Закон за изменение и допълнени на Гражданския процесуален кодекс се цели осъществяването на процесуалното представителство на държавата да бъде възложено на министъра на правосъдието. Това ще доведе до оптимизиране на процесите на държавно управление и концентрация на еднородни функции в един орган.

Правителството прие Постановление за приемане на Наредба за разглеждане на спорове по Закона за марките и географските означения

Правителството прие Постановление за приемане на Наредба за разглеждане на спорове по Закона за марките и географските означения.

С приемането на новата правна уредба се постига пълно съответствие на подзаконовата нормативна уредба, касаеща реда за разглеждане на спорове и реда за образуване, провеждане и приключване на производството за служебно заличаване на регистрацията на марка, с разпоредбите на Закона за марките и географските означения.

Въвеждането на ясни и подробни правила за административния ред, приложим в производствата, образувани във връзка с подадени жалби и искания по реда на Закона за марките и географските означения ще доведе до предвидимост на действията на Патентното ведомство по прилагане на правилата на Раздел VIII от Глава втора на закона.

Гарантира се безплатният училищен транспорт до съседни селища и през учебната 2021/2022 г.

Правителството прие промени в наредбата за начина на финансиране на превоз за собствена сметка и специализиран превоз на деца и ученици с автомобилен транспорт. Целта е и през учебната 2021/2022 г. да бъде гарантиран безплатният училищен превоз на деца и ученици до най-близкото населено място, ако в тяхното няма детска градина и училище. Промените са във връзка с продължаващата извънредна епидемиологична обстановка.

Предвижда се, когато присъственото обучение в детските градини и училищата е било преустановено, да се отпускат средства за условно постоянни разходи в размер до 60% от заявените суми при превоз за собствена сметка и до 50% при специализиран превоз с автомобилен транспорт.

Промяната се налага, тъй като превозът за собствена сметка и специализираният превоз с автомобилен транспорт обслужват 60% от всички маршрути. За да бъде гарантиран безплатният превоз на децата и учениците, е необходимо да бъдат запазени, както работните места на водачите, така и финансовата стабилност на транспортните предприятия, извършващи специализиран превоз с автомобилен транспорт.

Правителството прие Постановление за приемане на Устройствени правилници на МИ и МИР

Правителството прие Постановление за приемане на Устройствени правилници на Министерството на икономиката и индустрията и на Министерството на иновациите и растежа. С него се приемат правилниците създадени вследствие на разделяне на Министерството на икономиката в изпълнението на т.2 на Решението на Народното събрание от 13.12.2021 г. за приемане на структура на Министерския съвет на Република България (обн. ДВ, бр.106 от 15.12.2021 г., изм., бр. 110 от 2021 г.).

С приетия нормативен акт се осъществяват и част от структурните промени в централната администрация на изпълнителната власт. Предприемат се действия за подготовката на структурни и други промени в централната администрация на изпълнителната власт. Чрез предвидените в нормативните разпоредби на проекта на постановление и на приеманите с него проекти на устройствени правилници се преразпределят правомощия от материалната компетентност на министъра на икономиката, които следва да бъдат поети съответно от министъра на икономиката и индустрията и от министъра на иновациите и растежа, респективно разпределени между министрите на икономиката и индустрията и на иновациите и растежа.

В постановлението са включени разпоредби, регламентиращи правоприемството по отношение на закриващата се Държавната агенция за научни изследвания и иновации и преминаващите към Министерството на иновациите и растежа административни структури на преобразуваното Министерство на икономиката, както и разпределението на активите, пасивите, правата и задълженията, свързани с дейността на преобразуваното министерство.

Създава се комисия с участието на представители на пет ведомства

Правителството прие решение, с което създава комисия с участието на представители на Министерския съвет, Министерството на финансите, Министерството на регионалното развитие и благоустройството, Министерството на правосъдието и Министерството на транспорта и съобщенията.

Комисията ще направи подбор на адвокатски кантори, които да предоставят правни съвети при подготовката на производства пред съд и юрисдикции за защита интересите на държавата във връзка с установени злоупотреби и случаи на неправомерно разходване на публични средства, както и да предоставят правни съвети по въпроси, които могат да станат предмет на такива производства.

Правителството одобри законопроект за закриване на специализираните наказателни съдилища и прилежащите им прокуратури

Закриване на Специализирания наказателен съд, Апелативния специализиран наказателен съд и съответните специализирани прокуратури, уреждане на статуса на работещите в тях съдии, прокурори, следователи и администрация, както и приключването на висящите дела при спазване на принципа за неизменност на състава. Това предвижда приетият днес от правителството законопроект за изменение и допълнение на Закона за съдебната власт (ЗСВ).

Със законопроекта се предлага и отмяна на „кариерните“ и „финансови бонуси“ за членовете на Висшия съдебен съвет (ВСС), главния инспектор и инспекторите от Инспектората към ВСС (ИВСС), както и „кариерните бонуси“ за административните ръководители на съдилищата и прокуратурите и техните заместници.

„Структурните и организационни промени по отношение на звената на специализираното наказателно правосъдие имат за цел да гарантират конституционния принцип за независимост на съдебната власт и защитата на конституционните права на гражданите. За десетгодишния срок на своето действие, специализираните наказателни съдилища и съответните им прокуратури не постигнаха заложените със създаването им през 2011 г. цели“, пише в мотивите към законопроекта.

Компенсирането на мрежовите оператори за технологичните им разходи продължава

до края на м. март 2022 г.

Компенсирането на мрежовите оператори за технологичните им разходи ще продължи до края на м. март 2022 г. Това реши правителството на днешното си заседание, приемайки промени в програмата за компенсиране на разходите на операторите на електропреносната и електроразпределителните мрежи за закупуване на електроенергия за технологични разходи. По закон тези компании закупуват електроенергията, необходима за покриване на технологичните им разходи единствено от свободния пазар. От друга страна, при утвърждаване на цените на мрежовите услуги за текущия ценови период КЕВР определя прогнозна пазарна цена на електроенергията за технологични разходи. За текущия ценови период 1.07.2021 — 30.06.2022 г., прогнозната пазарна цена, определена от КЕВР, е в размер на 131.27 лв/МВтч за операторите на електроразпределителни мрежи и 124.85 лв/МВтч за оператора на електропреносната мрежа. Тези цени са значително под действителните борсови цени, което създава сериозни финансови дефицити при мрежовите оператори.

Според приетите днес от правителството промени в програмата операторите ще бъдат компенсирани с цялата разлика между определената от КЕВР прогнозна пазарна цена и борсовата цена, по която те закупуват енергията за технологичните си разходи. Финансовите средства за това в размер на около 221 млн. лв. са осигурени от фонд „Сигурност на електроенергийната система». Плащането на средствата по Програмата се извършва по Споразумение между Министерството на енергетиката (МЕ) и фонд „Сигурност на електроенергийната система» (ФСЕС). Съгласно подписаното споразумение Министерството на енергетиката ще уведомява фонд „Сигурност на електроенергийната система» за размера на полагащата се компенсация като ФСЕС ще извърши плащането на посочената сума в 3 -дневен срок от получаването на уведомлението. Средствата се превеждат по парична сметка, посочена от съответния заявител на компенсацията.

С изпълнението на тази програма се гарантира финансовата стабилност на мрежовите оператори, което е ключово условие за нормално и надеждно функциониране на електроенергийната система на страната.

От друга страна, чрез компенсиране на разходите на операторите и намаляване на финансовия дефицит, който следва да бъде компенсиран със следващо ценово решение на КЕВР, ще се ограничи необходимостта от съществено повишаване на цените на мрежовите услуги, а оттам — и поскъпване на електроенергията за всички крайни потребители.

От програмата ще се възползват операторът на електропреносната мрежа „ЕСО“ ЕАД и петте оператора на електроразпределителни мрежи „ЧЕЗ Разпределение България» АД, „Електроразпределение ЮГ“ ЕАД, „Електроразпределение Север“ АД, „ЕРП Златни пясъци“ АД, ДП „Национална компания Железопътна инфраструктура“. С предходно решение от края на миналата година правителството утвърди компенсация на мрежовите оператори за технологичните им разходи в пълен размер за периода юли — декември 2021 г.

Продължават компенсациите за битовите потребители и топлофикационните дружества заради високите цени на природния газ

Битовите потребители и потребителите на топлофикационните дружества, които използват природен газ като основно гориво и имат издадена лицензия за производство и пренос на топлинна енергия с преобладаващ топлинен товар за битови нужди, ще бъдат компенсирани заради растящите цени на синьото гориво и за месеците февруари и март. Това реши правителството на днешното си заседание, одобрявайки продължение на програмата за компенсиране на тези клиенти, приета на 25 януари 2022 г. Компенсациите за тях са изчислени като 50% от разликата между цената на обществен доставчик, одобрена от КЕВР за съответния месец и прогнозната цена за първото тримесечие на 2022 г., съгласно Решение на КЕВР № Ц- 26 от 1 юли 2021 г. В сумите не е включен ДДС. При този механизъм размерът на компенсацията е 30,54 лв./MWh за м. февруари 2022 г. и индикативно 29,58 лв./MWh за м. март 2022 г. Предвиденият бюджет за изпълнение на програмата е 83 млн. лева. Компенсациите ще бъдат изплатени до 30 април 2022 г.

Плащането на средствата по Програмата се извършва по Споразумение между Министерството на енергетиката (МЕ) и фонд „Сигурност на електроенергийната система» (ФСЕС). Съгласно подписаното споразумение Министерството на енергетиката ще уведомява фонд „Сигурност на електроенергийната система» за размера на полагащата се компенсация като ФСЕС ще извърши плащането на посочената сума в 3-дневен срок от получаването на уведомлението. Средствата се превеждат по парична сметка, посочена от съответния заявител на компенсацията. Изпълнението на програмата ще подпомогне битовите клиенти на природен газ за справяне с последиците от ръста на цените на природния газ. Компенсирането на топлофикационните дружества ще окаже положително влияние върху всички потребители, като допълнително улесни изпълнението на лицензионните им дейности по производство и пренос на топлинна енергия.

Компенсациите за бизнеса заради високите енергийни цени продължават до края на м. март

Всички небитови потребители на електроенергия ще бъдат подпомогнати заради високите й цени до края на м. март 2022 г. Това реши правителството на днешното си заседание, приемайки продължение на вече приетата през миналата година програма, насочена към тези клиенти. От нея ще се възползват всички около 633 хил. небитови крайни потребители на електрическа енергия, без мрежовите оператори, за които е предвидено друго подпомагане. Компенсацията се определя като фиксирана сума за всеки MWh използвана електроенергия. Конкретният размер се изчислява като 75% от разликата между реалната средномесечна борсова цена на сегмента „ден напред» на БНЕБ за съответния месец и базовата цена от 185.59 лв/MWh (средна цена базов товар на пазар „ден напред» на БНЕБ за м. юли 2021 г.). Компенсации за клиенти с цени под базовата не се предвиждат. В сумите не е включен ДДС. Както и до момента, компенсацията ще бъде извършена чрез доставчика, с който всеки небитов клиент има сключен договор. Информация за полагащата се компенсация ще бъде посочена във фактурата на всеки клиент.

Бюджетът на допълнението по Програмата е 575 млн. лева. Компенсациите ще бъдат изплатени до 31 май 2022 г.

Правителството прие решение за освобождаване на председателя на Държавна агенция за научни изследвания и иновации

Министерският съвет прие Решение за освобождаване на председателя на Държавна агенция за научни изследвания и иновации, считано от 01.03.2022г..

Предвид преминаването на Държавната агенция за научни изследвания и иновации към Министерството на иновациите и растежа, и променената структура на Агенцията, отпадат и функциите изпълнявани от председателя на Държавна агенция за научни изследвания и иновации.

Мая Манолова: Да бяха наложили мораториум и върху заплатите си ᐉ Новини от Fakti.bg — България

Гражданската платформа Изправи се.БГ заедно с председателя ѝ Мая Манолова се включиха в „Отворена дискусия: Бюджетът отвъд лозунгите“ – дебат в търсене на решения за по-справедливо разпределение на бюджета, организиран от онлайн предаването „Политизирай това“.

Панелисти в първата дискусия, търсеща отговори за по-справедливо общество бяха политологът Страхил Делийски, финансистът Константин Проданов, доцент Иво Инджов, юристът Никола Вапцаров и предприемачът Юлиян Ненчев. Водещи на дебата бяха журналистите Мирена Филипова и Николай Драганов.

При оценката си за бюджет 2022г. лидерът на Изправи се.БГ Мая Манолова заяви: „Бюджетът не просто не е най-социалният, той е антисоциален. Той е бюджет на бедността и неравенствата. Хората ще обедняват, а ножицата между най-ниските и най-богатите ще се разтваря.“

Г-жа Манолова силно разкритикува маниера вместо да има управленски решения на проблемите да виждаме пропаганда. Според нея социалният стълб в тази четворна коалиция отсъства. Пропагандата не пълни хладилниците, а гафовете в социалната сфера стават все повече: Като започнем с лъжата с преизчислените пенсии през януари; „Замразяването“ на сметките на мобилните оператори; Уж поевтиняването на дървата за огрев в края на отоплителния сезон; „Преборването“ на колекторите и монополите; електронните табла с цените от стоковата борса, които трябва да заблудят хората, че това което виждат на таблата са цените, които плащат в магазина. Лидерът на Изправи се.БГ беше категорична, че с пропаганда не се управлява и вместо да има решение на проблемите на хората, предлаганите решения създават още и още проблеми.

От гражданската платформа настояха за отпадане на ДДС върху храните, както и за мерки срещу повишаването на битовите сметки. По думите на Мая Манолова времето на мораториума трябваше да се използва за анализи и законодателни промени, които да решат проблемите с поскъпващите цени. До момента действия няма и хората се притесняват какво ще се случи с тока, парното, водата след мораториума.

Имаше призив от ЕК да бъде премахнато ДДС върху битовите сметки. Ако се спазват сегашните правила, водата ще поскъпне 2 пъти след вдигане на мораториума. И това може да доведе до водни бунтове по оценки на гражданската платформа.

