402 гпк рф: ГПК РФ Статья 402. Применение правил подсудности / КонсультантПлюс

Содержание

ГПК РФ Статья 402. Применение правил подсудности / КонсультантПлюс

ГПК РФ Статья 402. Применение правил подсудности

1. В случае, если иное не установлено правилами настоящей главы, подсудность дел с участием иностранных лиц судам в Российской Федерации определяется по правилам главы 3 настоящего Кодекса.

2. Суды в Российской Федерации рассматривают дела с участием иностранных лиц, если организация-ответчик находится на территории Российской Федерации или гражданин-ответчик имеет место жительства в Российской Федерации.

3. Суды в Российской Федерации вправе также рассматривать дела с участием иностранных лиц в случае, если:

1) орган управления, филиал или представительство иностранного лица находится на территории Российской Федерации;

2) ответчик имеет имущество, находящееся на территории Российской Федерации, и (или) распространяет рекламу в информационно-телекоммуникационной сети «Интернет», направленную на привлечение внимания потребителей, находящихся на территории Российской Федерации;

(в ред. Федерального закона от 13.07.2015 N 264-ФЗ)

3) по делу о взыскании алиментов и об установлении отцовства истец имеет место жительства в Российской Федерации;

4) по делу о возмещении вреда, причиненного увечьем, иным повреждением здоровья или смертью кормильца, вред причинен на территории Российской Федерации или истец имеет место жительства в Российской Федерации;

5) по делу о возмещении вреда, причиненного имуществу, действие или иное обстоятельство, послужившие основанием для предъявления требования о возмещении вреда, имело место на территории Российской Федерации;

6) иск вытекает из договора, по которому полное или частичное исполнение должно иметь место или имело место на территории Российской Федерации;

7) иск вытекает из неосновательного обогащения, имевшего место на территории Российской Федерации;

8) по делу о расторжении брака истец имеет место жительства в Российской Федерации или хотя бы один из супругов является российским гражданином;

9) по делу о защите чести, достоинства и деловой репутации истец имеет место жительства в Российской Федерации;

10) по делу о защите прав субъекта персональных данных, в том числе о возмещении убытков и (или) компенсации морального вреда, истец имеет место жительства в Российской Федерации;

(п. 10 введен Федеральным законом от 07.05.2013 N 99-ФЗ)

11) по делу о прекращении выдачи оператором поисковой системы ссылок, позволяющих получить доступ к информации в информационно-телекоммуникационной сети «Интернет», истец имеет место жительства в Российской Федерации.

(п. 11 введен Федеральным законом от 13.07.2015 N 264-ФЗ)

Открыть полный текст документа

Статья 402 ГПК РФ с комментариями

Полный текст ст. 402 ГПК РФ с комментариями. Новая действующая редакция с дополнениями на 2021 год. Консультации юристов по статье 402 ГПК РФ.

1. В случае, если иное не установлено правилами настоящей главы, подсудность дел с участием иностранных лиц судам в Российской Федерации определяется по правилам главы 3 настоящего Кодекса.

2. Суды в Российской Федерации рассматривают дела с участием иностранных лиц, если организация-ответчик находится на территории Российской Федерации или гражданин-ответчик имеет место жительства в Российской Федерации.

3. Суды в Российской Федерации вправе также рассматривать дела с участием иностранных лиц в случае, если:
1) орган управления, филиал или представительство иностранного лица находится на территории Российской Федерации;
2) ответчик имеет имущество, находящееся на территории Российской Федерации, и (или) распространяет рекламу в информационно-телекоммуникационной сети «Интернет», направленную на привлечение внимания потребителей, находящихся на территории Российской Федерации;(Пункт в редакции, введенной в действие с 1 января 2016 года Федеральным законом от 13 июля 2015 года N 264-ФЗ.

3) по делу о взыскании алиментов и об установлении отцовства истец имеет место жительства в Российской Федерации;
4) по делу о возмещении вреда, причиненного увечьем, иным повреждением здоровья или смертью кормильца, вред причинен на территории Российской Федерации или истец имеет место жительства в Российской Федерации;
5) по делу о возмещении вреда, причиненного имуществу, действие или иное обстоятельство, послужившие основанием для предъявления требования о возмещении вреда, имело место на территории Российской Федерации;
6) иск вытекает из договора, по которому полное или частичное исполнение должно иметь место или имело место на территории Российской Федерации;
7) иск вытекает из неосновательного обогащения, имевшего место на территории Российской Федерации;

8) по делу о расторжении брака истец имеет место жительства в Российской Федерации или хотя бы один из супругов является российским гражданином;
9) по делу о защите чести, достоинства и деловой репутации истец имеет место жительства в Российской Федерации;
10) по делу о защите прав субъекта персональных данных, в том числе о возмещении убытков и (или) компенсации морального вреда, истец имеет место жительства в Российской Федерации;(Пункт дополнительно включен с 19 мая 2013 года Федеральным законом от 7 мая 2013 года N 99-ФЗ)
11) по делу о прекращении выдачи оператором поисковой системы ссылок, позволяющих получить доступ к информации в информационно-телекоммуникационной сети «Интернет», истец имеет место жительства в Российской Федерации. (Пункт дополнительно включен с 1 января 2016 года Федеральным законом от 13 июля 2015 года N 264-ФЗ)

Комментарий к статье 402 ГПК РФ

1. Под международной подсудностью применительно к Российской Федерации понимается компетенция российских судов общей юрисдикции и арбитражных судов при рассмотрении споров с участием иностранных лиц, позволяющая разграничить ее с компетенцией иных государств.

Иностранное гражданство, иностранное место жительства или место нахождения организации, принадлежащего ей или физическому лицу имущества, иностранное место исполнения договора или причинение внедоговорного вреда предопределяют регулирование спорных правоотношений национальными правовыми режимами разных государств. В каждой стране законодатель самостоятельно определяет компетентные суды и границы международной подсудности им гражданских дел.

Международная подсудность не имеет тотального надгосударственного регулирования, не имеет общих для всех государств правил и принципов, которые бы ее определяли.

Важную роль упорядоченного решения вопросов, связанных с международной подсудностью, играют многосторонние конвенции (соглашения) и двусторонние договоры (например, Киевское соглашение от 20 марта 1992 года о порядке разрешения споров, связанных с осуществлением хозяйственной деятельности государств СНГ, Минская конвенция стран СНГ от 22 января 1993 года о правовой помощи и правовых отношениях по гражданским, семейным и уголовным делам, Федеральный закон от 11 июня 2002 года N 64-ФЗ «О ратификации договора между Российской Федерацией и Арабской Республикой Египет о взаимной правовой помощи и правовых отношениях по гражданским, коммерческим и семейным делам»)*, в которых находит отражение более детальная регламентация международной компетенции национальных судов договаривающихся стран.

_______________
Сборник международных договоров Российской Федерации по оказанию правовой помощи. М., 1996. С. 54-57; Российская газета. 2002. 14 июня.

При отсутствии международного соглашения общие правила подсудности дел с участием иностранных лиц определяются в настоящем Кодексе (гл. 3 ГПК) и основаны на подведомственности суду общей юрисдикции дел с их участием (ч. 2, 3 ст. 22 ГПК).

Территориальная международная подсудность определяет компетентный суд каждого национального государства при обращении за судебной защитой в тех случаях, когда участником спорных правоотношений является иностранное лицо.

Международная территориальная подсудность и внутренняя территориальная подсудность между собой в основном совпадают. Это объясняется тем, что национальный гражданский процесс максимально учитывает интересы истца (заявителя), которому необходимо обеспечить реальное исполнение судебного решения по результатам рассмотрения заявленных притязаний, и ответчика, нуждающегося в защите своих интересов всеми законными способами в комфортной языковой среде.

Процессуальное равенство между всеми участниками судебного разбирательства независимо от их относимости к отечественным или иностранным лицам также не порождает необходимости в принятии специальных правил для международного гражданского процесса.

Территориальная, а следом за ней и международная территориальная подсудность определяется по общему правилу местом жительства или местом нахождения ответчика, которое устанавливается в соответствии с национальным законодательством, учитывающим место государственной регистрации юридического лица и место нахождения его филиалов.

Если ответчик находится на территории Российской Федерации, то его иностранное происхождение и национальные особенности для установления международной подсудности дела значения не имеют.

Если ответчик находится вне пределов Российской Федерации, то российский суд, напротив, компетентен рассматривать дело с его участием лишь в случаях, предусмотренных законом. Они имеют отношение к правилам дополнительной (альтернативной) международной подсудности дел.

По делам об установлении фактов, имеющих юридическое значение, в отличие от искового производства, территориальная подсудность определяется местом жительства (нахождения) заявителя.

Компетенция российских судов в вопросах международной подсудности устанавливается национальным законодательством.

При отсутствии иных указаний законодателя компетенция российских судов общей юрисдикции конкретизируется с учетом правил о предъявлении иска по месту жительства или месту нахождения ответчика, правил исключительной подсудности, подсудности нескольких связанных между собой дел и договорной подсудности за теми изъятиями, которые предусмотрены для мировых судей и Верховного Суда РФ.

При этом под местом жительства признается то место, по которому иностранное лицо постоянно или преимущественно проживает, а местом жительства иностранного несовершеннолетнего лица, не достигшего 14 лет, признается в соответствии с гражданским законом (п.2 ст. 20 ГК РФ) место жительства его родителей, усыновителей, опекуна.

Если ответчиком выступает иностранное юридическое лицо, когда оно само или его органы находятся на территории Российской Федерации, то его место нахождения определяется по месту государственной регистрации, если иное не предусмотрено законом или учредительными документами (п. 2 ст. 54 ГК РФ). Из этого следует вывод о том, что местом нахождения иностранного лица является место нахождения его органов управления (п. 21 постановления Пленума Верховного Суда РФ и Пленума Высшего Арбитражного Суда РФ от 1 июля 1996 года N 6/8 «О некоторых вопросах, связанных с применением части первой Гражданского кодекса Российской Федерации»)*.