Топлофикация София е във фактически фалит с 1,5 млрд. лв. задължения. Според ръководството на дружеството недовзетия приход от гражданите е 364 млн. лв и ако смятат да ги събират от столичани това би било фатално. Хората няма да имат избор от това да се откажат от тези плащания.

Във връзка с това г-жа Манолова заяви: „Добре е, че депутатите наложиха мораториум върху битовите сметки, но да бяха наложи мораториум и върху собствените си заплати. 700лв отгоре в заплатите на властта е цинично при такава криза.“ Припомняме, че в 45-тия и 46-тия парламент парламентарната група на Изправи се предлагаше намаляване заплатите на депутатите 3 пъти до средните доходи за страната.

Преподавателят в СУ – гл. ас. Страхил Делийски определи българския бюджет като „абсурден, нечовешки, брутално ултрапазарен“. Затова всяко минимално увеличение на подкрепата за някоя група се представя като голямо социално постижение. В Европа държавата преразпределя повече и се дават средно по 20% от БВП за социални плащания. В България тези плащания са няма 12% от БВП. Другите дефицити у нас са при разходите за образование и здравеопазване – смята г-н Делийски.

Голяма част от българите заминават за чужбина, защото българската държава не се грижи за човека и не иска да плаща за социални дейности, за образование, за здравеопазване.

А държавата ни е такава заради насадени парадигми, че „данъците са кражба, държавата е лош стопанин, получаващите социални плащания са паразити, ядем парите на бизнеса…“ – завърши иронично Страхил Делийски.

За финансиста Константин Проданов това е най-асоциалният бюджет на фона на това, което правят другите държави. По думите му имаше две обяснения за бюджета: „От ляво се казваше, че това е най-социалният бюджет. А от дясно критиката беше, че това е най-разхитителният бюджет, ще докара хиперинфлация, тръгнали сме по пътя на Гърция с дългова спирала… А ако човек погледне числата в бюджета може да реши, че е правен от Владислав Горанов. Няма разлика в структурата на бюджета с тези на ГЕРБ.“

Г-н Проданов обори мантрата, че харчим парите на бизнеса с бюджета. От корпоративен данък се очакват 3,8 млрд. лв. или 7% от приходите в бюджет 2022г. А за миналата година физическите лица са платили 23 млрд. лв. данъци, осигуровки, ДДС. И ако бизнесът плаща данък печалба, то хората плащат данък върху целия си доход. За тях няма приспадане на данъци за разходите им.

По думите на финансиста у нас даваме по-малко за публични услуги като образование, здравеопазване, социални плащания в сравнение с останалите европейски страни. Но даваме почти два пъти повече в сравнение с Европа за вътрешен ред и сигурност. Т.е. сме необразовани, не здрави, не солидарни, но пък и с най-застрашени.

Доц. Иво Инджов коментира зависимостта на обществените медии у нас от волята на управляващите мнозинства с определянето на бюджета. По думите му чрез бюджета държавата определя дали обществените медии могат да имат независима редакционна политика. У нас обществените медии не се издържат чрез такси или нарочни данъци, а са зависими от мнозинството за техните средства през бюджета. Когато говорим за социален бюджет и за социална отговорност трябва да си дадем сметка, че в България бюджетът остава основен източник на финансиране на обществените медии, а това трябва да развива и качествената журналистика.

Според Никола Вапцаров – юрист и граждански активист — човешката цивилизация започва не с огъня, войната или търговията, а с грижата на хората един за друг. Сега в бюджета солидарността липсва.

Липсата на правосъдие е другият недостатък на държавността у нас, а запазването на 4% съдебна такса от материалния интерес по делата накърнява именно възможността за правосъдие и се уронват устоите на държавността.

Г-н Вапцаров, който беше сред основните лица на протестите през лятото на 2020 г., беше категоричен: „Бяхме толкова време на площада, именно за да видим правосъдие, справедливост, солидарност.“

По данни на предприемача, експерт в информационните технологии, Юлиян Ненчев – у нас има 5 пъти повече гишета, отколкото в европейските страни. Вместо дигитализацията и сигурността да са на преден план у нас продължава да се мисли единствено за усвояване на пари за едни фирми чрез обществени поръчки. Според него и в плана за възстановяване и устойчивост изглежда има само заложени средства, но няма кой да реализира проекти.

В Отворена дискусия: Бюджетът отвъд лозунгите се включиха и редица представители на неправителствени организации и представители на гражданското общество като „Системата ни убива“, пациентски организации, собственици на малък бизнес, артисти, експерти в сферата на енергетиката.

Голяма част от големите социални групи остават непредставени в този бюджет. Пенсионерите ще получат само 6,1% повишаване на пенсиите при 9% инфлация и близо 30% поскъпване на малката потребителска кошница. И тази лъжа е в ярък контраст с лайтмотива на кампаниите на всички управляващи партии, че пенсиите им ще бъдат преизчислени.

Хората с най-тежки увреждания и с нужда от лична помощ реално живеят с под 300 лв на месец. Не просто под прага на бедност, но с 290 лв на месец. Това е геноцид.

Работещите бедни не получават повишаване на доходите, което да компенсира инфлацията, защото с 60лв ръст на минималната заплата не решава проблемите. Всяка партия от четворната коалиция обещаваше необлагаем минимум. Това щеше да даде поне по 70 лв на работещите бедни.

Повишаването на минималния осигурителен доход на земеделските производители означава че голяма част от тях ще отидат в сивия сектор и ще се откажат от това да се занимават със земеделие или без да се регистрират няма да бъдат защитени срещу бедствия и лоша реколта.

В 46-тия парламент се преборихме за по 200 лв за възрастните хора за зъбни протези. Сега това го няма в бюджета за тази година, а би струвало 18 млн. лв за цялата година и 120 000 възрастни хора да получат зъбни протези.


Поставете оценка:

☆ ☆ ☆ ☆ ☆

3.7

Оценка 3.7 от 21 гласа.

Глава 29 – Законодательное собрание штата Айдахо

67-2901    ПОЛИЦИЯ ШТАТА АЙДАХО СОЗДАНА — ДИРЕКТОР — ПОДРАЗДЕЛЕНИЯ — ПОЛНОМОЧИЯ И ОБЯЗАННОСТИ — НЕПОЛНЕНИЕ МИРОТВОРИТЕЛЯМИ ПРИКАЗОВ, ПРОСТУПЛЕНИЕ — ЗАМЕСТИТЕЛИ — КОМПЕНСАЦИЯ И ПОЛНОМОЧИЯ.
67-2901А    ПОЛНОМОЧИЯ ПО ПРОВЕДЕНИЮ ПРОВЕРОК БЕЗОПАСНОСТИ И ПРОВЕРКИ СООТВЕТСТВИЯ АВТОТРАНСПОРТНЫХ СРЕДСТВ — ПРИНЯТИЕ ПРАВИЛ — ШТРАФ.
67-2901B    ОСМОТР АВТОМОБИЛЕЙ — ИСКЛЮЧЕНИЯ — СЕРТИФИКАЦИЯ РЕМОНТА — ПРОВЕРКА СООТВЕТСТВИЯ — ШТРАФЫ.
67-2902    ДИРЕКТОР И ЗАМЕСТИТЕЛИ — ПОЛНОМОЧИЯ СОТРУДНИКОВ ПОЛИЦИИ.
67-2904    АДМИНИСТРАТОР — НАЗНАЧЕНИЕ, СРОК, ЗАРПЛАТА.
67-2905    ЮРИСДИКЦИЯ.
67-2906    СОТРУДНИЧЕСТВО И ОБМЕН ИНФОРМАЦИЕЙ.
67-2907    ТЮРЕМНИКИ ПРИНИМАЮТ ЗАКЛЮЧЕННЫХ ОТ ПОЛИЦИИ ШТАТА АЙДАХО.
67-2908    ЗАРАБОТНАЯ ПЛАТА И РАСХОДЫ — ИСТОЧНИК ОПЛАТЫ.
67-2912    ГОСУДАРСТВЕННЫЙ ФОНД УВЕДОМЛЕНИЯ ПОСТРАДАВШИХ.
67-2913    ПОИСК И СПАСАТЕЛЬНЫЙ ФОНД.
67-2913А    СНЕГОХОДНЫЙ ПОИСКОВО-СПАСАТЕЛЬНЫЙ ФОНД — КОНСУЛЬТАТИВНЫЙ КОМИТЕТ.
67-2914    СОЗДАН ПРАВООХРАНИТЕЛЬНЫЙ ФОНД АЙДАХО.
67-2915    СТАТИСТИЧЕСКИЙ ОТЧЕТ О ЗЛОУПОТРЕБЛЕННЫХ ПРЕСТУПЛЕНИЯХ.
67-2916    СООБЩЕНИЯ ОБ УБИЙСТВАХ.
67-2917    ОПАСНЫЕ ОТХОДЫ.
67-2918    ШТРАФЫ.
67-2919    ПРОВЕРКА И ХРАНЕНИЕ КОМПЛЕКТОВ ДЛЯ ДОКАЗАТЕЛЬСТВ ПО СЕКСУАЛЬНЫМ НАСИЛИЯМ.
67-2920    СИНЯЯ СИСТЕМА СИГНАЛИЗАЦИИ.
67-2921    ПЕРЕВОЗКА ПРОМЫШЛЕННОЙ КОНОПЛИ.

БАМ Глава 29: Cronobacter | FDA

Бактериологическое аналитическое руководство (BAM) Основная страница

Авторы: Йи Чен, Кит Лампель и Томас Хаммак

История изменений:

  • , март 2012 г.: новая глава (данная глава заменила метод выделения и подсчета Enterobacter sakazakii из обезвоженной сухой детской смеси (доступен как заархивированное содержимое)).
  • Апрель 2012 г.: разделы D.1.a, D.1.b, D.2.3; Исправление: Флуоресценция регистрируется в конце каждого этапа отжига , а не в конце каждого этапа удлинения.

Введение

Cronobacter представляет собой грамотрицательную палочку семейства Enterobacteriaceae (7). Организм назывался «желто-пигментированный Enterobacter cloacae », пока в 1980 г. он не был переименован в Enterobacter sakazakii (6). Urmenyi и Franklin сообщили о первых двух известных случаях менингита, вызванного E.sakazakii в 1961 г. (11). Впоследствии во всем мире были зарегистрированы случаи менингита, септицемии и некротизирующего энтероколита, вызванные E. sakazakii (9). Хотя большинство задокументированных случаев связаны с младенцами, в отчетах описываются также инфекции и у взрослых. В целом показатели летальности значительно различаются, достигая в некоторых случаях 80 процентов (8). В то время как резервуар для E. sakazakii неизвестен, все большее число сообщений предполагают, что сухие смеси для детского питания являются средством передачи инфекции (12).

Недавно полученные данные с использованием полиморфизма длин амплифицированных фрагментов, фенотипических массивов, автоматизированного риботипирования, секвенирования гена 16S рРНК и гибридизации ДНК-ДНК привели к изменению номенклатуры. E. sakazakii был реклассифицирован в новый род Cronobacter , включающий пять видов, включая Cronobacter sakazakii gen. nov., Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp.nov. и Cronobacter dublinensis sp. ноябрь Все эти виды ранее были вовлечены в клинические случаи. Также был предложен один дополнительный новый вид, Cronobacter genomospecies I (таблица 1) (7).

Таблица 1. Биохимические тесты для дифференциации видов и подвидов рода Cronobacter (7).

  К. Саказакии C. malonaticus С.турицензис C. геномвид I К. Муйтьенсии C. dublinensis подвид. Дублинский C. dublinensis подвид. лактариди C. dublinensis подвид. лозанненский
Производство индола + + + В
Использование источников углерода:
Дульцит + + +
Лактулоза + + + + + + +
малонат + + В + +
Мальтитол + + + + + +
Палатиноза + + + + В + + +
Путрескин + В + В + + + В
Мелезитоза + +
Тураноза + + + В В + В
мио-инозитол В В + + + + +
цис-аконитат + + + + В + + +
транс-аконитат + + В + + +
1-0-метил а-D-глюкопиранозид + + + + + + +
4-аминобутират + + + В + + + +

+: 90% положительных результатов; V: 20-80% положительных результатов; −: 10 % положительных результатов 90 167

Метод

Описанный здесь метод включает в себя как метод ПЦР в реальном времени для быстрого скрининга, так и культуральный метод для обнаружения/выделения Cronobacter spp. . (3). Хромогенные агары используются для выделения культуры для подтверждения. Этап предварительного обогащения используется для выращивания бактерий до количества (≥ 10 3 КОЕ/мл), определяемого с помощью ПЦР и хромогенных агаров. Культуральная часть этого метода представляет собой полный метод обнаружения/выделения, поэтому его можно использовать как самостоятельный метод, если технология ПЦР недоступна. Часть метода ПЦР представляет собой метод скрининга, положительные результаты которого всегда должны подтверждаться культуральным методом. Метод ПЦР можно использовать для подтверждения наличия чистых культур Cronobacter spp.Этот метод был проверен в предварительных и совместных исследованиях (1,2).

Инклюзивность этого метода была определена путем анализа 51 различных штаммов Cronobacter, представляющих шесть видов Cronobacter, которые были выделены из пищевых продуктов, клинических образцов, поверхностей окружающей среды и культурных хранилищ, признанных на национальном/международном уровне. Происхождение и источник каждого штамма перечислены в таблице инклюзивности (A). Каждый штамм был обогащен бульоном настоя мозгового сердца (BHI) и разбавлен буферной пептонной водой (BPW) примерно в 10 раз выше предела обнаружения.Разбавленные культуры затем тестировали в соответствии с этим методом.

Эксклюзивность этого метода была определена путем тестирования 42 штаммов, отличных от Cronobacter. Источник и происхождение каждого штамма указаны в Таблице эксклюзивности (B). Каждый штамм был обогащен бульоном BHI. Эти инкубированные культуры тестировали согласно этому методу.

  1. Оборудование и материалы
    1. Весы вместимостью 2 кг и чувствительностью 0,1 г
    2. Инкубатор, 36 ± 1º C
    3. Стерильные колбы Эрленмейера с полиэтиленовыми завинчивающимися крышками и тефлоновыми вкладышами, 2 литра
    4. Микропипетка и наконечники для дозирования объемов 1 мкл, 100 мкл, 150 мкл и 200 мкл
    5. Пипетки, 1, 5 и 10 мл, градуировка 0. 1 мл шт.
    6. Стерильные петли для посева, размер петли 3 мм
    7. Стеклянные стержни (например, хоккейная клюшка) диаметром 3-4 мм с площадью раскрытия 45-55 мм
    8. Стерильная посуда для работы с пробами (см. BAM, Глава 1)
    9. Центрифуга с качающимся ротором, способная развивать ускорение 3000×g
    10. Микроцентрифуга с ускорением 10 000 g
    11. Центрифужные пробирки, полипропилен, 50 мл пробирки с коническим дном; Микроцентрифужные пробирки на 1,5 мл
    12. Вихревой миксер
    13. Водяная баня, до 100 °C
    14. Термоциклеры: ABI Prism 7500 Fast Sequence Detection System (Life Technologies, Inc.Карлсбад, Калифорния ), система ПЦР в реальном времени SmartCycler (Cepheid, Sunnyvale, CA )
    15. Пробирки с центрифужными адаптерами для SmartCycler II (минимальный реакционный объем 25 мкл)
    16. 96-луночный микропланшет
    17. Оптические клейкие крышки
    18. Чашки Петри, пластиковые, стерильные, 15 × 150 мм
    19. VITEK ® 2 Compact (bioMerieux, Hazelwood, MO 63402)
    20. NanoDrop ND1000 (Thermal Scientific, Уилмингтон, Делавэр, 19810)
  2. Среды и реактивы
    1. Фосфатно-солевой буфер (BAM R59)
    2. Забуференная пептонная вода (BPW) (BAM M192)
    3. Brilliance Агар Enterobacter sakazakii (состав DFI) (кат. № CM1055, Oxoid, Lenexa, KS). Подготовьте среду в соответствии с инструкциями на этикетке упаковки. После заливки и сушки чашек в перевернутом виде при комнатной температуре их можно поместить в рукава для чашек Петри и хранить в перевернутом виде при температуре 2–8 ºC в темноте до 2 недель.
    4. Enterobacter sakazakii хромогенный посевной агар (агар R&F) (кат. № M-0700, R&F Laboratories, Downers Grove, IL). Подготовьте среду в соответствии с инструкциями производителя на этикетке упаковки.После заливки чашек их следует хранить в перевернутом виде в темноте в течение 48 часов при комнатной температуре для высыхания поверхности агара. Затем чашки можно поместить в чашки Петри (сделав в них отверстие диаметром от 0,5 до 1 дюйма для выхода конденсата) и хранить в перевернутом виде при температуре 2–8 ºC в темноте до 45 дней.
    5. Реагент для теста на оксидазу (BAM R54)
    6. PrepMan Ultra ® реагент для пробоподготовки (кат. № 4318930. Life Technologies)
    7. Мастер-микс для ПЦР iQ™ Supermix (Кат. № 170-8860, Bio-Rad, Hercules, CA ). 2×смесь содержит 100 мМ KCl, 40 мМ Tris-HCl, pH 8,4, по 0,4 мМ каждого dNTP, 50 ед/мл ДНК-полимеразы iTaq и 6 мМ MgCl 2 .
    8. Биохимические полоски Rapid ID 32 E (bioMerieux)
    9. Грамотрицательная идентификационная карта VITEK (bioMérieux)
    10. Platinum ® ДНК-полимераза Taq (кат. № 10966-018, Invitrogen, Carlsbad, CA )
    11. Праймеры и зонды (таблица 2). Праймеры для ПЦР коммерчески синтезируются путем базовой очистки от солей, а затем восстанавливаются с использованием воды для ПЦР до 100 мкМ для длительного хранения.Их разбавляют до концентрации рабочего раствора 40 мкМ. ПЦР-зонды коммерчески синтезируются с очисткой ВЭЖХ и восстанавливаются до 2,5 мкМ в одноразовых аликвотах с использованием 1-кратного буфера ТЕ для ПЦР. Праймеры и зонды необходимо хранить в замороженном виде (от -20 до -70 ºC). Откажитесь от оставшихся размороженных зондов и избегайте повторного замораживания-оттаивания.

      Таблица 2. Праймеры и зонды для ПЦР

      Олигос Имя Последовательности (от 5 до 3 футов)
      Cronobacter вперед КроноФ GGGATATTGTCCCCTGAAACAG
      Cronobacter реверс КроноР КГАГААТААГКЦГККАТТ
      Зонд Cronobacter КроноП 6FAM-AGAGTAGTAGTTGTAGAGGCCGTGCTTCCGAAAG-TAMRA
      Внутренний контроль вперед Инкф CTAACCTTCGTGATGAGCAATCG
      Внутреннее управление реверсом InCR GATCAGCTACGTGAGGTCCTAC
      Датчик внутреннего контроля ИнСП Cy5-AGCTAGTCGATGCACTCCAGTCCTCCT-Iowa Black RQ-Sp.
    12. ДНК внутреннего контроля
    13. (3): ДНК внутреннего контроля (InC) конструируют путем создания последовательности длиной 198 п. н., которая синтезируется и встраивается в вектор pZErO-2 и трансформируется в Escherichia coli Представлено представление частичной последовательности pDMD801, содержащее внутренний контроль ниже (инвентарный номер GenBank FJ357008, рисунок 1). Последовательность ДНК внутреннего контроля (IAC на рисунке 1) выделена серым цветом, промотор T7 представлен в рамке, а M13, прямой и обратный праймеры внутреннего контроля и мишени зонда представлены стрелками.Плазмиду экстрагируют с помощью мини-набора Qiagen Plasmid Mini Kit (кат. № 12125, Qiagen, Valencia, CA

      ) из трансформированных клеток Escherichia coli в соответствии с инструкциями производителя и количественно определяют с помощью NanoDrop ND1000. ДНК внутреннего контроля также может быть коммерчески синтезирована и разбавлена ​​до исходного раствора, который обеспечит надежный Ct не менее 24, когда присутствует ДНК Cronobacter , и не более 34, когда Cronobacter отсутствует.

      Рис. 1. Иллюстрация ДНК внутреннего контроля

  3. Подготовка образцов детских смесей для выделения Cronobacter
    1. Всегда носите двойные перчатки. Меняйте внешние перчатки, протирайте весы и рабочую зону после обработки каждого образца
    2. Простерилизуйте края контейнера и ложки, используемые для отбора проб, перед отбором проб.
    3. В асептических условиях отвесить 100 г сухой детской смеси и добавить в 2-литровые колбы Эрленмейера.
    4. Добавьте 900 мл (разведение 1:10) стерильной забуференной пептонной воды (BPW) и осторожно встряхните рукой, пока порошок не станет однородным. Инкубировать в течение 24 ± 2 ч при 36 ± 1 °C.
    5. Тщательно перемешайте смесь для обогащения и отберите из инкубированного образца четыре аликвоты по 40 мл каждая и поместите их в четыре центрифужные пробирки на 50 мл. Отцентрифугируйте аликвоты при 3000 × g в течение десяти минут в центрифуге с качающимся ковшом (центрифуги с фиксированным углом не рекомендуются из-за проблем с отделением жиров от гранул).
    6. Аспирируйте супернатанты из каждой центрифужной пробирки.
    7. Используйте стерильные ватные тампоны или эквивалентные инструменты для удаления осадка жира на боковой стенке центрифужной пробирки, если это необходимо.
    8. Суспендировать полученный осадок в 200 мкл фосфатно-солевого буфера (PBS) путем встряхивания на максимальной скорости в течение не менее 20 секунд. Две аликвоты будут использованы для ПЦР. При необходимости две аликвоты будут использоваться для подтверждения культуры.
  4. ПЦР-скрининг Cronobacter
    Экстракция ДНК.Центрифуга 200 мкл взвешенных клеток (в PBS) при 3000 × г в течение 5 мин в микроцентрифужной пробирке объемом 1,5 мл. В зависимости от наличия и отсутствия бактериальных клеток и эффективности удаления жира на предыдущем этапе после центрифугирования может быть 4 слоя. Верхний слой представляет собой остатки жира, второй слой – надосадочная жидкость, третий слой – гранулы бактериальных клеток, которые имеют коричневый/желтый цвет, а нижние гранулы – частицы молока. Удалите супернатанты и любые остатки жира из каждой центрифужной пробирки.Добавьте 400 мкл реагента для подготовки проб PrepMan Ultra ® в каждую пробирку и перемешайте на вортексе на максимальной скорости, чтобы обеспечить полное суспендирование. Нагрейте образец в течение 10 минут при 100 ° C на кипящей водяной бане или в нагревательном блоке, затем охладите образец до комнатной температуры в течение 2 минут. Центрифугировать образец в течение 2 мин при скорости не менее 15 000 g. Перенесите 50 мкл супернатанта в новую пробирку для ПЦР-анализа. Для каждого экстракта ДНК запустите оба протокола ПЦР с InC и без него. Если какой-либо из результатов ПЦР положительный, образец считается предположительно положительным или не может быть исключен (CRO) и переходит к подтверждению посева (раздел E).Если оба экстракта ДНК отрицательные с помощью ПЦР, образец считается отрицательным и анализ прекращают.

    Включите положительный контроль (полученный путем разведения 1:10 чистой культуры штамма Cronobacter , т.е. E604) и контроль без матрицы (вода) в каждом цикле ПЦР. ПЦР предназначена для обнаружения очень низкого уровня клеток Cronobacter . Если после обогащения выращивается значительное количество клеток, ПЦР может давать высокую флуоресценцию. Одним из решений является разведение ДНК (1:10 или 1:100) и повторное проведение ПЦР.

    1. Термоциклер Cepheid SmartCycler (версия программного обеспечения 2.0d) .

      Подготовьте реакции ПЦР из компонентов реакции и конечных концентраций, перечисленных в Таблице 3 и Таблице 4. Создайте «прогон» на SmartCycler. Дайте каждому запуску уникальное имя запуска, выберите набор красителей FCTC25, выберите протокол трехэтапной ПЦР, как описано ниже, и назначьте соответствующие сайты на блоке циклера.

      1. Установка ПЦР без InC

        Условия ПЦР: 95 °C в течение 3 мин, затем 40 циклов: 95 °C в течение 15 с, 52 °C в течение 20 с и 72 °C в течение 30 с.Флуоресценцию регистрируют в конце каждого этапа отжига.

        Таблица 3. Компоненты реакции ПЦР для SmartCycler без InC

        Компонент Объем/реакция Окончательная концентрация
        Супермикс IQ 12,5 мкл 50 мМ KCl, 20 мМ Tris-HCl, 0,2 мМ каждого dNTP,
        0,625 ед. ДНК-полимеразы iTaq и 3 мМ MgCl 2
        Кроноф 0.5625 мкл (40 мкМ исходный раствор) 900 нМ
        КроноР 0,5625 мкл (40 мкМ исходный раствор) 900 нМ
        КроноП 2,5 мкл (исходный раствор 2,5 мкМ) 250 нМ
        Taq-полимераза 0,1 мкл (5 ЕД/мкл) 0,5 ЕВ
        Экстракт ДНК или контроль 2 мкл  
        Вода класса ПЦР Соответствующее количество для достижения 25 мкл  
      2. Установка ПЦР с InC
        Условия ПЦР: 95 °C в течение 3 мин, затем 40 циклов: 95 °C в течение 20 с, 50 ​​°C в течение 60 с и 72 °C в течение 30 с.Флуоресценцию регистрируют в конце каждого этапа отжига.

        Таблица 4. Компоненты реакции ПЦР для SmartCycler с InC

        Компонент Объем/реакция Окончательная концентрация
        Супермикс IQ 12,5 мкл 50 мМ KCl, 20 мМ Tris-HCl, 0,2 мМ каждого dNTP,
        0,625 ед. ДНК-полимеразы iTaq и 3 мМ MgCl 2
        Кроноф 0.5625 мкл (40 мкМ исходный раствор) 900 нМ
        КроноР 0,5625 мкл (40 мкМ исходный раствор) 900 нМ
        КроноП 2,5 мкл (исходный раствор 2,5 мкМ) 250 нМ
        Инкф 0,625 мкл (40 мкМ исходный раствор) 1000 нМ
        InCR 0,625 мкл (40 мкМ исходный раствор) 1000 нМ
        ИнСП 2.5 мкл (исходный раствор 2,5 мкМ) 250 нМ
        ИнК ДНК 1 мкл (0,01 пг/мкл; эквивалентно
        3 × 10 3 копий плазмиды на мкл)
        0,01 пг
        Taq-полимераза 0,5 мкл (5 ЕД/мкл) 2,5 ЕВ
        MgCl 2 1,5 мкл (50 мМ раствор) 3 мМ
        Экстракт ДНК или контроль 2 мкл  
        Вода класса ПЦР Соответствующее количество для достижения 25 мкл  
      3. Интерпретация качественных данных

        На приборе SmartCycler установите следующие параметры анализа для каналов FAM и Cy5. Обновите настройки анализа, если они были изменены до записи результатов.

        1. Применение: Анализ
        2. Анализ кривой: первичный
        3. Настройка порога: вручную
        4. Единицы ручной пороговой флуоресценции: Канал FAM настроен на 20 единиц. Канал Cy5 установлен на 30 единиц.
        5. Авто Минимальный цикл: 5
        6. Автоматический максимальный цикл: 10
        7. Действительный минимальный цикл: 3
        8. Действительный макс. Цикл: 60
        9. Вычитание фона: ON
        10. Крытый вагон Ср.Циклы: 0
        11. Фон Мин. Цикл: 5
        12. Фон Макс. Цикл: 40

        Первичные кривые флуоресценции, которые пересекают пороговое значение, будут записаны как «POS», а номер цикла, когда он пересечет пороговое значение, будет отображаться в представлении «Таблица результатов». Отрицательные результаты отображаются как «NEG». Каналы FAM и Cy5 коррелируют с мишенями Cronobacter и InC соответственно. Результаты также можно просмотреть графически (рис. 2).