_______________
Вестник ВАС РФ. 1996. N 9. С. 104.

Уточнения внесены Федеральным законом от 8 августа 2001 года N 129-ФЗ «О государственной регистрации юридических лиц» (далее — Закон). При создании юридических лиц их государственная регистрация осуществляется по месту нахождения постоянно действующего исполнительного органа, а в случае его отсутствия — по месту нахождения иного органа или лица, имеющего право действовать от имени юридического лица без доверенности (ст. 13 Закона).

_______________
СЗ РФ. 2001. N 33. Ст.3431.

Авторский комментарий
(актуален на 2012 год)
Комментарий эксперта
(актуален на 2014 год)
Государственная регистрация юридического лица, создаваемого путем реорганизации, осуществляется по месту нахождения реорганизуемых юридических лиц. Если место их нахождения отличается от места нахождения реорганизуемого юридического лица, то порядок взаимодействия регистрирующих органов определяется Правительством РФ (п.1 ст. 15 Закона). Согласно п.1 ст. 15 Федерального закона от 08.08.2001 N 129-ФЗ «О государственной регистрации юридических лиц и индивидуальных предпринимателей» государственная регистрация юридического лица, создаваемого путем реорганизации, осуществляется регистрирующим органом по месту нахождения реорганизуемого юридического лица. В случае участия в реорганизации двух и более юридических лиц государственная регистрация юридического лица, создаваемого путем реорганизации, а также государственная регистрация прекращения в результате реорганизации деятельности юридических лиц осуществляется регистрирующим органом по месту нахождения реорганизуемого юридического лица, направившего в регистрирующий орган уведомление о начале процедуры реорганизации.

Отечественным законодателем определена не только компетенция российских судов, но и пределы международной подсудности дел.

2. Из общего правила о рассмотрении дел по месту жительства (месту нахождения) ответчика следует дополнительный вывод о том, что рассмотрение требований, предъявляемых лицам, проживающим (находящимся) на территории Российской Федерации, отнесено к компетенции российских судов независимо от гражданства (принадлежности) последних.

Если иностранное лицо имеет место жительства (место нахождения) за границей, то основания для предъявления к нему требований в российском суде по общему правилу отсутствуют. Однако из общего правила имеются исключения.

Основания, установленные законодателем для альтернативной подсудности, применительно ко внутреннему и международному порядку во многом совпадают. К их числу относятся обращения за судебной защитой в российские судебные учреждения в тех случаях, когда:
иностранное юридическое лицо находится за рубежом, но его органы управления, филиал или представительство находятся на территории Российской Федерации. Предъявление иска по месту нахождения в Российской Федерации филиала или представительства иностранного юридического лица может иметь место безотносительно к их деятельности, но применительно к объему делегированных им полномочий;
ответчик (иностранное лицо) находится за границей, но он располагает имуществом на территории Российской Федерации. Не всякое имущество может служить формальным признаком наличия дополнительной (альтернативной) подсудности, поскольку только с представляющим ценность имуществом могут быть связаны перспективы исполнения судебного решения и реальное удовлетворение исковых требований;
по делу об установлении отцовства и взыскании алиментов истец имеет место жительства в Российской Федерации, а ответчик (иностранное лицо) — за ее пределами;
заявлено требование о возмещении вреда вследствие увечья, иного повреждения здоровья, смерти кормильца, если вред причинен или истец проживает на территории Российской Федерации. Для установления возможности обращения в российский суд достаточно установить факт его причинения на территории Российской Федерации или проживания на этой территории истца;
по делу о возмещении вреда, причиненного имуществу, обстоятельства, связанные с его возникновением, имели место на территории Российской Федерации. Основанием для обращения за судебной защитой нарушенных прав и охраняемых законом интересов в российский суд может служить факт его причинения на территории Российской Федерации. Решающее значение при этом имеет место совершения противоправного действия (бездействия).

В частности, предъявление требований о возмещении вреда, возникшего вследствие столкновения судов, оказания помощи пострадавшим на море. Значение для установления возможности обращения в российский суд имеет приписка судна к российскому порту или его нахождение на территории Российской Федерации независимо от того, в каких водах имело место столкновение судов (во внутренних, территориальных или открытом море).

Но не может быть ограничений права на судебную защиту и по месту наступления вредных последствий, когда:
исковые требования возникают из договора, исполнение которого (полное или частичное) имело место или должно было осуществляться на территории Российской Федерации. Основанием для обращения в российский суд могут служить спорные правоотношения, возникающие из договора, которым определено место его исполнения — территория Российской Федерации;
исковые требования заявлены как возникшие из неосновательного обогащения на территории Российской Федерации;
по делу о расторжении брака хотя бы один супруг является гражданином Российской Федерации или место жительства истца находится на ее территории;
истец по делу о защите чести (как социальной оценки, общественного признания или неприятия в связи с той или иной деятельностью, поведением субъекта спорных правоотношений), достоинства (социального качества, присущего каждому человеку по факту его принадлежности к человеческому сообществу) и деловой репутации (позитивной или негативной оценкой деловых качеств личности, деловой активности предприятия, учреждения, организации) находится на территории Российской Федерации.

По правилам дополнительной (альтернативной) подсудности имеет место и предъявление иска по связи дел, которая распространяет подсудность одного требования на все другие, если их разъединение невозможно. Наглядным примером могут служить правила о принятии и рассмотрении встречного иска независимо от его подсудности как самостоятельного требования, исковых требований к нескольким ответчикам, находящимся на территории разных государств.

Во всех названных случаях законодатель предоставляет возможность защиты нарушенных прав и охраняемых законом интересов в российском суде. Это обстоятельство не препятствует обращению с иском в иностранный суд по месту нахождения ответчика. Альтернатива всегда предпочтительнее запретов и ограничений, поэтому дополнительные правила подсудности являются очевидным шагом на пути развития гражданского процессуального законодательства.

Дополнительная (альтернативная) международная подсудность предоставляет заинтересованному лицу возможность обратиться за судебной защитой в суд по месту своего нахождения (жительства) или суд другого государства по своему выбору.

Консультации и комментарии юристов по ст 402 ГПК РФ

Если у вас остались вопросы по статье 402 ГПК РФ и вы хотите быть уверены в актуальности представленной информации, вы можете проконсультироваться у юристов нашего сайта.

Задать вопрос можно по телефону или на сайте. Первичные консультации проводятся бесплатно с 9:00 до 21:00 ежедневно по Московскому времени. Вопросы, полученные с 21:00 до 9:00, будут обработаны на следующий день.

Статья 402 ГПК РФ 2016-2021. Применение правил подсудности . ЮрИнспекция

Конвенцией о правах ребенка, принятой 44-й сессией Генеральной Ассамблеи ООН 20 ноября 1989 года (ратифицирована Постановлением Верховного Совета СССР от 13 июня 1990 года N 1559-I), провозглашено, что ребенку для полного и гармоничного развития его личности необходимо расти в семейном окружении, в атмосфере счастья, любви и понимания (абзац шестой преамбулы Конвенции). Правовой институт усыновления является одной из основных гарантий соблюдения этого важнейшего права ребенка в случае утраты им родительского попечения. Порядок рассмотрения дел об усыновлении (удочерении) ребенка, определен в главе 29 ГПК РФ. Согласно статье 269 ГПК РФ, заявление об усыновлении или удочерении (далее — усыновление) подается гражданами Российской Федерации, желающими усыновить ребенка, в районный суд по месту жительства или месту нахождения усыновляемого ребенка.Если лицами, желающими усыновить ребенка — гражданина Российской Федерации, являются граждане Российской Федерации, постоянно проживающие за пределами территории Российской Федерации, иностранные граждане или лица без гражданства, в том числе и в случаях, когда они постоянно проживают на территории Российской Федерации, то дела об усыновлении ими ребенка подсудны соответственно верховному суду республики, краевому, областному суду, суду города федерального значения, суду автономной области и суду автономного округа по месту жительства или месту нахождения усыновляемого ребенка (часть 2 статьи 269 ГПК РФ). Это же правило о подсудности применяется, если данные лица состоят в браке с гражданами Российской Федерации, с которыми постоянно проживают на территории Российской Федерации, и желают усыновить (удочерить) пасынка (падчерицу), являющегося гражданином Российской Федерации, либо желают совместно с мужем (женой) усыновить иного ребенка — гражданина Российской Федерации. Форма и содержание такого заявления должна отвечать как общим требованиям, предъявляемым статьей 131 ГПК РФ к исковому заявлению, так и требованиям статьи 270 ГПК РФ с приложением к заявлению необходимых документов, перечень которых содержится в статье 271 ГПК РФ. Заявление об усыновлении ребенка не подлежит оплате государственной пошлиной, так как в силу подпункта 14 пункта 1 статьи 333.36 части второй Налогового кодекса Российской Федерации усыновители освобождены от ее уплаты по делам данной категории.При рассмотрении заявления об усыновлении ребенка, поданного лицом, состоящим в браке, необходимо иметь в виду, что в соответствии с пунктом 1 статьи 133 СК РФ усыновление возможно только при наличии согласия супруга заявителя. Согласие другого супруга на усыновление должно быть выражено в письменной форме и приложено к заявлению об усыновлении (пункт 3 части 1 статьи 271 ГПК РФ). Однако следует иметь ввиду, что к заявлению иностранных граждан об усыновлении ребенка, являющегося гражданином Российской Федерации, прилагаются документы, указанные в части 1 статьи 271 ГПК РФ, а также заключение компетентного органа государства, гражданами которого являются усыновители (при усыновлении ребенка лицами без гражданства — государства, в котором эти лица имеют постоянное место жительства), об условиях их жизни и о возможности быть усыновителями, разрешение компетентного органа соответствующего государства на въезд усыновляемого ребенка в это государство и его постоянное жительство на территории этого государства. При этом, документы усыновителей — иностранных граждан подлежат легализации. После легализации они должны быть переведены на русский язык и перевод нотариально удостоверен. Для документов, исходящих от соответствующих органов государств — участников Гаагской конвенции от 5 октября 1961 г. (Бюллетень международных договоров. 1993. N 6), отменяющей требование легализации иностранных официальных документов, не требуется легализации, на них проставляется апостиль (Примечание: Канадой данной документ не ратифицирован).Таким образом, усыновление только вами ребенка РФ будет наименее проблематично по составу документов.