        Рисунок 2 .Примеры скриншотов результата SmartCycler (график и табличное представление). Кривые амплификации Cronobacter (помечены FAM) и внутреннего контроля (помечены Cy5) показаны на графике. Значения Ct, положительные/отрицательные результаты и наборы красителей показаны в таблице результатов. Набор красителей FCTC25 содержит FAM, Cy3, TxR и Cy5. Cy3 и TxR не используются в анализе ПЦР.

        Экстракт ДНК считается ПЦР-положительным, если любой из циклов ПЦР (с InC и без него) положительный.
        Для ПЦР с InC экстракты ДНК, которые имеют значения Ct для FAM, а также демонстрируют сигмоидальные кривые амплификации, считаются CRO. Если значение Ct в FAM для экстракта ДНК отсутствует или кривая не имеет типичной сигмоидальной формы, необходимо проанализировать InC для этого экстракта ДНК:

        1. Экстракт ДНК считается отрицательным, если в Cy5 имеется значение Ct и кривая для Cy5 имеет сигмоидальную форму;
        2. Если значение Ct в Cy5 отсутствует, возможно, в образце присутствует ингибирующее вещество, и результат ПЦР недействителен. Экстракты ДНК должны быть разбавлены (1/10 водой для ПЦР) или центрифугированы для дальнейшей очистки, а ПЦР повторена; или непосредственно приступить к подтверждению культуры (раздел E).

        Для ПЦР без InC экстракты ДНК, которые имеют значения Ct для FAM, а также демонстрируют сигмоидальную кривую амплификации, считаются CRO и переходят к подтверждению культуры. Если в FAM отсутствуют значения Ct, экстракт ДНК считается отрицательным. Если ПЦР без InC отрицательна, но ПЦР с InC показывает возможное присутствие в образце ингибирующих веществ, то необходимо дополнительно развести очищенные экстракты ДНК и повторить ПЦР без InC.

        При использовании обоих протоколов положительный контроль матрицы должен генерировать положительный сигнал, чтобы результаты ПЦР были достоверными. Если контроль без матрицы показывает амплификацию, реакция может быть загрязнена и результат ПЦР недействителен. Повторить ПЦР; или непосредственно приступить к подтверждению культуры.

    2. Быстрый термоциклер ABI 7500 (версия программного обеспечения 2. 0.4)

      Подготовьте реакции ПЦР из компонентов реакции и конечных концентраций, перечисленных в Таблице 5 и Таблице 6.Создайте «новый эксперимент» на 7500 Fast. Дайте каждому эксперименту уникальное имя. Выберите следующие параметры:

      1. В «Экспериментальные свойства» выберите кривую количественного стандарта в качестве типа эксперимента; Реагенты Taqman и стандартная линейная скорость,
      2. В разделе «Настройка планшета» выберите «Нет» для эталонного красителя, «TAMRA» в качестве гасителя для зонда Cronobacter и «Нет» в качестве гасителя для зонда InC. Назначьте соответствующие сайты на блоке циклера.
      3. В «Прогонном методе» установите реакционный объем на лунку равным 25 мкл.Выберите условия ПЦР: 95 градусов по Цельсию в течение 3 мин, а затем 40 циклов 95 градусов по Цельсию в течение 15 секунд, 52 градусов по Цельсию в течение 40 секунд и 72 градусов по Цельсию в течение 15 секунд. Флуоресценцию регистрируют в конце каждого этапа отжига. ПЦР с InC и без него используют одни и те же условия ПЦР.
      1. Установка ПЦР без InC

        Таблица 5. Компоненты реакции ПЦР для ABI 7500 Fast без InC

        Компонент Объем/реакция Окончательная концентрация
        Супермикс IQ 12.5 мкл 50 мМ KCl, 20 мМ Tris-HCl, 0,2 мМ каждого dNTP,
        0,625 ед. ДНК-полимеразы iTaq и 3 мМ MgCl 2
        Кроноф 0,25 мкл (40 мкМ исходный раствор) 400 нМ
        КроноР 0,25 мкл (40 мкМ исходный раствор) 400 нМ
        КроноП 3 мкл (исходный раствор 2,5 мкМ) 300 нМ
        Taq-полимераза 0.1 мкл (5 ЕД/мкл) 0,5 ЕВ
        Экстракт ДНК или контроль 2 мкл
        Вода класса ПЦР Соответствующее количество для достижения 25 мкл
      2. Установка ПЦР с InC

        Таблица 6. Компоненты реакции ПЦР для ABI 7500 Fast с InC

        Компонент Объем/реакция Конечная концентрация
        Супермикс IQ 12.5 мкл 50 мМ KCl, 20 мМ Tris-HCl, 0,2 мМ каждого dNTP,
        0,625 ед. ДНК-полимеразы iTaq и 3 мМ MgCl 2
        Кроноф 0,25 мкл (40 мкМ исходный раствор) 400 нМ
        КроноР 0,25 мкл (40 мкМ исходный раствор) 400 нМ
        КроноП 3 мкл (исходный раствор 2,5 мкМ) 300 нМ
        Инкф 0.09375 мкл (40 мкМ исходный раствор) 150 нМ
        InCR 0,09375 мкл (40 мкМ исходный раствор) 150 нМ
        ИнСП 1,5 мкл (исходный раствор 2,5 мкМ) 150 нМ
        ИнК ДНК 0,005 пг/мкл (эквивалентно
        1,5 × 10 3 копий плазмиды на мкл)
        0,005 стр
        Taq-полимераза 0. 5 мкл (5 ЕД/мкл) 2,5 ЕВ
        MgCl 2 1,5 мкл (50 мМ раствор) 3 мМ
        Экстракт ДНК или контроль 2 мкл
        Вода класса ПЦР Соответствующее количество для достижения 25 мкл

        Чтобы проанализировать данные, установите автоматический базовый уровень и установите пороговое значение на 50 000 единиц как для FAM, так и для Cy5. Примеры снимков экрана с графиком и таблицей показаны на рисунке 3.Следуйте критериям интерпретации данных, чтобы SmartCycler интерпретировал данные.

        Рисунок 3 . Примеры скриншотов результата 7500 Fast. Кривые амплификации Cronobacter (обозначен как мишень 1) и InC (назначен как мишень 2) показаны на графике, а значения Ct и наборы красителей показаны в таблице результатов.

  5. Выделение Cronobacter

    Для образцов CRO равномерно распределите аликвоты по 100 мкл взвешенных клеток (полученных в C8) на каждый из двух хромогенных агаров DFI (4) и двух хромогенных посевных агаров R&F Cronobacter (9) с помощью стерильных распределяющих палочек. Кроме того, нанесите штрихом аликвоты взвешенных клеток на поверхность двух DFI и двух агаров R&F стерильными петлями для посева. Инкубируйте чашки с агаром при температуре 36 ± 1 °C в течение 18–24 часов. Наблюдайте чашки для колониальной морфологии, типичной для Cronobacter (рис. 4). Если культуры разрастаются на чашках, нанесите штрихом 3-миллиметровую петлю (10 мкл) газонного материала как минимум на три квадранта новой чашки для выделения одиночных колоний.

    Рис. 4а. колоний Cronobacter на агаре DFI.

    Рисунок 4b . колоний Cronobacter на агаре R&F. На планшете справа показан образец детской смеси с Cronobacter и фоновой флорой. Фоновая флора изменяет цвет фона агара с красного на желтый в большинстве областей. Колонии Cronobacter имеют зеленый цвет с желтым фоном и черный цвет с красным фоном.

  6. Идентификация Cronobacter

    Предположительно Колонии Cronobacter на агаре DFI имеют темно-зеленый, слабо-зеленый или коричневато-зеленый цвет. Некоторые колонии имеют только зеленый центр с бело-желтой каймой. Предполагаемые колонии Cronobacter на агаре R&F выглядят от синего до черного или от синего до серого на красном фоне. Красный фон может казаться пурпурно-красным при разном напряжении или при разных условиях освещения. Cronobacter не изменяет цвет агара R&F, но в присутствии фоновой микрофлоры, которая меняет цвет агара R&F с красного на желтый, колонии Cronobacter кажутся сине-зелеными (рис. 4b).

    1. Биохимическое подтверждение

      Культуры для биохимической идентификации должны быть не старше 24 часов. С помощью стерильной инокуляционной петли выберите одну предполагаемую колонию Cronobacter из каждой чашки с агаром DFI и агаром R&F и подтвердите с помощью системы биохимической идентификации Rapid ID 32 E или VITEK 2.0 в соответствии с инструкциями производителя. Для положительной идентификации с помощью Rapid ID 32 E необходимо включить тест на оксидазу.

    2. Подтверждение ПЦР

      Приготовьте ДНК предположительно положительных колоний на чашках с агаром DFI и R&F. Добавьте небольшое количество материала колонии к 150 мкл dH 2 O для ПЦР, содержащемуся в пластиковой центрифужной пробирке объемом 1,5 мл, и кипятите в течение 5 минут на кипящей водяной бане. Охладите пробирки во льду и отцентрифугируйте при 10 000 × g в течение 2 мин. Используйте 1 мкл этого лизированного материала в качестве матрицы ДНК для анализа ПЦР в реальном времени с любым из упомянутых выше протоколов ПЦР.

  7. Дополнительно: перечисление Cronobacter

    Используйте процедуру трехпробирочного наиболее вероятного числа (MPN) (Руководство BAM, Приложение 2; Определение наиболее вероятного числа из серийных разведений; ).В асептических условиях взвешивают в трех повторах 100 г, 10 г и 1 г сухой детской смеси и добавляют в колбы Эрленмейера объемом 2 л, 250 мл и 125 мл соответственно и проводят подготовку проб, выделение и идентификацию культуры. Рассчитайте MPN клеток Cronobacter /г образца, исходя из количества «пробирок» при каждом разведении, в котором было подтверждено присутствие клеток Cronobacter .

  8. Блок-схема всей процедуры

    Рис. 5. Блок-схема всей процедуры


Каталожные номера

  1. Чен Ю., К.Э. Ноэ, С. Томпсон, К.А. Элемс, Э.А. Браун, К.А. Лампель и Т.С. Гамак. 2011. Оценка пересмотренного метода FDA для обнаружения Cronobacter в сухой детской смеси: совместное исследование. J. Food Prot. В печати.
  2.  Чен, Ю., Т.С. Хаммак, К.Ю. Сонг и К.А. Лампель. 2009. Оценка пересмотренного метода Управления по санитарному надзору за качеством пищевых продуктов и медикаментов США для обнаружения и выделения Enterobacter sakazakii в сухой детской смеси: предварительное совместное исследование. Дж. АОАС, междунар. 92 :862-872.
  3. Чен Ю., К.Ю. Сонг, Э. У. Браун и К.А. Лампель. 2010. Разработка улучшенного протокола для выделения и обнаружения Enterobacter sakazakii ( Cronobacter ) из сухой детской смеси. J. Food Prot. 73 :1016-1022.
  4. Дир, Д.М., К.А. Лампель и Н. Гонсалес-Эскалона. 2010. Универсальный внутренний контроль для использования в качестве ДНК в ПЦР в реальном времени и в качестве РНК в ПЦР с обратной транскрипцией в реальном времени. Письмо. заявл. микробиол. 50 :366-372.
  5.  Другган, П. и К.Иверсен. 2009. Питательные среды для выделения Cronobacter spp. Междунар. Дж. Пищевая микробиология. 136 :169-178.
  6. Фармер Дж. Дж., III, М. А. Эсбери, Ф. В. Хикман. Исследовательская группа Enterobacteriaceae и D.J. Бреннер. 1980. Enterobacter sakazakii : новый вид « Enterobacteriaceae «, выделенный из клинических образцов. Междунар. Дж. Сист. Эвол. микробиол. 30 :569-584.
  7.  Иверсен, К., Н. Маллейн, Б. Маккарделл, Б.Д. Талл, А. Ленер, С. Фаннинг, Р. Стефан и Х. Йостен. 2008. Cronobacter род. nov., новый род для размещения биогрупп Enterobacter sakazakii и предложение Cronobacter sakazakii gen. ноя, гребен. nov., Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp.nov., Cronobacter dublinensis sp. nov., Cronobacter genomospecies 1, и трех подвидов, Cronobacter dublinensis subsp. dublinensis подвид. nov., Cronobacter blinensis subsp. лозанненский subsp. ноябрь и Cronobacter dublinensis subsp. лактариди подвид. ноябрь Междунар. Дж. Сист. Эвол. Микробиол . 58 :1442-1447.
  8. Лай, К.К. 2001. Enterobacter sakazakii инфекций среди новорожденных, младенцев, детей и взрослых.Отчеты о клинических случаях и обзор литературы. Медицина (Балтимор). 80 :113-122.
  9. Назаровец-Уайт, М. и Дж. М. Фарбер. 1997. Enterobacter sakazakii : обзор. Междунар. Дж. Пищевая микробиология. 34 :103-113.
  10. Рестейно, Л., Э. У. Фрэмптон, У. К. Лионберг и Р.Дж. Беккер. 2006. Хромогенная посевная среда для выделения и идентификации Enterobacter sakazakii из пищевых продуктов, пищевых ингредиентов и источников окружающей среды. J. Food Prot. 69 :315-322.
  11. Урменьи А.М. и А.В. Франклин. 1961. Смерть новорожденных от пигментной колиформной инфекции. Ланцет. 1 :313-315.
  12. Всемирная организация здравоохранения. Enterobacter sakazakii и другие микроорганизмы в сухой детской смеси: отчет о совещании. 2004.

Приложение

Таблица A. Результаты тестирования на инклюзивность для Cronobacter

Оригинальная лаборатория Исходный идентификатор Организм Источник Страна происхождения ДФИ и R&F б БЫСТРЫЙ ИДЕНТИФИКАТОР 32E ПЦР в реальном времени
UCD c /UZH d /NRC e Э265 С. малонатик сухое молоко Малайзия Положительный Положительный Кронобактэр Положительный
ИЛСИ ф Ф6-036 К. Саказакии Окружающая среда
(Сухое молоко)
Малайзия Положительный Положительный Кронобактэр Положительный
ИЛСИ Ф6-038 С.Саказаки Окружающая среда
(Сухое молоко)
Голландия Положительный Положительный Кронобактэр Положительный
ИЛСИ Ф6-040 К. Саказакии Окружающая среда
(Сухое молоко)
Голландия Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Э464 С. дублинский Окружающая среда
(Сухое молоко)
Зимбабве Положительный Положительный Кронобактэр Положительный
АТСС г ;
NCTC ч
АТСС 29544;
НКТС 11467
К. Саказакии человек (горло) неизвестно Положительный Положительный Кронобактэр Положительный
FDA и 607 С.Саказаки неизвестно неизвестно Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Э515 C. dublinensis вода Швейцария Положительный Положительный Кронобактэр Положительный
АТСС АТСС 12868 С. Саказаки неизвестно неизвестно Положительный Положительный Кронобактэр Положительный
АТСС АТСС 51329 C. muytjensii неизвестно неизвестно Положительный Положительный Кронобактэр Положительный
HCSC j ; FDA СК90 С.Саказаки поликлиника
(детская больница)
Канада Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Э632 К. Саказакии еда США Положительный Положительный Кронобактэр Положительный
HCSC HPB 2848 С. Саказаки клинический Канада Положительный Положительный Кронобактэр Положительный
HCSC HPB 2873 К. Саказакии клинический Канада Положительный Положительный Кронобактэр Положительный
HCSC HPB 2874 С.Саказаки клинический Канада Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Х. Муйтьенс
(Прага 72 26248)
К. Саказакии неизвестно Чехия Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Х.Мутьенс 52 C. malonaticus сухое молоко Австралия Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Х. Мутьенс 58 К. Саказакии сухое молоко Бельгия Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Х.Мутьенс 15 К. Саказакии сухое молоко Дания Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Х. Муйтьенс 8 К. Саказакии сухое молоко Франция Положительный Положительный Не- Cronobacter Положительный
УКД/УЖ/НРК Х.Мейтьенс 35 К. Саказакии сухое молоко Россия Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Х. Мутьенс 26 К. Саказакии сухое молоко Россия Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Х.Muytjens
(Nijmegen 15)
К. Саказакии новорожденный Голландия Положительный Положительный Кронобактэр Положительный
УКД/УЖ/НРК Х. Муйтьенс
(Неймеген 21)
К. Саказакии новорожденный Голландия Положительный Положительный Кронобактэр Положительный
ЦКЗ к ЦКЗ 5960-70 С.дублинский человек (кровь) США Положительный Положительный Кронобактэр Положительный
ЦКЗ ЦКЗ 3523-75 C. malonaticus человек (костный мозг) США Положительный Положительный Кронобактэр Положительный
НКТС НКТС 9238 С.Саказаки человек
(абдоминальный гной)
Великобритания Положительный Положительный Кронобактэр Положительный
НКТС НКТС 9529 Геномовид C. вода Великобритания Положительный Положительный Кронобактэр Положительный
АТСС АТСС ВАА893 С.Саказаки неизвестно США Положительный Положительный Кронобактэр Положительный
АТСС АТСС ВАА894 К. Саказакии неизвестно США Положительный Положительный Кронобактэр Положительный
ЦКЗ ЦКЗ 996-77 С.Саказаки человек (спинномозговая жидкость) США Положительный Положительный Кронобактэр Положительный
ЦКЗ ЦКЗ 1058-77 C. malonaticus человек (абсцесс молочной железы) США Положительный Положительный Кронобактэр Положительный
ЦКЗ ЦКЗ 407-77 С.Саказаки человек (мокрота) США Положительный Положительный Кронобактэр Положительный
ЦКЗ ЦКЗ 3128-77 К. Саказакии человек (мокрота) США Положительный Положительный Кронобактэр Положительный
ЦКЗ ЦКЗ 9369-75 С.Саказаки неизвестно США Положительный Положительный Кронобактэр Положительный
УЖ з3032 C. turicensis новорожденный (менингит) Швейцария Положительный Положительный Кронобактэр Положительный
HCSC
ILSI
СК81
Ф6-023
С.Саказаки человек Канада Положительный Положительный Кронобактэр Положительный
ИЛСИ; РАД1 Ф6-029 К. Саказакии новорожденный Голландия Положительный Положительный Кронобактэр Положительный
ИЛСИ 01-10-2001; Ф6-034 С. Саказаки клинический США Положительный Положительный Кронобактэр Положительный
ИЛСИ 8397; Ф6-043 К. Саказакии клинический США Положительный Положительный Кронобактэр Положительный
ЦКЗ;
ИЛСИ
CDC 289-81;
Ф6-049
С.малонатик клинический США Положительный Положительный Кронобактэр Положительный
ЦКЗ;
ИЛСИ
CDC 1716-77;
Ф6-052
К. Саказакии человек (кровь) США Положительный Положительный Кронобактэр Положительный
ИЛСИ;
РАД
Ф6-032;
Х. Мутьенс 7
К. Саказакии сухое молоко Уругвай Положительный Положительный Кронобактэр Положительный
УДК CFS112 К. Саказакии сухое молоко Ирландия Положительный Положительный Кронобактэр Положительный
УДК КФС349Н С.Саказаки сухое молоко Новая Зеландия Положительный Положительный Кронобактэр Положительный
УДК КФС352Н К. Саказакии сухое молоко Новая Зеландия Положительный Положительный Кронобактэр Положительный
УДК ЭС187 С. дублинский сухое молоко Ирландия Положительный Положительный Кронобактэр Положительный
ЦКЗ ЦКЗ 9363-75 К. Саказакии табурет США Положительный Положительный Не- Cronobacter Положительный
ЦКЗ ЦКЗ 4963-71 С.Саказаки табурет США Положительный Положительный Кронобактэр Положительный
ЦКЗ CDC 1895-73 C. malonaticus человек (фекалии) США Положительный Положительный Кронобактэр Положительный
РФ м ЭС626 С.Саказаки рисовая мука США Положительный Положительный Кронобактэр Положительный

a Положительный результат DFI показывает колонию зеленого цвета как Cronobacter. , Белфилд, Дублин 4, Ирландия
д УЖ: Р.Стефан, Институт безопасности пищевых продуктов, Цюрихский университет, Winterthurerstrasse 270, CH-8057, Швейцария
e NRC: Исследовательский центр Nestlé, Вер-Шез-ле-Блан, Лозанна, CH-1000, Швейцария
f ILSI: R. Ivy, Лаборатория безопасности пищевых продуктов, Корнельский университет, 412 Stocking Hall, Итака, штат Нью-Йорк, США
g ATCC: Американская коллекция типовых культур, Манассас, Вирджиния, США
h NCTC: Национальная коллекция типовых культур, Лондон, UK
i FDA: R.Buchanan, FDA-CFSAN, College Park, MD, USA
j HCSC: F. Pagotto, Health Products and Food Branch, Health Canada
k CDC: Center for Disease Control, Atlanta, GA, USA
l RAD: Кафедра медицинской микробиологии, Университет Неймегена, Радбауд, Нидерланды
m RF: L. Restaino, R&F Laboratories, Downers Grove, IL, USA

Таблица B. Результаты тестирования на эксклюзивность для Cronobacter

Оригинальная лаборатория Штамм ID Организм Источник ДФИ и R&F б БЫСТРЫЙ ИДЕНТИФИКАТОР 32E ПЦР в реальном времени
АТСС с 13047 Enterobacter cloacae спинномозговая жидкость Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 13048 Enterobacter aerogenes мокрота Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 13182 Клебсиелла окситока Глоточная миндалина Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 13880 Серратия marcescens прудовая вода Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 14485 Термофильный стрептококк неизвестно Нет роста Нет роста не Cronobacter Отрицательный
АТСС 14807 Bacillus subtilis почва Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 15469 Эдвардсиелла тарда фекалии Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 23055 Acinetobacter calcoaceticus неизвестно Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 23216 Leclercia adecarboxylata питьевая вода Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 25830 Морганелла моргания пациент с летней диареей Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 25922 Кишечная палочка клинический изолят Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 27028 Citrobacter koseri посев крови Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 27982 Pantoea agglomerans Жидкость для внутривенного вливания Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 29013 Клебсиелла пневмония кровь Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 29944 Провиденсия Реттгери неизвестно Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 27853 Pseudomonas fluorescens неизвестно Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 13472 Bacillus cereus неизвестно Нет роста Нет роста не Cronobacter Отрицательный
АТСС 33105 Серратия фикарная Калимирна рис Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 33420 Протей обыкновенный клинический изолят Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 33650 Escherichia hermanii палец ноги человека Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 15246 Alcalgenes faecalis неизвестно Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 33832 Escherichia vulneris неизвестно Отрицательный Отрицательный не Cronobacter Отрицательный
АТСС 29212 Enterococcus faecalis неизвестно Нет роста Нет роста не Cronobacter Отрицательный
АТСС 10054 Желтый микрококк неизвестно Нет роста Нет роста не Cronobacter Отрицательный
АТСС 51713 Buttiauzella noakiae неизвестно Положительный Положительный не Cronobacter Отрицательный
АТСС 25741 Pediococus acidilactici неизвестно Нет роста Нет роста не Cronobacter Отрицательный
АТСС 8090 Citrobacter freundii неизвестно Отрицательный Положительный не Cronobacter Отрицательный
АТСС 9789 Bacillus licheniformis молоко Нет роста Нет роста не Cronobacter Отрицательный
УЖ д /УКД д /НРК ф Э440 Enterobacter helveticus
sp. ноябрь
сухое молоко Положительный Положительный не Cronobacter Отрицательный
УЖ/UCD/NRC Э441 Новые виды Enterobacter сухое молоко Отрицательный Положительный не Cronobacter Отрицательный
УЖ/UCD/NRC Э644 Enterobacter cloacae человек (фекалии) Отрицательный Отрицательный не Cronobacter Отрицательный
УЖ/UCD/NRC Е904; 05-01-120 Enterobacter homaeechei сухое молоко Отрицательный Отрицательный не Cronobacter Отрицательный
ИЛСИ г Ф6-026 Enterobacter asburiae окружающая среда Отрицательный Отрицательный не Cronobacter Отрицательный
ИЛСИ Ф6-033 Enterobacter hormaechei сухое молоко Отрицательный Отрицательный не Cronobacter Отрицательный
LMG ч ; УЖ ЛМГ 23730 Enterobacter turicensis,
sp. ноябрь
фруктовый порошок Отрицательный Отрицательный не Cronobacter Положительный
Ручной пулемет; УЖ ЛМГ 23732 Enterobacter helveticus,
sp. ноябрь
фруктовый порошок Положительный Отрицательный не Cronobacter Отрицательный
УЖ 1160/04;Е908 Новые виды Enterobacter фруктовый порошок Положительный Отрицательный не Cronobacter Отрицательный
FDAi   Кубинская сальмонелла молоко Отрицательный Отрицательный не Cronobacter Отрицательный
FDA Yp 1313 Yersinia pseudotuberculosis неизвестно Отрицательный Отрицательный не Cronobacter Отрицательный
FDA Е 37 Yersinia enterocolitica неизвестно Отрицательный Отрицательный не Cronobacter Отрицательный
FDA 2457Т Шигелла флекснери клинический Отрицательный Отрицательный не Cronobacter Отрицательный
FDA   Шигелла Sonnei клинический Отрицательный Отрицательный не Cronobacter Отрицательный
Ложноположительный       4 / 42 4 / 42 0 / 42 1 / 42

a Положительный результат DFI показывает зеленую колонию как Cronobacter
b Положительный результат R&F показывает сине-зелено-черную колонию как Cronobacter
c ATCC: Американская коллекция типовых культур, Манассас, Вирджиния, США
d UZH: Р. Stephan, Institute for Food Safety, University of Zurich, Winterthurerstrasse 270, CH-8057, Switzerland
e UCD: S. Fanning, Center for Food Safety, University College Dublin, Belfield, Dublin 4, Ireland
f NRC: Исследовательский центр Nestlé, Vers-Chez-les-Blanc, Lausanne, CH-1000, Швейцария
g ILSI: R. Ivy, Лаборатория безопасности пищевых продуктов, Корнельский университет, 412 Stocking Hall, Итака, штат Нью-Йорк, США
h LMG : Коллекция бактерий BCCM/LMG, Гент, Бельгия
i FDA: K.Лампель, FDA-CFSAN, Колледж-Парк, Мэриленд, США

Добро пожаловать в главу 29, где наша страсть к авиации процветает!

Если вы летаете, строите, восстанавливаете или просто наслаждаетесь самолетами и авиацией, приглашаем вас посетить наши мероприятия и присоединиться к нашему отделению. Мы группа энтузиастов авиации, авиастроителей и пилотов, которые собираются вместе с единомышленниками, чтобы делиться идеями, обмениваться информацией, поощрять безопасность, служить местному авиационному сообществу и получать от этого массу удовольствия. Пожалуйста, приходите на нашу следующую встречу или мероприятие в качестве нашего гостя.

Мы встречаемся в первый четверг месяца. Пожалуйста, проверьте страницу собраний для получения самой последней информации и следите за нами на Facebook!

Член или нет… Присоединяйтесь к нам на любом из наших собраний. Мы будем рады видеть вас!

Начните планировать посещение собраний отделения в первый четверг каждого месяца, кроме июня и сентября. Для получения подробной информации о наших встречах посетите страницу встреч. Мы с нетерпением ждем встречи с вами.

Как вы уже должны знать, требования к оборудованию ADS-B отпали. AOPA опубликовала статью (см. здесь) о том, как получить разрешение на полет в воздушное пространство ADS-B без работающего оборудования. Рекомендуется использовать его только в экстренных случаях или для доставки самолета в магазин авионики, потому что он, вероятно, не будет одобрен несколько раз для одного и того же самолета.