Глава 44 ГПК РФ статья: 402

 

скачать ГПК РФ бесплатно

Глава 44. Подсудность дел с участием иностранных лиц судам в Российской Федерации

Статья 402. Применение правил подсудности

1. В случае, если иное не установлено правилами настоящей главы, подсудность дел с участием иностранных лиц судам в Российской Федерации определяется по правилам главы 3 настоящего Кодекса.

2. Суды в Российской Федерации рассматривают дела с участием иностранных лиц, если организация-ответчик находится на территории Российской Федерации или гражданин-ответчик имеет место жительства в Российской Федерации.

3. Суды в Российской Федерации вправе также рассматривать дела с участием иностранных лиц в случае, если:

1) орган управления, филиал или представительство иностранного лица находится на территории Российской Федерации;

2) ответчик имеет имущество, находящееся на территории Российской Федерации;

3) по делу о взыскании алиментов и об установлении отцовства истец имеет место жительства в Российской Федерации;

4) по делу о возмещении вреда, причиненного увечьем, иным повреждением здоровья или смертью кормильца, вред причинен на территории Российской Федерации или истец имеет место жительства в Российской Федерации;

5) по делу о возмещении вреда, причиненного имуществу, действие или иное обстоятельство, послужившие основанием для предъявления требования о возмещении вреда, имело место на территории Российской Федерации;

6) иск вытекает из договора, по которому полное или частичное исполнение должно иметь место или имело место на территории Российской Федерации;

7) иск вытекает из неосновательного обогащения, имевшего место на территории Российской Федерации;

8) по делу о расторжении брака истец имеет место жительства в Российской Федерации или хотя бы один из супругов является российским гражданином;

9) по делу о защите чести, достоинства и деловой репутации истец имеет место жительства в Российской Федерации.

Статья 403. Исключительная подсудность дел с участием иностранных лиц

1. К исключительной подсудности судов в Российской Федерации относятся:

1) дела о праве на недвижимое имущество, находящееся на территории Российской Федерации;

2) дела по спорам, возникающим из договора перевозки, если перевозчики находятся на территории Российской Федерации;

3) дела о расторжении брака российских граждан с иностранными гражданами или лицами без гражданства, если оба супруга имеют место жительства в Российской Федерации;

4) дела, предусмотренные главами 23 — 26 настоящего Кодекса.

2. Суды в Российской Федерации рассматривают дела особого производства в случае, если:

1) заявитель по делу об установлении факта, имеющего юридическое значение, имеет место жительства в Российской Федерации или факт, который необходимо установить, имел или имеет место на территории Российской Федерации;

2) гражданин, в отношении которого подается заявление об усыновлении (удочерении), об ограничении дееспособности гражданина или о признании его недееспособным, об объявлении несовершеннолетнего полностью дееспособным (эмансипации), о принудительной госпитализации в психиатрический стационар, о продлении срока принудительной госпитализации гражданина, страдающего психическим расстройством, о принудительном психиатрическом освидетельствовании, является российским гражданином или имеет место жительства в Российской Федерации;

3) лицо, в отношении которого подается заявление о признании безвестно отсутствующим или об объявлении умершим, является российским гражданином либо имело последнее известное место жительства в Российской Федерации и при этом от разрешения данного вопроса зависит установление прав и обязанностей граждан, имеющих место жительства в Российской Федерации, организаций, имеющих место нахождения в Российской Федерации;

4) подано заявление о признании вещи, находящейся на территории Российской Федерации, бесхозяйной или о признании права муниципальной собственности на бесхозяйную недвижимую вещь, находящуюся на территории Российской Федерации;

5) подано заявление о признании недействительными утраченных ценной бумаги на предъявителя или ордерной ценной бумаги, выданных гражданином или гражданину, имеющим место жительства в Российской Федерации, либо организацией или организации, находящимся на территории Российской Федерации, и о восстановлении прав по ним (вызывное производство).

Статья 404. Договорная подсудность дел с участием иностранных лиц

1. По делу с участием иностранного лица стороны вправе договориться об изменении подсудности дела (пророгационное соглашение) до принятия его судом к своему производству.

2. Подсудность дел с участием иностранных лиц, установленная статьями 26, 27, 30 и 403 настоящего Кодекса, не может быть изменена по соглашению сторон.

Статья 405. Неизменность места рассмотрения дела

Дело, принятое судом в Российской Федерации к производству с соблюдением правил подсудности, разрешается им по существу, если даже в связи с изменением гражданства, места жительства или места нахождения сторон либо иными обстоятельствами оно стало подсудно суду другой страны.

Статья 406. Процессуальные последствия рассмотрения дел иностранным судом

1. Суд в Российской Федерации отказывает в принятии искового заявления к производству или прекращает производство по делу, если имеется решение суда по спору между теми же сторонами, о том же предмете и по тем же основаниям, принятое иностранным судом, с которым имеется международный договор Российской Федерации, предусматривающий взаимное признание и исполнение решений суда.

2. Суд в Российской Федерации возвращает исковое заявление или оставляет заявление без рассмотрения, если в иностранном суде, решение которого подлежит признанию или исполнению на территории Российской Федерации, ранее было возбуждено дело по спору между теми же сторонами, о том же предмете и по тем же основаниям.

Статья 407. Судебные поручения

1. Суды в Российской Федерации исполняют переданные им в порядке, установленном международным договором Российской Федерации или федеральным законом, поручения иностранных судов о совершении отдельных процессуальных действий (вручение извещений и других документов, получение объяснений сторон, показаний свидетелей, заключений экспертов, осмотр на месте и другие).

2. Поручение иностранного суда о совершении отдельных процессуальных действий не подлежит исполнению, если:

1) исполнение поручения может нанести ущерб суверенитету Российской Федерации или угрожает безопасности Российской Федерации;

2) исполнение поручения не входит в компетенцию суда.

3. Исполнение поручений иностранных судов производится в порядке, установленном российским правом, если иное не предусмотрено международным договором Российской Федерации.

4. Суды в Российской Федерации могут обращаться в иностранные суды с поручениями о совершении отдельных процессуальных действий. Порядок сношений судов в Российской Федерации с иностранными судами определяется международным договором Российской Федерации или федеральным законом.

Статья 408. Признание документов, выданных, составленных или удостоверенных компетентными органами иностранных государств

1. Документы, выданные, составленные или удостоверенные в соответствии с иностранным правом по установленной форме компетентными органами иностранных государств вне пределов Российской Федерации в отношении российских граждан или организаций либо иностранных лиц, принимаются судами в Российской Федерации при наличии легализации, если иное не предусмотрено международным договором Российской Федерации или федеральным законом.

2. Документы, составленные на иностранном языке, должны представляться в суды в Российской Федерации с надлежащим образом заверенным их переводом на русский язык.

Примечание:

О признании и исполнении решений иностранных судов и арбитражей см. также Указ Президиума ВС СССР от 21.06.1988 N 9131-XI.

 

РЧ-разъемы от RFMW, Ltd

РФ Индастриз

Больше информации

M-UHF, ВТУЛОЧНЫЙ ОБЖИМ, ТИПА AMP, N, G, D; ДЛЯ RG-58/U, CBL GRP C

Характеристики

  • Номер детали: RFU-600-1
  • Производитель: RF Industries
  • Статус: Стандартный
  • Тип разъема RF: Mini-UHF
  • Максимальная частота: 2.5
  • Импеданс: 50
  • Тип интерфейса: Штыревой
  • Ориентация: Прямой
  • Способ монтажа: Кабель
  • Тип разъема: Обжимной
  • Тип разъема: LMR-195; RG-58;141
  • Покрытие внешнего корпуса: никель
  • Покрытие внутреннего контакта: никель
70 В наличии

РФУ-600-1

M-UHF, ВТУЛОЧНЫЙ ОБЖИМ, ТИПА AMP, N, G, D; ДЛЯ RG-58/U, CBL GRP C

Поля, отмеченные *, обязательны для заполнения.