В этом году мы провели очень успешный сезон ралли Young Eagles. Мы прекратим на зиму, но надеемся возобновить, как только весной погода снова станет хорошей.Следите за объявлениями здесь и на нашей странице в Facebook.

Если вам нужно продлить членство в отделении, вы можете загрузить форму продления членства. Это заполняемая форма в формате PDF, и после загрузки ее можно заполнить, а затем либо распечатать и принести на следующую встречу, либо отправить обратно по электронной почте Бобу или Кирку.

Наше отделение является частью всемирной сети отделений EAA. EAA воплощает дух авиации через самое активное в мире сообщество авиационных энтузиастов.Более 170 000 членов EAA наслаждаются весельем и духом товарищества, разделяя свою страсть к полетам, строительству и ремонту самолетов для отдыха. Чтобы узнать больше о EAA, наших программах и услугах, посетите нашу домашнюю страницу EAA.org.

Свод законов Раздел 34 Банковское дело, финансовые учреждения и деньги

ГЛАВА 1 – ГОСУДАРСТВЕННЫЙ СОВЕТ ФИНАНСОВЫХ УЧРЕЖДЕНИЙ HTML Слово
ГЛАВА 3 – БАНКИ И БАНКОВСКАЯ ДЕЯТЕЛЬНОСТЬ В ОБЩЕМ ОБРАЗЕ HTML Слово
ГЛАВА 5. УПРАВЛЕНИЕ БАНКОМ КОНСЕРВАТОРАМИ HTML Слово
ГЛАВА 6 — ЮЖНАЯ КАРОЛИНА ЕДИНЫЙ ЗАКОН О РАЗУМНОМ УПРАВЛЕНИИ ИНСТИТУЦИОНАЛЬНЫМИ СРЕДСТВАМИ HTML Слово
ГЛАВА 7. РЕОРГАНИЗАЦИЯ НЕСОСТОЯТЕЛЬНЫХ БАНКОВ HTML Слово
ГЛАВА 9 — БАНКОВСКИЙ КАПИТАЛ И ОСНОВНОЙ АКЦИОНЕР HTML Слово
ГЛАВА 11 — БАНКОВСКИЕ ВКЛАДЫ HTML Слово
ГЛАВА 12 — ОКРУЖНЫЕ И МНОГООКРУЖНЫЕ КОНТРОЛЬНО-КОНСУЛЬТАЦИОННЫЕ ЦЕНТРЫ HTML Слово
ГЛАВА 13 — БАНКОВСКИЕ ЗАЙМЫ И ИНВЕСТИЦИИ HTML Слово
ГЛАВА 15 — БАНК, ДЕЙСТВУЮЩИЙ В КАЧЕСТВЕ ДОВЕРЕННОГО ЛИЦА HTML Слово
ГЛАВА 19 — СЕЙФЫ HTML Слово
ГЛАВА 21 – БАНКИ И КОРПОРАЦИИ, ЗАНИМАЮЩИЕСЯ ТРАСТНЫМ БИЗНЕСОМ HTML Слово
ГЛАВА 24 — ЗАКОН О БАНКОВСКОЙ ХОЛДИНГОВОЙ КОМПАНИИ ЮЖНОЙ КАРОЛИНЫ [ОТМЕНЕН] HTML Слово
ГЛАВА 25 — ЗАКОН ЮЖНОЙ КАРОЛИНЫ ОБ ЭФФЕКТИВНОСТИ БАНКОВСКИХ И ФИЛИАЛЬНЫХ ОТДЕЛЕНИЙ 1996 ГОДА HTML Слово
ГЛАВА 26 — ЗАКОН КРЕДИТНОГО СОЮЗА ЮЖНОЙ КАРОЛИНЫ HTML Слово
ГЛАВА 27 — КРЕДИТНЫЕ СОЮЗЫ HTML Слово
ГЛАВА 28 – СБЕРЕЖИТЕЛЬНЫЕ ОБЪЕДИНЕНИЯ HTML Слово
ГЛАВА 29 — ЗАКОН О ФИНАНСИРОВАНИИ ПОТРЕБИТЕЛЕЙ HTML Слово
ГЛАВА 30 — УСТАВ ГОСУДАРСТВЕННОЙ СБЕРЕГАТЕЛЬНОЙ БАНК В ЮЖНОЙ КАРОЛИНЕ HTML Слово
ГЛАВА 31 — ДЕНЬГИ И ПРОЦЕНТЫ HTML Слово
ГЛАВА 33 — БАНКИ БАНКИ HTML Слово
ГЛАВА 36 — КРЕДИТНЫЕ БРОКЕРЫ HTML Слово
ГЛАВА 39 — УСЛУГИ ПО ОТСРОЧЕННОМУ ПРЕДСТАВЛЕНИЮ HTML Слово
ГЛАВА 41. УСЛУГИ ПО ОБНАличИВАНИЮ ЧЕКОВ HTML Слово
ГЛАВА 43 — ЗАКОН ОБ ЭКОНОМИЧЕСКОМ РАЗВИТИИ ЮЖНОЙ КАРОЛИНЫ HTML Слово
ГЛАВА 45 — КОНКУРСЫ ПО АКЦИИ СБЕРЕЖЕНИЙ HTML Слово

Глава 29

Резюме и анализ Глава 29

Резюме

Хитклиф прибывает, чтобы проводить Кэти домой, сообщая ей, что наказал Линтона за его роль в побеге Кэти.Он отказывается позволить Кэти жить в поместье, потому что хочет, чтобы она работала на себя, особенно после смерти Линтона. Юридически и Линтон, и Хитклифф имеют большие права на Мызу; таким образом, у Кэти нет другого выбора, кроме как подчиниться указанию своего тестя.

Кэти высказывается против Хитклифа, заявляя о своей любви к Линтону и о том, что Хитклифф одинок в этом мире. Когда она собирает вещи, Хитклиф признается Нелли, что верит в призраков, особенно в призрак Кэтрин. С момента ее похорон 18 лет назад он чувствовал ее присутствие и видел ее. Уходя, Хитклиф инструктирует Нелли не посещать Грозовой перевал, потому что она здесь не приветствуется.

Анализ

Полная степень жестокости Хитклифа, то, что он делает с Линтоном, не показана на странице; скорее, читатели могут оставить это своему воображению. Тем не менее, он до боли ясно дает понять, что Линтон никогда больше не будет с ним ссориться.

Хотя он и наказывает своего сына, Хитклиф не совсем лишен чувств.Потеря Кэтрин мучила его, и, как ни странно, после всего, что Хитклиф сделал с другими персонажами, многие читатели снова склонны сочувствовать ему за то, что он пережил. Бронте вызывает это сочувствие через объяснение Хитклифа, что он беспокоился каждую ночь в течение 18 лет, стремясь воссоединиться с Кэтрин, но имея ее вне досягаемости. Стремление Хитклифа быть единым целым с Кэтрин навечно — признак романтика, человека, искренне влюбленного и по-настоящему мучающегося от потери своей любви. Тем не менее, верный своей натуре, он заканчивает главу таким же бессердечным, как всегда, сообщая Нелли, что она не должна посещать Грозовой перевал, фактически оставляя Кэти одну в ее новом доме.

Arizona Revised Statutes

Сессия: 2022 г. — Пятьдесят пятая сессия Законодательного собрания — Вторая очередная сессия2021 г. — Пятьдесят пятая сессия Законодательного собрания — Первая специальная сессия 2021 г. — Пятьдесят пятая сессия Законодательного собрания — Первая очередная сессия — Первая очередная сессия 2018 г. — Пятьдесят третья законодательная сессия — Первая специальная сессия 2018 г. — Пятьдесят третья законодательная сессия — Вторая очередная сессия 2017 г. — Пятьдесят третья законодательная сессия — Первая очередная сессия 2016 г. — Пятьдесят вторая законодательная сессия — Вторая очередная сессия 2015 г. — Пятьдесят вторая законодательная сессия — Первая специальная сессия 2015 г. — Пятьдесят вторая сессия — Первая очередная сессия2014 — Пятьдесят первая сессия — Вторая очередная сессия 2014 — Пятьдесят первая сессия — Вторая очередная сессия 2013 — Пятьдесят первая сессия — Первая очередная сессия 2013 — Пятьдесят первая сессия — Первая очередная сессия2012 — Пятидесятая сессия — Вторая очередная сессия Session2011 — Пятидесятая законодательная сессия — Четвертая специальная сессия2011 — Пятидесятая сессия ature — Третья специальная сессия 2011 г. — Законодательный орган пятидесятого созыва — Вторая специальная сессия 2011 г. — Законодательный орган пятидесятого созыва — Первая специальная сессия 2011 г. — Законодательный орган пятидесятого созыва — Первая очередная сессия 2010 г. — Законодательный орган 49-го созыва — Специальная девятая сессия 2010 г. — Законодательный орган 49-го созыва — Восьмая специальная сессия 2010 г. — Законодательный орган 49-го созыва — Седьмая специальная сессия 2010 г. — Сорок девятая законодательная сессия — Шестая специальная сессия 2010 г. — Сорок девятая законодательная сессия — Вторая очередная сессия 2009 г. — Сорок девятая законодательная сессия — Пятая специальная сессия 2009 г. — Сорок девятая законодательная сессия — Четвертая специальная сессия 2009 г. — Сорок девятая законодательная сессия — Третья специальная сессия 2009 г. — Сорока Законодательный орган девятого созыва — Вторая специальная сессия 2009 г. — Законодательный орган 49-го созыва — Первая специальная сессия 2009 г. — Законодательный орган 49-го созыва — Первая очередная сессия 2008 г. — Законодательный орган 48-го созыва — Вторая очередная сессия 2007 г. — Законодательный орган 48-го созыва — Первая очередная сессия 2006 г. Специальная сессия 2006 г. — Сорок седьмая сессия Законодательного собрания — Вторая очередная сессия Сессия 2005 г. — Сорок седьмая сессия Законодательного собрания — Первая очередная сессия 2004 г. — Сорок шестая сессия Законодательного собрания — Вторая очередная сессия 2003 г. — Сорок шестая сессия Законодательного собрания — Вторая специальная сессия 2003 г. — Сорок шестая сессия Законодательного собрания — Первая специальная сессия 2003 г. — Сорок шестая сессия Законодательного собрания — Первая очередная сессия 2002 г. — Сорок пятая сессия Законодательный орган — Шестая специальная сессия 2002 г. — Сорок пятый законодательный орган — Пятая специальная сессия 2002 г. — Сорок пятый законодательный орган — Четвертая специальная сессия 2002 г. — Сорок пятый законодательный орган — Третья специальная сессия 2002 г. — Сорок пятый законодательный орган — Вторая очередная сессия 2001 г. — Сорок пятый законодательный орган — Вторая специальная сессия 2001 г. — Сорок пятая законодательная сессия — Первая специальная сессия 2001 г. — Сорок пятая законодательная сессия — Первая очередная сессия 2000 г. — Сорок четвертая законодательная сессия — Седьмая специальная сессия 2000 г. — Сорок четвертая законодательная сессия — Шестая специальная сессия 2000 г. — Четвертая специальная сессия, 2000 г. — Сорок четвертая сессия Законодательного собрания — Вторая очередная сессия, 1999 г. — Законодательный орган сорок четвертого созыва — Третья специальная сессия 1999 г. — Законодательный орган сорок четвертого созыва — Вторая специальная сессия 1999 г. — Законодательный орган сорок четвертого созыва — Первая специальная сессия 1999 г. — Законодательный орган сорок четвертого созыва — Первая очередная сессия 1998 г. — Пятая специальная сессия 1998 г. — Сорок третья законодательная сессия — Четвертая специальная сессия 1998 г. — Сорок третья законодательная сессия — Третья специальная сессия 1998 г. — Сорок третья законодательная сессия — Вторая очередная сессия 1997 г. — Сорок третья законодательная сессия — Вторая специальная сессия 1997 г. Сорок третья сессия — Первая очередная сессия, 1996 г. — Сорок вторая сессия — Седьмая специальная сессия, 1996 г. — Сорок вторая сессия — Шестая специальная сессия, 1996 г. — Сорок вторая сессия — Пятая специальная сессия, 1996 г. — Сорок вторая сессия — Вторая очередная сессия, 1995 г. — Сорок вторая сессия — Четвертая специальная сессия 1995 г. — Сорок вторая сессия Законодательного собрания — Третья специальная сессия 1995 г. — Forty-Se cond Законодательный орган — Вторая специальная сессия 1995 г. — Сорок вторая сессия Законодательного собрания — Первая специальная сессия 1995 г. — Сорок вторая сессия Законодательного органа — Первая очередная сессия 1994 г. — Сорок первая сессия Законодательного органа — Девятая специальная сессия 1994 г. — Сорок первая сессия Законодательного органа — Восьмая специальная сессия 1994 г. — Сорок первая сессия Законодательного органа — Вторая очередная сессия Сессия 1993 г. — Сорок первая сессия Законодательного собрания — Седьмая специальная сессия 1993 г. — Сорок первая сессия Законодательного собрания — Шестая специальная сессия 1993 г. — Сорок первая сессия Законодательного собрания — Пятая специальная сессия 1993 г. — Сорок первая сессия Законодательного собрания — Четвертая специальная сессия 1993 г. — Сорок первая сессия Законодательного собрания — Третья специальная сессия 1993 г. — Сорок первая сессия Законодательный орган — Вторая специальная сессия1993 г. — Сорок первая Законодательная власть — Первая специальная сессия 1993 г. — Сорок первая Законодательная власть — Первая очередная сессия 1992 г. — Сороковая законодательная власть — Девятая специальная сессия 1992 г. — Сороковая законодательная власть — Восьмая специальная сессия 1992 г. — Сороковая законодательная власть — Седьмая специальная сессия 1992 г. — Сороковая законодательная власть — Пятая специальная сессия Session1992 — Сороковой Законодательный орган — Шестая Специализированная l Сессия 1992 г. — Сороковая сессия — Вторая очередная сессия 1991 г. — Сороковая сессия — Четвертая специальная сессия 1991 г. — Сороковая сессия — Третья специальная сессия 1991 г. — Сороковая сессия — Вторая специальная сессия 1991 г. — Сороковая сессия — Первая специальная сессия 1991 г. — Сороковая сессия — Первая очередная сессия 1990 г. — Тридцать девятая сессия — Пятая специальная сессия 1990 г. — Законодательный орган тридцать девятого созыва — Четвертая специальная сессия 1990 г. — Законодательный орган тридцать девятого созыва — Третья специальная сессия 1990 г. — Законодательный орган тридцать девятого созыва — Вторая очередная сессия 1989 г. — Законодательный орган тридцать девятого созыва — Вторая специальная сессия 1989 г. — Законодательный орган тридцать девятого созыва — Первая специальная сессия 1989 г. — Тридцать -девятый Законодательный орган — Первая очередная сессия

Снижение рисков за счет смягчения последствий выбросов

Объем этой главы был определен федеральным Руководящим комитетом Четвертой национальной оценки климата (NCA4), который состоит из представителей США. S. Агентства-члены Программы исследования глобальных изменений (USGCRP) (см. Приложение 1: Процесс для получения дополнительной информации о Руководящем комитете). Масштаб также определялся исследовательскими потребностями, определенными в Третьей национальной оценке климата (NCA3) и в последующих анализах пробелов. 155 Предполагаемые авторы были номинированы соответствующим агентством, университетом, организацией или коллегами. Все потенциальные авторы были опрошены относительно их квалификации и опыта. Авторы были отобраны для представления различных точек зрения, имеющих отношение к смягчению последствий, а последняя группа представила точки зрения федеральных и государственных агентств, нефедеральных организаций по исследованию климата и частного сектора.Команда авторов запросила общественное мнение по объему главы и плану через веб-семинар и во время презентаций на конференциях и семинарах.