*Выберите рольPurchasingEngineeringFinanceManagement

Выберите функциюКонтракт с производителемДизайн-услугиОбразованиеЭкспортПравительствоКомплектацияТехническое обслуживание РемонтПредставитель производителяOEMИсследованияТорговый посредникСистемный интеграторЛичное использованиеКонечный пользователь

* Выберите государство или ProvinceAlabamaAlaskaAmerican SamoaArizonaArkansasCaliforniaColoradoConnecticutDelawareDistrict из ColumbiaFederated государств MicronesiaFloridaGeorgiaGuamHawaiiIdahoIllinoisIndianaIowaKansasKentuckyLouisianaMaineMarshall IslandsMarylandMassachusettsMichiganMilitary AAMilitary AEMilitary APMinnesotaMississippiMissouriMontanaNebraskaNevadaNew HampshireNew JerseyNew MexicoNew YorkNorth CarolinaNorth DakotaNorthern Марина IslandsOhioOklahomaOregonPalauPennsylvaniaRhode IslandSouth CarolinaSouth DakotaTennesseeTexasUtahVermontVirgin IslandsVirginiaWashingtonWest VirginiaWisconsinWyoming

* Выберите Ваш CountryAfghanistanAland IslandsAlbaniaAlgeriaAmerican SamoaAndorraAngolaAnguillaAntarticaAntigua и BarbudaArgentinaArmeniaArubaAustraliaAustriaAzerbaijanBahamasBahrainBangladeshBarbadosBelarusBelgiumBelizeBeninBermudaBhutanBoliviaBosnia-herzegovinaBotswanaBrazilBruneiBulgariaBurkina FasoBurma (Мьянма) BurundiCambodia (Кампучия) CameroonCanadaCape VerdeCayman IslandsCentral африканского RepublicChadChannel остров (U. К.) ChileChinaColombiaComorosCongoCongo (Демократическая Республика) Острова Кука (Новая Зеландия) Коста RicaCroatiaCubaCuracaoCyprusCzech RepublicDenmarkDjiboutiDominicaDominican RepublicEcuadorEgyptEl SalvadorEquatorial GuineaEritreaEstoniaEthiopiaFalkland IslandsFijiFinlandFranceFrench GuianaFrench Полинезия (Таити) GabonGambiaGeorgiaGermanyGhanaGibraltarGreeceGreenlandGrenadaGuadeloupeGuamGuatemalaGuineaGuinea-BissauGuyanaHaitiHolland (Нидерланды) HondurasHong KongHungaryIcelandIndiaIndonesiaIranIraqIrelandIsraelItalyIvory побережье (Cote D»Iv.) JamaicaJapanJordanKazakhstanKenyaKiribatiKorea (Северная) Корея, Республика ofKuwaitKyrgyzstanLaosLatviaLebanonLesothoLiberiaLibyaLiechtensteinLithuaniaLuxembourgMacauMacedoniaMadagascarMalawiMalaysiaMaldivesMaliMaltaMarshall IslandsMartiniqueMauritaniaMauritiusMexicoMicronesia, Федеративные StatesMoldovaMonacoMongoliaMontenegroMontserratMoroccoMozambiqueMyanmar (Бирма) NamibiaNauruNepalNetherlandsNetherlands AntillesNew CaledoniaNew ZealandNicaraguaNigerNigeriaNorthern Mariana IslandsNorwayOmanPakistanPalau (Микронезия) PanamaPapua Новый GuineaParaguayPeruPhilippinesPolandPortugalPuerto RicoQatarReunionRomaniaRussian FederationRwandaSaint Киттс и NevisSaint LuciaSaint Pierre & MiquelonSaint Винсент / GrenadinesSamoaSan MarinoSao Tome & PrincipeSaudi ArabiaSenegalSerbiaSeychellesSierra LeoneSingaporeSint MaartenSlovakiaSloveniaSolomon IslandsSomaliaSouth AfricaSpainSri LankaSudanSurinameSwazilandSwedenSwitzerlandSyriaTahiti (Французская Полинезия)ТайваньТаджикистанТанзанияТаиландТимор-ЛештиTinianTogoTong aТринидад и ТобагоТунисТурцияТуркменистанОстрова Теркс и КайкосТувалуУгандаУкраинаОбъединенные Арабские ЭмиратыВеликобританияУругвайСШААУзбекистанВануатуВатиканВенесуэлаВьетнамВиргинские острова, Британские Виргинские острова, СШАОстрова Уоллис и ФутунаЙеменЮгославияЗамбияЗимбабве

Мини-УВЧ 2. 5 50 Мужской Прямой Кабель Обжим ЛМР-195; РГ-58;141 Никель Никель

Радиал

Больше информации

SMA / КАБЕЛЬ С ПРЯМОУГЛОВЫМ РАЗЪЕМОМ, ОБЖИМНЫМ ИЛИ ПРИПАЯНЫМ 5/50 D

Характеристики

  • Номер детали: R125176000
  • Производитель: Radiall USA, Inc./ AEP
  • Статус: Standard
  • Rf Разъем Тип разъема: SMA
  • Max Частота: 12.4
  • Impedance: 50
  • Тип интерфейса: Мужской
  • Ориентация: Прямой Угол
  • Стиль монтажа: кабель
  • Стиль терминации: Crimp
  • Тип разъема: RG-55;142;223;400
  • Покрытие внешнего корпуса:ЗОЛОТО 0,5 НА НИКЕЛЬ 2
  • Внутреннее контактное покрытие:ЗОЛОТО 0,5 НА НИКЕЛЬ 2
60 В наличии Отправить запрос котировки СМА 12. 4 50 Мужской Прямой угол Кабель Обжим РГ-55;142;223;400 ЗОЛОТО 0,5 НА НИКЕЛЬ 2 ЗОЛОТО 0,5 НА НИКЕЛЬ 2

Радиал

Больше информации

Характеристики

  • Номер детали: R125052002
  • Производитель: Radiall USA, Inc./ AEP
  • Статус: Standard
  • Rf Разъем Тип разъема: SMA
  • Max Частота: 18
  • Импеданс: 50
  • Тип интерфейса: Мужской
  • Ориентация: Прямой
  • Стиль монтажа: кабель
  • Стиль терминации: Prayer
  • Тип заделки: .085 полужесткий; RG-405
  • Внешнее покрытие корпуса: ЗОЛОТО 0,5 НА НИКЕЛЕ 2
  • Внутреннее контактное покрытие: ЗОЛОТО 1,3 НА НИКЕЛЕ 2
1370 В наличии Отправить запрос котировки СМА 18 50 Мужской Прямой Кабель Припой . 085 полужесткий; РГ-405 ЗОЛОТО 0,5 НА НИКЕЛЬ 2 ЗОЛОТО 1,3 НА НИКЕЛЕ 2

Радиал

Больше информации

SMA / ПРЯМОЙ ОБЖИМНЫЙ КАБЕЛЬ 5/50 D

Характеристики

  • Номер детали: R125076000
  • Производитель: Radiall USA, Inc./ AEP
  • Статус: Standard
  • Rf Разъем Тип разъема: SMA
  • Max Частота: 12.4
  • Impedance: 50
  • Тип интерфейса: Мужской
  • Ориентация: прямой
  • Стиль монтажа: кабель
  • Стиль терминации: Crimp
  • Тип разъема:RG-55;142;223;400
  • Внешнее покрытие корпуса:ЗОЛОТО 0,5 НА НИКЕЛЕ 2
  • Внутреннее контактное покрытие:ЗОЛОТО 1,3 НА НИКЕЛЕ 2
35 В наличии Отправить запрос котировки СМА 12.4 50 Мужской Прямой Кабель Обжим РГ-55;142;223;400 ЗОЛОТО 0,5 НА НИКЕЛЬ 2 ЗОЛОТО 1,3 НА НИКЕЛЕ 2

Радиал

Больше информации

TNC / ПРЯМОЙ РАЗЪЕМ ЗАЖИМА КАБЕЛЬ 10+11/50

Характеристики

  • Номер детали: R143018000
  • Производитель: Radiall USA, Inc. / AEP
  • Статус: Standard
  • Rf Разъем Тип разъема: TNC
  • Максимальная частота: 11
  • Impedance: 50
  • Тип интерфейса: Мужской
  • Ориентация: Прямая
  • Стиль монтажа: кабель
  • Стиль терминации: Crimp
  • Покрытие внешнего корпуса: НИКЕЛЬ 2
  • Внутреннее покрытие контактов: ЗОЛОТО 0,5 ПОВЕРХ НИКЕЛЬ 2
37 В наличии Отправить запрос котировки ТНК 11 50 Мужской Прямой Кабель Обжим НИКЕЛЬ 2 ЗОЛОТО 0.5 НАД НИКЕЛЕМ 2

РФ Индастриз

Больше информации

SMA, ВТУЛКА R/A CRIMP, N,G,T; ДЛЯ RG-316 DBL SHIELD, CBL GRP B1

Характеристики

  • Номер детали:RSA-3010-B1
  • Производитель:RF Industries
  • Статус:Стандартный
  • Тип разъема RF:SMA
  • Максимальная частота:12. 4
  • Импеданс: 50
  • Тип интерфейса: Штыревой
  • Ориентация: Прямоугольный
  • Способ монтажа: Кабель
  • Тип разъема: Обжимной
  • Тип разъема: RG-188; 316 Двойное экранирование
  • Покрытие внешнего корпуса: никель
  • Покрытие внутреннего контакта: золото
45 В наличии СМА 12.4 50 Мужской Прямой угол Кабель Обжим РГ-188; 316 Двойное экранирование Никель Золото

Розенбергер

Больше информации
1000 2 доллара.97
2500 2,81 $
5000+ 2,68 $

SMP, угловая вилка для печатной платы

Характеристики

  • Номер детали: 19S242-40ML5
  • Производитель: Rosenberger
  • Статус: Стандартный
  • Тип разъема RF: SMP
  • Максимальная частота: 26. 5
  • Импеданс: 50
  • Тип интерфейса: Мужской
  • Ориентация: Прямой Угол
  • Стиль монтажа: PCB
  • Стиль терминации: PACB
  • Стиль терминации: Praver
  • Тип терминации: Поверхностное покрытие PCB
  • Наружное покрытие для тела: золото
  • Внутреннее контактное покрытие :Золото
  • Реверсивная полярность/резьба/фиксатор: Гладкое отверстие
1612 В наличии
1000 2 доллара.97
2500 2,81 $
5000+ 2,68 $
СМП 26,5 50 Мужской Прямой угол Печатная плата Припой Печатная плата для поверхностного монтажа Золото Золото Гладкоствольный

Дельта

Больше информации

ВЧ-разъем, 2. 4 мм ПАНЕЛЬНЫЙ ДОМКРАТ ДЛЯ ЗАМЕНЫ В ПОЛЕВЫХ УСЛОВИЯХ ДЛЯ ШТИФТА .009

Характеристики

  • Номер детали: 8096000K911-009
  • Производитель: Delta Electronics MFG. Corp
  • Статус: Non Standard
  • RF Тип разъема: 2.4 мм
  • Максимальная частота: 50
  • Импеданс: 50
  • Тип интерфейса: Женский
  • Ориентация: Прямой
  • Тип монтажа: Фланец с 2 отверстиями.550
  • Тип разъема: Беспаечный
  • Тип разъема: Гнездо для замены в полевых условиях .009
  • Покрытие внешнего корпуса: Пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: Золото
196 В наличии Отправить запрос котировки 2.4 мм 50 50 Женщина Прямой Фланец с 2 отверстиями .550 Без припоя Гнездо для замены в полевых условиях . 009 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Розетка SMA, ул.Внутренняя резьба, 2 отверстия Фланец FR .015 диам. штифт

Характеристики

  • Номер детали: 1206-121-PJ
  • Производитель: San-tron
  • Статус: Нестандартный
51 В наличии

Карлайл

Больше информации

Разъем RF, SMP (M) FULL DETENT STR PCB SURF MNT

Характеристики

  • Номер детали: P797-10615-3CC
  • Производитель: Carlisle Interconnect Technologies
  • Статус: Нестандартный
6 В наличии Отправить запрос котировки

Радиал

Больше информации

СМПМ М СБ СТР

Характеристики

  • Номер детали: R201508700W
  • Производитель: Radiall USA, Inc. /AEP
  • Статус: нестандартный
195 В наличии Отправить запрос котировки

Сан-трон

Больше информации

Характеристики

  • Номер детали:1901-24-AS
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

Характеристики

  • Номер детали: 1206-19-PJ
  • Производитель: San-tron
  • Статус: Стандарт
75 В наличии

Сан-трон

Больше информации

4. 3-10 гнездо обжимное

Характеристики

  • Номер детали:4103-11-AS
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

4.Обжимной штекер 3-10

Характеристики

  • Номер детали:4101-11-AS
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

S292 Панель Rep 2H . 550 ФЛ ФР.012

Характеристики

  • Номер детали: 2906-10-PJ
  • Производитель: San-tron
  • Статус: Стандарт
100 В наличии

Сан-трон

Больше информации

S292 Штекерный припой для .047 СР

Характеристики

  • Номер детали: 2901-61-DJP
  • Производитель: San-tron
  • Статус: Стандарт
100 В наличии Отправить запрос котировки

Сан-трон

Больше информации

S292 Панель Rep 2H . 500 ФЛ ФР.012

Характеристики

  • Номер детали: 2906-07-PJ
  • Производитель: San-tron
  • Статус: Стандарт
96 В наличии

Сан-трон

Больше информации

S292 Штекерный припой для .086 СР

Характеристики

  • Номер детали: 2901-86-DJP
  • Производитель: San-tron
  • Статус: Стандарт
100 В наличии

Сан-трон

Больше информации

S292 Штекерный припой для . 141 СР

Характеристики

  • Номер детали: 2901-141-DJP
  • Производитель: San-tron
  • Статус: Стандарт
100 В наличии

Сан-трон

Больше информации

S292 Штекер под пайку для HP-190

Характеристики

  • Номер детали: 2901-113-PJ
  • Производитель: San-tron
  • Статус: Стандарт
100 В наличии

Сан-трон

Больше информации

7/16 Штекерный зажим для LMR-600

Характеристики

  • Номер детали:1901-06-AS
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

7/16 Штекерный зажим для LMR-400

Характеристики

  • Номер детали:1901-05
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

Панель SMA Rep . 500 x 0,375 FL FR 0,015

Характеристики

  • Номер детали: 1206-86-PJ
  • Производитель: San-tron
  • Статус: Стандарт
2000 В наличии

Сан-трон

Больше информации

Панель SMA Rep .375 ФЛ ФР .020

Характеристики

  • Номер детали:1206-83-M1-PJ
  • Производитель:San-tron
  • Статус:Стандарт
98 В наличии Отправить запрос котировки

Сан-трон

Больше информации

Панель SMA Rep 2H . 550 ФЛ ФР .015

Характеристики

  • Номер детали: 1206-70-PJ
  • Производитель: San-tron
  • Статус: Стандарт
100 В наличии

Сан-трон

Больше информации

Панель SMA Rep .500 ФЛ ФР .012

Характеристики

  • Номер детали:1206-62-PJ
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

Панель SMA Rep . 375 ФЛ ФР .015

Характеристики

  • Номер детали:1206-65 M1-PJ
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H .550 ФЛ ФР .020

Характеристики

  • Номер детали:1206-54-PJ
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H . 480 ФЛ ФР .012

Характеристики

  • Номер детали: 1206-60-PJ
  • Производитель: San-tron
  • Статус: Стандарт
90 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H .550 FL FR .012 с прокладкой EMI

Характеристики

  • Номер детали:1206-53-PJ
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H . 550 ФЛ ФР .012

Характеристики

  • Номер детали:1206-52-PJ
  • Производитель:San-tron
  • Статус:Стандарт
40 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H .625 FL FR .015 с прокладкой EMI

Характеристики

  • Номер детали: 1206-50-PJ
  • Производитель: San-tron
  • Статус: Стандарт
90 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H . 625 FL FR .015 с прокладкой EMI

Характеристики

  • Номер детали:1206-50 M1-PJ
  • Производитель:San-tron
  • Статус:Стандарт
2000 В наличии

Сан-трон

Больше информации

Панель SMA Rep .500 ФЛ ФР .020

Характеристики

  • Номер детали:1206-57-PJ
  • Производитель:San-tron
  • Статус:Стандарт
100 В наличии Отправить запрос котировки

Сан-трон

Больше информации

Панель SMA Rep 2H . 480 ФЛ ФР .015

Характеристики

  • Номер детали: 1206-41-PJ
  • Производитель: San-tron
  • Статус: Стандарт
100 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H .625 ФЛ ФР .012

Характеристики

  • Номер детали:1206-36-PJ
  • Производитель:San-tron
  • Статус:Стандарт
841 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H . 550 FL ФР .020 SW

Характеристики

  • Номер детали: 1206-209-M20-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Заменяемый в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 2 отверстиями .550
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .020
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 2 отверстиями.550 Припой Вывод под пайку .020 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep 2H . 625 ФЛ ФР .020

Характеристики

  • Номер детали:1206-46-PJ
  • Производитель:San-tron
  • Статус:Стандарт
74 В наличии

Сан-трон

Больше информации

Панель SMA Rep 2H .550 FL ФР .015 SW

Характеристики

  • Номер детали: 1206-209-M15-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Сменный в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 2 отверстиями .550
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .015
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 2 отверстиями. 550 Припой Вывод под пайку .015 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep 2H .550 FL ФР .012 SW

Характеристики

  • Номер детали: 1206-209-M12-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Сменный в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 2 отверстиями .550
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .012
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 2 отверстиями. 550 Припой Вывод под пайку .012 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep 2H .625 ФЛ ФР .020 SW

Характеристики

  • Номер детали: 1206-208-M20-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Сменный
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 2 отверстиями .625
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .020
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 2 отверстиями. 625 Припой Вывод под пайку .020 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep 2H .625 ФЛ ФР .015 SW

Характеристики

  • Номер детали: 1206-208-M15-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Заменяемый в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 2 отверстиями .625
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .015
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 2 отверстиями. 625 Припой Вывод под пайку .015 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep 2H .625 ФЛ ФР .012 SW

Характеристики

  • Номер детали: 1206-208-M12-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Сменный в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 2 отверстиями .625
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .012
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
50 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 2 отверстиями. 625 Припой Вывод под пайку .012 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep .500 FL ФР .020 SW

Характеристики

  • Артикул:1206-206-M20-PJ
  • Производитель:San-tron
  • Статус:Стандартный
  • Тип разъема RF:SMA Заменяемый в полевых условиях
  • Максимальная частота:27
  • Импеданс:50
  • 7
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 4 отверстиями .500
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .020
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 4 отверстиями. 500 Припой Вывод под пайку .020 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep .500 FL ФР .015 SW

Характеристики

  • Номер детали: 1206-206-M15-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Заменяемый в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 4 отверстиями .500
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .015
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 4 отверстиями. 500 Припой Вывод под пайку .015 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep .500 FL ФР .012 SW

Характеристики

  • Артикул:1206-206-M12-PJ
  • Производитель:San-tron
  • Статус:Стандартный
  • Тип разъема RF:SMA Сменный
  • Максимальная частота:27
  • Импеданс:50
  • 7
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 4 отверстиями .500
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .012
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 4 отверстиями. 500 Припой Вывод под пайку .012 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep .375 ФЛ ФР .020 SW

Характеристики

  • Номер детали: 1206-205-M20-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Сменный в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 4 отверстиями .375
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .020
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
100 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 4 отверстиями. 375 Припой Вывод под пайку .020 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep .375 ФЛ ФР .015 SW

Характеристики

  • Номер детали: 1206-205-M15-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Заменяемый в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 4 отверстиями .375
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .015
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
98 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 4 отверстиями. 375 Припой Вывод под пайку .015 Пассивированная нержавеющая сталь Золото

Сан-трон

Больше информации

Панель SMA Rep .375 ФЛ ФР .012 SW

Характеристики

  • Номер детали: 1206-205-M12-PJ
  • Производитель: San-tron
  • Статус: Стандартный
  • Тип разъема RF: SMA Сменный в полевых условиях
  • Максимальная частота: 27
  • Тип интерфейса: 50
  • le
  • Ориентация: Прямая
  • Способ монтажа: Фланец с 4 отверстиями .375
  • Тип разъема: под пайку
  • Тип разъема: вывод под пайку .012
  • Покрытие внешнего корпуса: пассивированная нержавеющая сталь
  • Покрытие внутреннего контакта: золото
98 В наличии SMA Заменяемый в полевых условиях 27 50 Женщина Прямой Фланец с 4 отверстиями. 375 Припой Вывод под пайку .012 Пассивированная нержавеющая сталь Золото