Эта глава была разработана на основе технических обсуждений соответствующих доказательств и экспертных обсуждений авторами отчета в ходе обширных телеконференций, семинаров и обмена электронной почтой. Эти обсуждения основывались на результатах всестороннего обзора литературы, в том числе исследований, направленных на оценку предотвращенных или сниженных рисков изменения климата.Авторы рассмотрели предложения, представленные общественностью, заинтересованными сторонами и федеральными агентствами, и улучшили главу на основе раундов рецензирования, проведенных общественностью, Национальными академиями наук, инженерии и медицины, а также федеральными агентствами. Группа авторов также участвовала в целевых консультациях в ходе многочисленных обменов мнениями с авторами, участвовавшими в других главах этой оценки, а также с авторами Специального отчета по науке о климате (CSSR). Для получения дополнительной информации об общем процессе составления отчета см. Приложение 1: Процесс.

Основное сообщение 1: Мероприятия по смягчению последствий в Соединенных Штатах

Мероприятия, связанные со смягчением последствий, осуществляются в Соединенных Штатах на федеральном уровне, уровне штатов и на местном уровне, а также в частном секторе ( очень высокая достоверность ). После Третьей национальной оценки климата все большее число штатов, городов и предприятий реализуют или углубляют инициативы, направленные на сокращение выбросов (, очень высокая достоверность, ).

Описание доказательной базы

Начиная с NCA3, государственные, местные и племенные органы объявили о новых или расширенных усилиях по сокращению выбросов парниковых газов (ПГ). Несмотря на то, что некоторые меры политики, связанные с сопутствующими выбросами, были упразднены, в целом число инициатив, направленных на сокращение выбросов, увеличилось. Рисунок 29.1 включает несколько типов усилий на уровне штатов и взят из рисунка ES-3 отчета America’s Pledge Phase 1, наиболее полного списка усилий по секторам, доступного в настоящее время.Базовая информация о состоянии получена из Министерства энергетики США, Проекта по повышению осведомленности о стандартах бытовой техники, Открытой энергетической информации, Rethink Food Waste Through Economics and Data, Института мировых ресурсов, штат Нью-Йорк, Калифорнийского совета по воздушным ресурсам, Университета Миннесоты, Land Trust. Альянс и Лесная служба США.

Число государственных и местных программ ценообразования на выбросы углерода в США увеличилось после NCA3. 156 Региональная инициатива по выбросам парниковых газов расширила масштабы деятельности по сокращению выбросов и рассматривает возможность включения в нее транспорта.Калифорнийская программа ограничения выбросов и торговли квотами началась в 2012 году и была расширена за счет привязки к Квебеку и Онтарио в 2017 году. Системы торговли квотами на выбросы запланированы в Массачусетсе и находятся на рассмотрении в Вирджинии. 156

В 90 166 штатах США действуют как обязательные, так и добровольные программы, которые различаются по строгости и степени воздействия. Например, 29 штатов, Вашингтон, округ Колумбия, и 3 территории имеют стандарты портфеля возобновляемых источников энергии (RPS; https://energy.gov/eere/slsc/renewable-portfolio-standards-resources), которые требуют, чтобы некоторая часть электроэнергии была источником. из возобновляемых источников энергии; в то время как 8 штатов и 1 территория имеют добровольные цели портфеля возобновляемых источников энергии. 42 , 45 Аналогичным образом, в 20 штатах действуют обязательные Стандарты ресурсов энергоэффективности (EERS; https://energy.gov/eere/slsc/energy-efficiency-resource-standards-resources), а в 8 штатах цели энергоэффективности. 42 Хотя количество штатов с политиками RPS и EERS остается таким же, как и во время NCA3, сокращение выбросов, связанное с влиянием этих политик, увеличилось и, по прогнозам, будет увеличиваться. 157 В 2013 году 8 штатов предприняли усилия по координации реализации своих государственных программ создания автомобилей с нулевым уровнем выбросов и с тех пор предприняли ряд действий. 158

Уровни федерального бюджета для мероприятий, направленных на сокращение выбросов парниковых газов, в последние годы оставались стабильными. Существует неопределенность в отношении реализации федеральных инициатив, отчасти из-за реализации Исполнительного указа 13783. 40 , 159 Федеральные исследования и разработки, связанные с энергетикой, имеют несколько сопутствующих преимуществ, включая сокращение выбросов. 15

90 166 американских компаний, которые отчитываются в рамках проекта Carbon Disclosure Project, все чаще (хотя и не в полной мере) сообщают о контроле на уровне совета директоров по вопросам климата, который вырос с 50% в 2011 году до 71% в 2017 году.Аналогичным образом, 59 американских компаний недавно взяли на себя обязательство установить научно обоснованные цели по сокращению выбросов. 46 Предприятия США все чаще устанавливают цены на углерод. 46 , 160 Корпоративные закупки солнечной энергии выросли на порядок с 2014 года. 47

Как указано в базе данных отчетов образовательных учреждений, все большее число университетов взяли на себя обязательства по сокращению выбросов или углубили существующие обязательства 161 , а также опубликовали результаты своих усилий. 162

Основные неопределенности

На рис. 29.1 показано количество каждого типа из 30 мер по 6 категориям, но не исследуется относительная строгость или влияние этих мер на выбросы. Размер, сфера охвата, временные рамки и применимость мер варьируются в зависимости от штата. Некоторые усилия государства и большинство усилий города носят добровольный характер, поэтому стандарты отчетности различаются. В настоящее время предпринимаются усилия по обеспечению строгого учета совокупного масштаба этих инициатив.Сбор данных в рамках программы America’s Pledge — это непрерывный итеративный процесс, который по необходимости включает объединение различных показателей в категории. Исторически сложилось так, что государственные, местные и корпоративные политики меняются в разные циклы.

Описание достоверности и вероятности

Существует очень высокая степень уверенности в том, что государственные, местные и частные организации все чаще предпринимают или обязуются предпринимать меры по снижению выбросов парниковых газов. Публичные заявления и сопоставленные индексы показывают тенденцию к увеличению количества обязательств, а также широты и глубины обязательств за последние пять лет.

Ключевое сообщение 2: Риски бездействия

В отсутствие более значительных глобальных усилий по смягчению последствий изменение климата, по прогнозам, нанесет значительный ущерб экономике США, здоровью человека и окружающей среде ( очень высокая достоверность ). Согласно сценариям с высокими выбросами и ограниченной адаптацией или ее отсутствием, ежегодные потери в некоторых секторах, по оценкам, вырастут до сотен миллиардов долларов к концу века (, высокая достоверность, ).Весьма вероятно, что некоторые физические и экологические воздействия будут необратимыми в течение тысяч лет, тогда как другие будут постоянными ( очень высокая достоверность ).

Описание доказательной базы

Недавние научные и экономические достижения улучшают способность понимать и количественно оценивать физические и экономические последствия изменения климата в Соединенных Штатах, в том числе то, как этих рисков можно избежать или уменьшить за счет крупномасштабного смягчения последствий выбросов парниковых газов. Несмотря на то, что прогнозируемые воздействия изменения климата по секторам и регионам хорошо задокументированы в ходе этой оценки, несколько проектов многосекторного моделирования позволяют сравнивать последствия посредством использования согласованных сценариев и допущений. 2 , 3 , 4 , 5 Общепризнанный вывод из литературы, подготовленной этими проектами, заключается в том, что изменение климата, по прогнозам, неблагоприятно повлияет на США.экономика, здоровье человека и окружающая среда, каждая из которых подробно описана ниже. Эти предполагаемые убытки увеличиваются со временем, особенно при более высоком сценарии (РТК8.5). Для секторов, в которых положительные эффекты наблюдаются в некоторых регионах или в определенные периоды времени (например, снижение смертности от экстремально низких температур или положительное влияние на урожайность), эффекты обычно затмеваются изменениями, происходящими в целом в секторе или в более широких масштабах ( например, сравнительно большее увеличение смертности от экстремальной жары или неблагоприятных последствий для многих других культур). 2 , 3 , 4 , 5 интервалы. 2 Однако важно отметить, что анализ, лежащий в основе этого результата, не дал количественной оценки более широких экономических последствий, связанных с этими вегетативными сдвигами, включая разрушение экосистемы и изменение экосистемных услуг.См. Главу 6: Леса для обсуждения весомости данных, касающихся прогнозов будущей активности лесных пожаров, которые, как правило, показывают увеличение годовой выгораемой площади с течением времени. См. главу 25: Юго-запад для обсуждения засушливости к концу этого века в условиях высоких выбросов.

Имеются надежные и последовательные доказательства того, что изменение климата, по прогнозам, негативно повлияет на многие компоненты экономики США. Прогнозируется, что повышение температуры, повышение уровня моря и изменения в экстремальных явлениях повлияют на застроенную среду, включая дороги, мосты, железные дороги и развитие прибрежных районов. Например, прогнозируется, что затопление побережья во время прилива значительно увеличит время задержки транспортных средств. 163 Годовой ущерб прибрежной собственности от повышения уровня моря и штормовых нагонов, при условии отсутствия адаптации, согласно прогнозам RCP8.5 , к концу века составит от десятков до сотен миллиардов долларов (гл. 8: Прибрежные районы). ) . 2 , 5 Прогнозируемые ежегодные затраты на ремонт дорог, мостов и железных дорог для поддержания уровня обслуживания в свете изменения климата варьируются от миллиардов до десятков миллиардов долларов в рамках РТК8.5. 2 , 164 Многочисленные исследования показывают, что региональные экономики также могут подвергаться риску, особенно когда они связаны с экологическими ресурсами или экосистемными услугами, которые особенно уязвимы к изменению климата. Например, прогнозируемое сокращение рекреационных услуг на коралловых рифах 152 , 165 , 166 приведет к сокращению доходов от туризма; более короткие сезоны зимнего отдыха, вероятно, приведут к закрытию горнолыжных зон и курортов; 167 , 168 , 169 , 170 и повышенный риск вредоносного цветения водорослей может ограничить рекреацию водохранилища (гл. 3: Вода) . 171 , 172

Растущий объем литературы указывает на то, что воздействие на здоровье человека, вероятно, будет иметь одно из самых значительных последствий для экономики. Исследования неизменно показывают, что вызванные климатом изменения заболеваемости и смертности могут быть значительными. 72 , , , , , , , , 174, , , , , , , 176 В некоторых секторах стоимость убытков здравоохранения оценивается для достижения сотен миллиардов долларов в год в соответствии с RCP8.5 к концу века. Большая часть общего ущерба для здоровья связана со смертностью, количественно определяемой с использованием подхода «Ценность статистической жизни» (VSL), основанного на стандартных значениях VSL, используемых в нормативном анализе федерального правительства. 177 Например, ежегодный ущерб, связанный со смертью, связанной с экстремальными температурами, оценивается в 140 миллиардов долларов США к концу века в соответствии с RCP8.5, в то время как потеря заработной платы из-за экстремальных температур, особенно для наружной промышленности, прогнозируется на уровне 160 миллиардов долларов США в год. к 2090 году. 2 Адаптивные действия, включая физиологическую адаптацию и повышение доступности кондиционирования воздуха, по прогнозам, снизят смертность от экстремальных температур примерно наполовину; однако затраты на внедрение этих адаптаций не оценивались. Хотя влияние климата на качество воздуха 72 , 178 и аэроаллергены 173 , 179 менее изучено по сравнению с исследованиями прямого воздействия температуры на здоровье, также прогнозируется. эффекты из-за увеличения медицинских расходов (таких как посещения отделений неотложной помощи) и преждевременной смертности (гл. 13: Качество воздуха) .