Корпорация Madell Technology

GTL-101
BNC-ALLIGATOR
Для: ГОС-310
GVT-427B/417B,
  GFC-8010H/8131H/8270H,
  GFG-серия

GTL-103
BANANA-ALLGATOR
Для: GAG-809/810,
ГОС-305,
ГАД-201Г,
ГВФ-202
Цена: 10 долларов.00
Цена: $10.00

GTL-104
 Для: GPR, GPS, GPC, PPE,
 PPS, PPT, PSS, PSP
 (текущий 4A-10A)

GTL-105
Для: GPR, GPS, GPC, PPE,
  PPS, PPT, PSS, PST
  (текущий 3A)
Цена: 15 долларов. 00
Цена: $10.00

GTL-107A
 Для:GDM-8034/8135/8145
GTL-108A
 Для: GOM-801G/802
Цена: $10,00
Цена: 75 долларов.00

GTL-110
  Для: GFC-8131H/8270H,
ГРГ-450Б, ГСГ-120/122,
СФГ-830
GTL-114A
 Для:GDM-351A/352A,
ГДМ-354/391А/393А/450А
Цена: $15,00
Цена: 10 долларов. 00

GTL-117
 Для:GDM-8245/8246

GTL-203/204 
(только для Европы)
  Для: GPR, GPS, GPC,
  PPS, PPT, SPS, PSP
(GTL-203, ток 3A)
(GTL-204, ток 4A~10A)
Цена: 10 долларов.00
Цена: $15,00

GCP-210LC   
  Для :
ГОС-620/620ФГ/622Г/635Г

LF-210E
  Для: GOS-6103/6103C/6112
  10:1  DC-100 МГц
1:1 DC-6MHz

Цена: 24 доллара. 00
Цена: $30.00
GLF-190C  
  Для : GOS-652G/653G/658G
Новая серия GOS-6000
  GRS-6000 Series
  10:1 DC-60MHz
  1:1 DC-6MHz
GLF-250
Для: GOS-6200
10:1 DC~250MHz
1:1 DC~6MHz
Цена: $27,00
Цена: $88,00

GTP-150A
 
Для: GDS-820/820S/820C
  10:1 Постоянный ток ~ 150 МГц
  1:1 Постоянный ток ~ 6 МГц

Цена: 40 долларов. 00

GTP-250A
 
Для: GDS-840S/840C
  10:1 Постоянный ток~250 МГц
  1:1  Постоянный ток~6 МГц
Цена: $35,00
Цена: $55.00

КТП- 01  
Опция для:GDM-393A
Датчик температуры (тип K)
Макс.200°C
Точность: ±0,04%
КТП- 02
Опция для:GDM-393A
Датчик температуры (тип K)
Макс. 500°C
Точность: ±0,75%
Цена: $
Цена:
$

КПТ- 03
Опция для:GDM-393A
Датчик температуры (тип K)
Макс. 800°C
Точность: ±0,75%
ПТ- 100
Опция Для: GOM-802
Датчик температуры
Макс. 800°C
Точность: ±0,75%
Цена: $
Цена:
$

GHT-105
  Для: GPI-625
  GPT/GPI-700 Series
GHT-106R
 Для:GPI-625
Цена: $
GHT-105A
  Для: серии GPT/GPI-700A
  GPT/GPI-800 Серия
Цена: 115 долларов. 00
Цена:
$

GHT-107A
  Для: серии GPT/GPI-745A
Цена: $
Цена:
$

GTL- 032
Кабель типа N
Для:GSP-810/827
GTL- 301
Кабель типа N
Для:GSP-810/827
Цена: $
Цена:
$

GTL- 302
Кабель RS-232
Для: серии GDS-800
Серия GRS, серия LCR-800
GTL- 303
ВЧ-кабель, 600 мм RD316 с двумя SMA(P) Соединители
  Для: GSP-827
Цена: $
Цена:
$

GTL- 401
Шнур питания постоянного тока с разъемом постоянного тока и вилкой прикуривателя, ток 5 А
  Для: GSP-827
ADP-001
  Переходник N(P) на BNC
Для:GSP-810/827
Цена: $
Цена:
$

ADP-002
  Переходник SMA(J) на N(P)
Для:GSP-827
ADP-102
Адаптер от 50 до 75 Ом
Для:GSP-827
Цена: $
Цена:
$

GAK-001
  Заделка 50 Ом N(P)
Для:GSP-827
GAK-002
Крышка с цепочкой N(P)
Для:GSP-827
Цена: $
Цена:
$

ATN-100
Аттенюатор 10 дБ или N(J) на BNC(J)
Для:GSP-827
ATA-001
Антенна BNC
Для: GSP-810/827
Цена: $
Цена:
$

ГРА-401 
СТОЙКА ПАНЕЛЬ ПЕРЕХОДНИКА

или: PPE/PPS/PPT/PEL/GPC/GPR-M-H Series
Монтаж в стойку 19″, 4U

 

 

ГРА-402
СТОЙКА ПАНЕЛЬ ПЕРЕХОДНИКА

 Для:LCR-800 Series/GPT/GPI-700A Series
Монтаж в стойку 19″, 4U

  

Цена: 150 долларов. 00
Цена: $175,0

ГРА-403
СТОЙКА ПАНЕЛЬ ПЕРЕХОДНИКА

  Для: серии PSH
для монтажа в стойку 19″, 4U

 

ГРА-405
СТОЙКА ПАНЕЛЬ ПЕРЕХОДНИКА

 Для: GDS-820/840 Серия
для монтажа в стойку 19″, 4U

Цена: 185 долларов.00
Цена: $250.00

CSC-001
Мягкий футляр для переноски
Для: GSP-827

Мягкий футляр для переноски
Для: GDS-820/840
Цена: $
Цена:
$

GTC-001
Тележка для измерительных приборов
(нагрузка на полку 30 кг)
Входная розетка 120 В
450 (Ш) x 430 (Г) мм
GTC-002
Тележка для измерительных приборов
(нагрузка на полку 30 кг)
Входная розетка 120 В
330 (Ш) x 430 (Г) мм
Цена: $
Цена:
$

ХК-31 КОБУРА  
  Для:GDM-351A/352A
ХК-32 КОБУРА
Для:
GDM-354A/391A/393A/450A
Цена: $
Цена:
$

LCR-05
Для :LCR-816/817/819
LCR-821/826/827/829
LCR-06A
Для :LCR-816/817/819
LCR-821/826/827/829
Цена: 210 долларов. 00
Цена: $104,00

LCR-07
Для :LCR-816/817/819
LCR-821/826/827/829
LCR-08
Для :LCR-816/817/819
LCR-821/826/827/829
Цена: 105 долларов.00
Цена: $262,00

LCR-09
Для :LCR-816/817/819
LCR-821/826/827/829
Цена: $262,00

28520353

%PDF-1. 4 % 1 0 объект > эндообъект 4 0 объект >поток 2022-03-07T19:39:05-08:002019-04-07T01:17:47-07:002022-03-07T19:39:05-08:00Заявитель ПриложениеPDF Pro 5.5uuid:82ff648f-ab36-11b2-0a00- 782dad000000uuid:8c6848a9-1dd2-11b2-0a00-bf00b894fbffapplication/pdf

  • 28520353
  • Администратор
  • Acrobat Distiller 8.1.0 (Windows)AppendPDF Pro 5.5 Linux Kernel 2.6 64bit 2 октября 2014 г. Библиотека 10.1.0 конечный поток эндообъект 2 0 объект > эндообъект 3 0 объект > эндообъект 5 0 объект > эндообъект 6 0 объект > эндообъект 7 0 объект > эндообъект 8 0 объект > эндообъект 25 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Повернуть на 90/Тип/Страница>> эндообъект 26 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Повернуть на 90/Тип/Страница>> эндообъект 27 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Повернуть на 90/Тип/Страница>> эндообъект 28 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Type/Page>> эндообъект 29 0 объект >/ExtGState>/Font>/ProcSet[/PDF/Text]>>/Type/Page>> эндообъект 30 0 объект >/ProcSet[/PDF/Text/ImageC]/XObject>>>/Type/Page>> эндообъект 31 0 объект >/ProcSet[/PDF/Text/ImageC]/XObject>>>/Type/Page>> эндообъект 32 0 объект >/ProcSet[/PDF/Text/ImageC]/XObject>>>/Type/Page>> эндообъект 174 0 объект [176 0 Р 177 0 Р] эндообъект 175 0 объект >поток д 1276 0 0 721 0 0 см /Im0 Делать Вопрос БТ /T1_0 1 тс 8 0 0 8 375. 12793 763,99994 тм (.)Tj 0 0 1 рг -17,50398 0 тд (CC-BY-NC-ND 4.0 Международная лицензия)Tj 0 г -0,556 0 Тд (а)Tj -22.20596 1 тд (подтверждено рецензированием\) является автором/спонсором, предоставившим bioRxiv\ лицензия на бессрочное отображение препринта. Он доступен u\ nder )Tj 38,

    1,00001 тд (Правообладатель этого препринта\(которого не было)Tj -14,78499 0 тд (эта версия опубликована 7 апреля 2019 г.) Tj -0,556 0 Тд (; )Tj 0 0 1 рг -13,56499 0 тд (https://doi.org/10.1101/601773) Tj 0 г -1.89 0 тд (дои: )Tj -7,22398 0 тд (препринт bioRxiv) Tj ET конечный поток эндообъект 79 0 объект >поток

    Справочник по командам контроллера беспроводной сети Cisco Catalyst серии 9800, Cisco IOS XE Gibraltar 16.10.x — Показать команды [Контроллеры беспроводной сети Cisco Catalyst серии 9800]

    Примеры

    Ниже приведен пример вывода команды show wireless country channels:

      Номер устройства   Показать беспроводные каналы страны  
      Настроенная страна. .................................: США - Соединенные Штаты
          КЛЮЧ: * = Канал разрешен в этой стране и может быть настроен вручную.
               A = Канал является значением Auto-RF по умолчанию в этой стране.
               . = Канал незаконен в этой стране.
               C = Канал настроен для использования Auto-RF.
               x = Канал доступен для настройки для использования Auto-RF.
             (-,-) = (внутри, снаружи) нормативный домен, разрешенный в этой стране.
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-
        802.11бг :
        Каналы: 1 1 1 1 1
                     : 1 2 3 4 5 6 7 8 9 0 1 2 3 4
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-
     (-A,-AB) США: A * * * * A * * * * A. . .
     Авто-РФ: . . . . . . . . . . . . . .
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+- +-+-+-+-+-+-+-+-+-+-+-+-
     802.11a: 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
     Каналы: 3 3 3 4 4 4 4 4 5 5 6 6 0 0 0 1 1 2 2 2 3 3 4 4 5 5 6 6
                     : 4 6 8 0 2 4 6 8 2 6 0 4 0 4 8 2 6 0 4 8 2 6 0 9 3 7 1 5
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+- +-+-+-+-+-+-+-+-+-+-+-+-
     (-A,-AB) США: . А . А . А . А А А А А * * * * * . . . * * * А А А А *
     Авто-РФ: . . . . . . . . . . . . . . . . . . . . . . . . . . . .
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+- +-+-+-+-+-+-+-+-+-+-
     4,9 ГГц 802.11а:
       Каналы: 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2
                     : 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+- +-+-+-+-+-+-+-+-+-+-
     США (-A,-AB): * * * * * * * * * * * * * * * * * * * * A * * * * * A
     Авто-РФ: .. . . . . . . . . . . . . . . . . . . . . . . . .
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+- +-+-+-+-+-+-+-+-+-+-
    
                                                       
                                                         

    Ниже приведен пример вывода команды show wireless country configure:

      Номер устройства   показать страну, настроенную для беспроводной сети  
     Настроенная страна. .................................: США - Соединенные Штаты
     Настроенные коды стран
            США — Соединенные Штаты: 802.11a в помещении, вне помещения/802.11b/802.11g
      

    Ниже приведен пример вывода команды tx-power show Wireless Country Supported:

      Номер устройства   Показать поддерживаемую беспроводную сеть страны, мощность передачи  
          КЛЮЧ: ## = мощность передачи в дБм.
               ##* = Канал поддерживает обнаружение радаров.. = Канал незаконен в этой стране.
               (-) = Регуляторные домены разрешены в этой стране.
               (-,-) = (внутренние, наружные) нормативные домены, разрешенные в этой стране.
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-
        802.11бг:
        Каналы: 1 1 1 1 1
                     : 1 2 3 4 5 6 7 8 9 0 1 2 3 4
    ------------------:+-+-+-+-+-+-+-+-+-+-+-+-+-+-
     (-CE ,-CE ) АЕ : 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) АЛ: 20 20 20 20 20 20 20 20 20 20 20 20 20 . (-А,-АР) АР: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е,-Е) В: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-А,-НА) АЕ: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е,-) БА: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) БЭ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) БГ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-) ЧД: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-А,-А) БО: 27 27 27 27 27 27 27 27 27 27 27 .. .
     (-А,-АР) БР: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е,-) ПО: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-А,-АБН) КА: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-А,-АБН) СА2: 27 27 27 27 27 27 27 27 27 27 27 . . .
     (-Е,-Е) СН: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-AER,-AR) CL: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) СМ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-CE ,-CE ) CN : 20 20 20 20 20 20 20 20 20 20 20 20 20 .(-А,-АР) СО: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-A,-AB) CR: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-E,-E) CY: 20 20 20 20 20 20 20 20 20 20 20 20 20 . 
     (-Е,-Е) ЧР: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ДЭ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) НЗ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-A,-ABN) ДЕЛАТЬ: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е,-) ДЗ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .(-А,-АВ) ЕС: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е,-Е) ЕЕ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) Например: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,-E) ES: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ФИ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ФР: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,-E) ГБ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ГИ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .(-Е ,-Е ) ГР : 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-A,-NA) Гонконг: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-E,-) ЧСС: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E ,-E ) HU : 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,-ER) ID: 20 20 20 20 20 20 20 20 20 20 20 20 20.
     (-E ,-E ) IE : 20 20 20 20 20 20 20 20 20 20 20 20 20 . 
     (-EI,-IE) IL: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-I ,-I ) МОТ : . . . . 20 20 20 20 20 20 20 20 20 .(-А,-АН) В: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Э,-Э) IQ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ЕСТЬ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ИТ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-JPU,-JPU) J2: 23 23 23 23 23 23 23 23 23 23 23 23 23 23
     (-JPU,-JPU) J3: 23 23 23 23 23 23 23 23 23 23 23 23 23 23
     (-JPQU,-PQ ) J4 : 23 23 23 23 23 23 23 23 23 23 23 23 23 23
     (-Э,-) ДЖО: 20 20 20 20 20 20 20 20 20 20 20 20 20 .(-JPU,-JPU) JP: 23 23 23 23 23 23 23 23 23 23 23 23 23 23
     (-ACE ,-ACEK) КЭ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) КН: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-ACE ,-ACEK) КР : 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,-E) кВт: 20 20 20 20 20 20 20 20 20 20 20 20 20.
     (-Е,-Е) КЗ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,-E) LB: 20 ​​20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е ,-Е ) ЛИ : 20 20 20 20 20 20 20 20 20 20 20 20 20 . (-Е,)ЛК: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) LT: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ЛУ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ЛЖ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) МС: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) МЭ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) МК: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,) МО: 20 20 20 20 20 20 20 20 20 20 20 20 20 .(-Е,-Е) МТ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-A,-NA) MX: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-ACE,-AEC) МЫ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) НЛ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) НЕТ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-А,-НА) НЗ: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е,-Е) ОМ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-А,-АР) ПА: 27 27 27 27 27 27 27 27 27 27 27.. .
     (-A,-AR) PE: 27 27 27 27 27 27 27 27 27 27 27 . . .
     (-А,-АБН) РН: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-А,-АБН) Ф3: 27 27 27 27 27 27 27 27 27 27 27 .  . .
     (-Е,-Е) ПК: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ПЛ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-А,-А) ПР: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е,-Е) ПТ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-А,-А) ПЯ: 27 27 27 27 27 27 27 27 27 27 27 .. .
     (-E ,-E ) КА : 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ТЧ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,-E) RS: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-AER,-ER) RU: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-AE,-AE) SA: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,-E) SE: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E ,-SE ) SG : 20 20 20 20 20 20 20 20 20 20 20 20 20 20
     (-Е,-Е) СИ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .(-Е,-Е)СК: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Э,-ЕР) ТХ: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-E,-E) TN: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-EI ,-E ) TR : 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-A,-ANT) TW: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е ,-Е ) UA : 20 20 20 20 20 20 20 20 20 20 20 20 20 . 
     (-A,-AB) США: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-A,-AB) US2: 27 27 27 27 27 27 27 27 27 27 27.. .
     (-А,-АВ) УСЛ: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-A,-) USX: 27 27 27 27 27 27 27 27 27 27 27 . . .
     (-А,-А)УЙ: 27 27 27 27 27 27 27 27 27 27 27 . . .
     (-А,-АР) ВЭ: 27 27 27 27 27 27 27 27 27 27 27. . .
     (-Е,-Е) ВН: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
     (-Е,-Е) ЗА: 20 20 20 20 20 20 20 20 20 20 20 20 20 .
      

    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка браузера на прием файлов cookie

    Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
    • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

    (PDF) Пустота KBC и хаббловское натяжение противоречат LCDM по шкале Gpc

    38 M.Хаслбауэр и др.

    Colin J., Mohayaee R., Rameez M. , Sarkar S., 2019, A&A,631,

    L13

    Collett TE, et al., 2018, Science,360, 1342

    Cooke RJ, Fumagalli M. ., 2018, Нац. Astron.,2, 957

    Cooke RJ, Pettini M., Steidel CC, 2018, ApJ,855, 102

    Cuceu A., Farr J., Lemos P., Font-Ribera A., 2019, J. Cosmol .

    Астропарт. Phys., 2019, 044

    Cyburt R.H., Fields B.D., Olive K.A., 2002, Astropart. физ.,

    17, 87

    Cyburt RH, Fields BD, Olive KA, Yeh T.-H., 2016, Reviews

    of Modern Physics,88, 015004

    DES Collaboration 2019, MNRAS,484 Dark Energy Survey & South Pole Telescope Collaborations 2018,

    MNRAS, 480, 3879

    Ди Валентино Э., Мельчиорри А., Силк Дж., 2020a, Nature Astronomy,

    4, 196

    Ди Валентино Э., Мельхиорри А. ., Силк Дж., 2020б, Дж. Космол. Астропарт

    .Phys., 2020, 013

    Ди Валентино Э., Мельчиорри А., Силк Дж., 2020c, препринт, ArXiv

    (arXiv:2003.04935v1)

    Дин К., Накама Т., Ван Ю., 2020, науч. Китай физ. мех.

    Астрон.,63, 2

    Додельсон С., Лигуори М., 2006, Phys. Rev. Lett.,97, 231301

    Eisenstein DJ, et al., 2005, ApJ,633, 560

    Enea AR, 2018, IJMPD,27, 1850102

    Falco M., Hansen SH, Wojtak R., Мамон Г.А., 2013, МИР РАН,

    431, L6

    Фамай Б., Binney J., 2005, MNRAS,363, 603

    Famaey B., McGaugh SS, 2012, Living Rev. Relativ.,15, 10

    Famaey B., Bruneton J.-P., Zhao H., 2007 , MNRAS,377, L79

    Fixsen DJ, 2009, ApJ,707, 916

    Frith WJ, Busswell GS, Fong R., Metcalfe N., Shanks T.,

    2003, MNRAS,345, 1049

    Frith

    WJ, Shanks T., Outram PJ, 2005, MNRAS,361, 701

    Frith WJ, Metcalfe N., Shanks T., 2006, MNRAS,371, 1601

    Fujii H., 2020, Res.Примечания Ам. Астрон. Soc.,4, 72

    Gaia Collaboration 2018, A&A,616, A1

    Гомес-Валент А., Амендола Л., 2018, J. Cosmol. Астропарт.