Несколько направлений исследований также показали, что некоторые последствия изменения климата, скорее всего, будут необратимыми в течение тысяч лет. Прогнозируется, что для некоторых видов скорость и масштабы изменения климата, прогнозируемые на 21 век, повысят риск исчезновения или истребления (вымирания в местном масштабе) в Соединенных Штатах. 180 , 181 , 182 , 183 9: океаны; Ч. 7: Экосистемы) . Быстрые и широкомасштабные изменения климата, происходящие в Арктике и Антарктике, приводят к исчезновению горных ледников и сокращению континентальных ледяных щитов. 69 , 184 Прогнозируется, что вклад этого объема наземного льда в скорость глобального повышения уровня моря будет влиять на береговые линии США на протяжении столетий (гл. 8: Прибрежные районы) . 19 , 30 , 185

Основные неопределенности

Это ключевое сообщение отражает рассмотрение результатов нескольких недавних многоотраслевых проектов моделирования (например,г. , Сян и др. 2017, О’Нил и др. 2017 г., EPA 2017 г., Houser et al. 2015) 2 , 3 , 4 , 5 выпущены после NCA3. Несмотря на эти усовершенствования для количественной оценки физических и экономических последствий изменения климата в разных секторах, существует неопределенность в отношении конечных сроков и масштабов изменений, особенно в локальном и региональном масштабах. Источники неопределенности различаются в зависимости от сектора и применяемых подходов к моделированию.Каждый подход также различается по своей способности измерять способность адаптации снижать уязвимость, незащищенность и риск. В то время как охват воздействий улучшился благодаря последним достижениям в науке, многие важные последствия изменения климата остаются неизученными, равно как и взаимодействия между секторами (гл. 17: Сложные системы) . 85 Наконец, по мере того, как климатические условия выходят за пределы естественной изменчивости, наблюдаемой в течение последних нескольких тысячелетий, шансы пересечения порогов или переломных моментов (таких как исчезновение арктического летнего морского льда) возрастают, хотя эти пороги недостаточно хорошо представлены в текущих модели. 22 , 142

Описание достоверности и вероятности

Существует очень высокая степень уверенности в том, что изменение климата, по прогнозам, существенно повлияет на средства к существованию и благополучие американцев в будущем по сравнению с будущим без изменения климата. Доказательства, подтверждающие этот вывод, основаны на согласии в большом количестве исследований, анализирующих воздействие во множестве секторов, сценариев и регионов. В литературе четко указывается, что, по прогнозам, неблагоприятные последствия изменения климата значительно перевешивают положительные последствия.Хотя существуют важные неопределенности, влияющие на наше понимание времени и масштабов некоторых воздействий, существует очень высокая степень уверенности в том, что некоторые воздействия, скорее всего, приведут к изменениям, необратимым в масштабах человеческого времени.

Ключевое сообщение 3: предотвращение или снижение воздействия благодаря смягчению последствий

Многие последствия изменения климата и связанный с ним экономический ущерб в Соединенных Штатах могут быть существенно уменьшены в течение 21 века за счет сокращения выбросов парниковых газов в глобальном масштабе, хотя масштабы и сроки предотвращенных рисков различаются в зависимости от сектора и региона ( очень высокая достоверность ). Ожидается, что влияние краткосрочного смягчения последствий выбросов на снижение рисков станет очевидным к середине века и существенно возрастет после этого ( очень высокая достоверность ).

Описание доказательной базы

Существует несколько направлений исследований и литературы, позволяющих охарактеризовать влияние крупномасштабных мер по снижению выбросов парниковых газов на предотвращение или снижение долгосрочных рисков изменения климата в Соединенных Штатах. Недавние многосекторальные проекты по моделированию воздействий, все из которых содержат согласованные наборы сценариев и допущений для различных анализов, обеспечивают улучшенные возможности для сравнения воздействий по секторам и регионам, включая влияние глобального смягчения последствий выбросов ПГ на предотвращение или снижение рисков. 2 , 3 , 4 , 5 Результаты этих скоординированных проектов моделирования постоянно показывают снижение воздействия в разных секторах благодаря крупномасштабным мерам по смягчению последствий. Для большинства секторов этот эффект смягчения последствий обычно становится очевидным к середине века, а затем значительно возрастает. В некоторых секторах смягчение последствий может принести большие выгоды. Например, к концу века уменьшение изменения климата по более низкому сценарию (РТК4.5) по сравнению с более высоким (РТК8.5) позволяет избежать (в чистом виде и при отсутствии дополнительного снижения риска за счет адаптации) от тысяч до десятков тысяч смертей в год от экстремальных температур, 2 , 5 сотен до тысяч смертей в год от плохого качества воздуха, 2 , 72 и потери сотен миллионов рабочих часов. 2 , 3 , 5

Помимо этих многосекторальных проектов моделирования, обширная литература по отраслевым исследованиям сравнивает воздействие в Соединенных Штатах при альтернативных сценариях.Тщательный обзор этих исследований, особенно тех, которые были опубликованы после Третьей национальной оценки климата, обнаруживает сильную и последовательную поддержку вывода о том, что глобальное смягчение последствий выбросов парниковых газов может предотвратить или уменьшить долгосрочные риски изменения климата в Соединенных Штатах. Например, смягчение за счет снижения риска неблагоприятных воздействий, связанных с экстремальными погодными событиями, 29 , 186 Эффекты здоровья, связанные с температурой, 99 , 100 , 175 урожайность, 187 , 188 , 189 и лесные пожары. 73 , 190 , 191

Вывод о том, что масштабы и сроки предотвращенных рисков различаются в зависимости от сектора и региона, а также в связи с изменениями в социально-экономических условиях и способности к адаптации, постоянно подтверждается обширной литературной базой многоотраслевого анализа (например, Hsiang et al. 2017, O ‘Neill et al. 2017, EPA 2017, Houser et al. 2015 2 , 3 , 4 , 3 (e) и целевые секторные исследования.г., Мелвин и др. 2016, Нейманн и др. 2014 71 , 77 ). Сложные пространственные модели предотвращенных рисков обычно наблюдаются в разных секторах, в том числе в отношении воздействия на здоровье человека (например, Fann et al. 2015, Sarofim et al. 2016 100 , 178 ), сельского хозяйства (например, Beach et al. 2015 192 ) и водные ресурсы (например, Chapra et al. 2017, Wobus et al. 2017, EPA 2013 167 , 171 5 63 63 , 63563 , 635 , 635 ).

Совокупность данных исследований, опубликованных в литературе, указывает на то, что разница в результатах воздействия на климат между различными сценариями была более скромной в первой половине века, 9 , так как вынужденная реакция человека, возможно, еще не возникла из-за шума естественной изменчивости климата. 6 При оценке и количественном определении многосекторального воздействия по альтернативным сценариям литература в целом показывает, что эффект краткосрочного смягчения последствий для предотвращения ущерба значительно возрастает после 2050 года. 2 , 4 , 5 Например, прогнозируется, что смягчение последствий согласно РТК4.5 сократит количество преждевременных смертей и потерянных рабочих часов из-за экстремальных температур на 24 % и 21 % (соответственно) к 2050 г. , и 58 % и 48 % к 2090 г. 2 Для воздействия на побережье, когда инерция климатической системы приводит к меньшим различиям в темпах повышения уровня моря по сценариям, последствия краткосрочных смягчений становятся очевидными только к концу век (гл.8: Прибрежный) . 2 , 5 , 19

Основные неопределенности

Количественная оценка многосекторального воздействия изменения климата включает ряд аналитических шагов, каждый из которых имеет свои собственные потенциальные источники неопределенности. Сроки и масштабы прогнозируемого будущего изменения климата являются неопределенными из-за неопределенности, вызванной человеческим выбором, естественной изменчивостью и научной неопределенностью, которая включает неопределенность как в научном моделировании, так и в чувствительности климата. Один из наиболее известных источников включает проекцию изменения климата на региональном уровне, которая может варьироваться в зависимости от предположений о чувствительности климата, естественной изменчивости и использовании какой-либо одной конкретной климатической модели. Достижения в способности климатических моделей разрешать ключевые аспекты атмосферной циркуляции, улучшенные статистические и динамические процедуры уменьшения масштаба и использование нескольких членов ансамбля в анализе воздействия повысили надежность потенциальных климатических изменений, которые определяют оценки воздействия, описанные в недавней литературе. .Однако основные неопределенности и проблемы остаются, в том числе структурные различия между отраслевыми моделями воздействия, способность моделировать будущие воздействия с высоким пространственным и временным разрешением и недостаточные подходы для количественной оценки экономической ценности изменений в нерыночных товарах и услугах. 85 Кроме того, литература по экономическому ущербу от изменения климата в Соединенных Штатах неполна по охвату, и необходимы дополнительные исследования, чтобы лучше отразить будущие социально-экономические изменения, включая способность адаптации снижать риск.

Описание достоверности и вероятности

Существует очень высокая степень уверенности в том, что крупномасштабное сокращение выбросов парниковых газов в 21 веке, по прогнозам, снизит уровень изменения климата, которое, по прогнозам, произойдет в Соединенных Штатах, наряду с неблагоприятными последствиями для здоровья человека и окружающей среды. В литературе есть ограниченные случаи, когда смягчение по сравнению со сценарием с более высокими выбросами не дает чистых выгод для Соединенных Штатов.Хотя содержание этой главы в первую очередь сосредоточено на 21 веке, уверенность в способности смягчения последствий избежать или уменьшить воздействие возрастает при рассмотрении последствий после 2100 года.

Ключевое сообщение 4: Взаимодействие между смягчением последствий и адаптацией

Взаимодействия между смягчением последствий и адаптацией сложны и могут принести пользу, но они также могут иметь неблагоприятные последствия ( очень высокая достоверность ). Адаптация может дополнять меры по смягчению последствий для существенного снижения воздействия и уязвимости к изменению климата в некоторых секторах ( очень высокая достоверность ). Эта взаимодополняемость особенно важна, учитывая, что определенная степень изменения климата из-за прошлых и настоящих выбросов неизбежна ( очень высокая достоверность ).

Описание доказательной базы

Прогнозируется, что сокращение выбросов парниковых газов в глобальном масштабе уменьшит многие риски, связанные с изменением климата.Однако американцы уже испытывают и будут продолжать испытывать последствия, которым уже подвергались из-за прошлых и нынешних выбросов. 5 , 9 Кроме того, модели многосекторального моделирования показывают, что смягчение последствий вряд ли позволит полностью избежать неблагоприятных последствий изменения климата. , , , , , , , 4 , 5 , 27 Эти факторы, вероятно, потребуют широко распространенной адаптации к изменению климата (CH. 28: Адаптация) ; расширяющаяся литература постоянно указывает на возможность снижения долгосрочных рисков и экономического ущерба от изменения климата. 2 , 4 , 5 , 194 Однако важно отметить, что адаптация может потребовать больших предварительных затрат и долгосрочных обязательств по обслуживанию29: гл. Адаптация) , и в некоторых секторах существует неопределенность в отношении применимости и эффективности адаптации для снижения риска. 101

Из-за способности адаптации снижать риск так, как не может смягчение последствий, и наоборот, множество доказательств показывает, что эти две стратегии могут дополнять друг друга. В нескольких недавних исследованиях совместно моделируются последствия смягчения последствий и адаптации для снижения общего риска последствий изменения климата в Соединенных Штатах с упором на инфраструктуру (например, Ларсен и др., 2017 г., Мелвин и др. , 2016 г., Нойманн и др., 2014 г.) 71 , 77 , 195 и сельское хозяйство (напр.г., Кайе и Кемада, 2017 г., Чаллинор и др. 2014, Лобелл и др. 2013). 108 , 109 , 111 Изучение этой взаимосвязи смягчения последствий и адаптации также продвигается в секторе здравоохранения, причем как смягчение последствий, так и адаптация (такие как изменения в поведении или физиологическая акклиматизация) экстремальные температуры 100 как в сценариях с более высокими, так и с более низкими выбросами, которым посвящена эта глава.Аналогичным образом, инвестиции в повышение энергоэффективности сокращают выбросы парниковых газов и эксплуатационные расходы, а также повышают устойчивость к будущим перебоям в подаче электроэнергии из-за экстремальных погодных явлений (гл. 14: Здоровье человека) . Хотя необходимы дополнительные исследования, изучающие совместное воздействие смягчения последствий и адаптации, недавняя литература показывает, что комбинированные действия по смягчению последствий и адаптации могут существенно снизить риски, связанные с изменением климата, в нескольких секторах. 2 , 103 , 104 Однако в нескольких исследованиях подчеркивается, что смягчение последствий и адаптация могут также взаимодействовать отрицательно.Хотя эти исследования более ограничены в литературе, секторы, демонстрирующие потенциальные негативные сопутствующие эффекты смягчения последствий и адаптации, включают взаимосвязь между биоэнергией и водными ресурсами 114 и изменения спроса и предложения электроэнергии в ответ на более широкое использование кондиционирования воздуха. 2 , 117

Основные неопределенности

Общеизвестно, что адаптация, вероятно, снизит климатические риски и что адаптация и смягчение последствий взаимодействуют.Однако существуют неопределенности в отношении величины, времени и регионального/секторального распределения этих эффектов. Полное понимание взаимодействия между смягчением последствий и адаптацией с подробным учетом потенциальных положительных и отрицательных сопутствующих эффектов является важной исследовательской задачей, которая только начинает изучаться в деталях, необходимых для обеспечения эффективной реализации этих политик. Количественная оценка эффективности адаптации требует детального анализа сроков и масштабов того, как, по прогнозам, климат повлияет на людей, живущих в Соединенных Штатах, а также на их природную и искусственную среду.Таким образом, неопределенности, описанные в ключевых сообщениях 1 и 2, также актуальны здесь. Кроме того, существует неопределенность в отношении эффективности адаптационных мер для повышения устойчивости к климатическим воздействиям. Для некоторых секторов, таких как развитие прибрежных районов, меры защиты (например, подъемные сооружения) были хорошо изучены и реализованы для снижения риска. Однако эффективность адаптации в других областях, таких как физиологическая реакция на более интенсивные волны тепла, только начинает пониматься.

Описание достоверности и вероятности

Существует очень высокая степень уверенности в том, что двойные стратегии смягчения последствий и адаптации, принимаемые на национальном, региональном и местном уровнях, обеспечивают дополнительные возможности для снижения рисков, связанных с изменением климата. Исследования последовательно показывают, что адаптация будет особенно важна для последствий, которые будут иметь место в течение следующих нескольких десятилетий, периода времени, в течение которого последствия крупномасштабных мер по смягчению последствий еще трудно распознать.Тем не менее, необходим дальнейший анализ, чтобы помочь устранить неопределенности в отношении сроков и масштабов адаптации, включая потенциальные положительные и отрицательные сопутствующие эффекты смягчения последствий.

.

Оставить комментарий

Ваш адрес email не будет опубликован.