    Phys., 2018, 051

    Haghi H., Bazkiaei AE, Zonoozi AH, Kroupa P., 2016, MN-

    RAS,458, 4172

    MNR Haghi H. , et al., 2014a, 2019a, AS , 2441

    Haghi H., Amiri V., Hasani Zonoozi A., Banik I., Kroupa P.,

    Haslbauer M., 2019b, ApJ,884, L25

    Harrison ER, 1970, Phys.Рев. Д,1, 2726

    Хаслбауэр М., Баник И., Крупа П., Гришунин К., 2019а, МНИРАН,

    489, 2634

    Хаслбауэр М., Дабрингхаузен Дж., Крупа П., Яванмарди Б. .,

    Баник И., 2019b, A&A,626, A47

    Hill JC, McDonough E., Toomey MW, Alexander S., 2020,

    Phys. Rev. D, 102, 043507

    Hoof S., Geringer-Sameth A., Trotta R., 2020, J. Cosmol. Астропарт

    . Phys., 2020, 012

    Hoscheit B.L., Barger A.J., 2018, ApJ,854, 46

    Howk J.C., Lehner N., Fields BD, Mathews GJ, 2012, Nature,

    489, 121

    Huang JS, Cowie LL, Gardner JP, Hu EM, Songaila A.,

    Wainscoat RJ 1997, ApJ, 476, 12

    Huang CD, et al., 2020, ApJ,889, 5

    Ibata RA, et al., 2013, Nature, 493, 62

    Jaffe AH, et al., 2001, Phys. Rev. Lett.,86, 3475

    Джаванмарди Б. , Крупа П., 2017, A&A,597, A120

    Джаванмарди Б., Крупа П., 2020, MNRAS,493, L44

    Джаванмарди Б., Порчиани К., Крупа П., Пфламм-Альтенбург Дж.,

    2015, ApJ,810, 47

    Джаванмарди Б., Рауф М., Хосрошахи Х.Г., Тавасоли С., М¨

    Уллер

    О. , Молаейнежад А., 2019, ApJ,870, 50

    Jee MJ, Hughes JP, Menanteau F., Sif´on C., Mandelbaum

    R., Barrientos LF, Infante L., Ng KY, 2014, ApJ, 785, 20

    Джи И., Сую С.Х., Комацу Э., Fassnacht CD, Гилберт С.,

    Купманс ЛВЭ, 2019, Наука, 365, 1134

    Джоудаки С., Каплингхат М., Кили Р., Киркби Д., 2018, Phys.

    Ред. Д,97, 123501

    Караченцев И. Д., 2012, Астрофиз. Бюлл., 67, 123

    Караченцев И. Д., Теликова К. Н., 2018, Астрон. Nachr.,339,

    615

    Karwal T., Kamionkowski M., 2016, Phys. Rev. D,94, 103523

    Кашлинский А., Атрио-Барандела Ф., Коцевски Д., Эбелинг Х.,

    2008, ApJ,686, L49

    Кашлинский А., Атрио-Барандела Ф., Эбелинг Х. ., 2011, ApJ,732, 1

    Кац Х., McGaugh S., Teuben P., Angus GW, 2013, ApJ,772,

    10

    Keenan RC, Barger AJ, Cowie LL, 2013, ApJ,775, 62

    Kenworthy WD, Scolnic D., Riess A ., 2019, ApJ,875, 145

    Хораминежад Х., Виэль М., Баччигалупи К., Архидиаконо М.,

    2020, Ж. Космология Астропарт. Phys.,2020, 039

    Kochanek CS, 2020, MNRAS,493, 1725

    Kogut A., et al., 1993, ApJ,419, 1

    Kov´acs A., 2018, MNRAS,475, 1777

    Крупа П., 2012, изд. Астрон. соц. Августа, 29, 395

    Крупа П., 2015, кан. J. Phys.,93, 169

    Kroupa P., Theis C., Boily CM, 2005, A&A,431, 517

    Kroupa P., et al., 2018, Nature,561, E4

    Lavaux G. , Hudson MJ, 2011, MNRAS,416, 2840

    Lelli F., McGaugh SS, Schombert JM, 2016, AJ,152, 157

    Lelli F., McGaugh SS, Schombert JM, Pawlowski MS, 2017,

    Ap ,836, 152

    Льюис Г.Ф., Барнс Л.А., Кошик Р., 2016, MNRAS,460, 291

    Llinares C., Knebe A., Zhao H., 2008, MNRAS,391, 1778

    ughausen F. , Famaey B., Kroupa P., 2015, Can . J. Phys.,93,

    232

    Macaulay E., et al., 2019, MNRAS,486, 2184

    Macpherson HJ, Lasky PD, Price DJ, 2018, ApJ,865, L4

    Maddox SJ, Sutherland WJ, Efstathiou G., Loveday J., Pe-

    terson BA, 1990, MNRAS, 247, 1P

    Mantz AB, et al., 2015, MNRAS, 446, 2205

    Marra V., Amendola L., Sawicki I., Valkenburg W., 2013, Phys.

    Rev. Lett., 110, 241305

    Marriage TA, et al., 2011, ApJ, 737, 61 Rev. Lett., 106, 121303

    McGaugh SS, 2016, ApJ,832, L8

    McGaugh S., Milgrom M., 2013, ApJ,775, 139

    McGaugh SS, Wolf J., 2010, ApJ, 722, 248

    McGaugh SS, Schombert JM, Bothun GD, de Blok WJG,

    2000, ApJ, 533, L99

    Melia F., 2020, Евро. физ. J. Plus,135, 511

    Menanteau F., et al., 2012, ApJ,748, 7

    Merle A., 2017, Стерильная нейтринная темная материя. Morgan & Claypool

    Publishers, doi: 10.1088/978-1-6817-4481-0

    Месарос А., 2019, Астрон. Nachr.,340, 564

    Migkas K., Schellenberger G., Reiprich TH, Pacaud F., Ramos-

    Ceja ME, Lovisari L., 2020, A&A,636, A15

    Milgrom M., 1983, ApJ ,270, 365

    Милгром М., 1986, ApJ,302, 617

    Милгром М., 1999, Физ. лат. A,253, 273

    Милгром М., 2010, МНРАН,403, 886

    Милгром М., 2013, Phys. Rev. Lett.,111, 041105

    Милгром М., 2017, препринт, ArXiv (arXiv:1703.06110v3)

    Милгром М., 2020a, Исследования по истории и философии науки,

    71, 170 9000 Милгром ., 2020b, препринт, ArXiv (arXiv:2001.09729v1)

    Millon M., et al., 2020, A&A,639, A101

    Mirabel IF, Dottori H., Lutz D., 1992, A&A, 256, L19

    MNRAS 000,1–40 (2020)

    Вакцина на основе высокоаттенуированного штамма вируса коровьей оспы LC16m8 для лечения тяжелой лихорадки с синдромом тромбоцитопении

    Образец цитирования: Х., Куросу Т. и соавт.(2021) Вакцина на основе штамма LC16m8 вируса осповакцины с высокой степенью ослабления для лечения тяжелой лихорадки с синдромом тромбоцитопении. PLoS Pathog 17 (2): е1008859. https://doi.org/10.1371/journal.ppat.1008859

    Редактор: Александр Букреев, Медицинское отделение Техасского университета / Галвестонская национальная лаборатория, США

    Поступила в редакцию: 31 июля 2020 г.; Принято: 18 января 2021 г .; Опубликовано: 3 февраля 2021 г.

    Авторское право: © 2021 Yoshikawa et al.Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в рукописи.

    Финансирование: MSa и MSh получили финансовую поддержку от Министерства здравоохранения, труда и социального обеспечения Японии (https://www. mhlw.go.jp/english/) (грант №.h36-Sinkogyousei-Shitei-002, h39-Sinkogyousei-Shitei-002, 20HA2005) и от Японского агентства медицинских исследований и разработок (AMED) (https://www.amed.go.jp/en/) (грант № , JP15fk0108037, JP20fk0108002, JP20fk0108081, MSa-JP17fk0108312 и JP20fk0108072). TY & NN получили финансовую поддержку от Министерства здравоохранения, труда и социального обеспечения Японии (https://www.mhlw.go.jp/english/) (грант № h39-Sinkogyousei-Shitei-002 и 20HA2005), а также от Японское агентство медицинских исследований и разработок (AMED) (https://www.amed.go.jp/en/) (№ гранта JP17fk0108312, JP20fk0108072 и TY-JP20fk0108081). Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: У авторов нет конкурирующих интересов.

    Введение

    Тяжелая лихорадка с синдромом тромбоцитопении (SFTS) представляет собой формирующуюся вирусную геморрагическую лихорадку с высокой летальностью (примерно от 5 до более 40%) [1–6]. Клиническими симптомами являются лихорадка, общее недомогание, миалгия, тошнота, рвота и диарея.Лабораторные данные включают лейкоцитопению и тромбоцитопению в общем количестве клеток крови и повышенный уровень печеночных ферментов в сыворотке крови [1, 7–11]. Болезнь вызывается видом Dabie bandavirus , который был назван SFTS вирусом (SFTSV), а позже Huaiyangshan banyangvirus [12], новым клещевым вирусом отряда Bunyavirales , семейство Phenuiviridae. и род Bandavirus . Вирусный геном состоит из трех сегментов РНК с отрицательной цепью и кодирует четыре гена: РНК-зависимую РНК-полимеразу, предшественник гликопротеинов оболочки (GPC), нуклеопротеин (N) и неструктурный белок.Коренные SFTS были зарегистрированы в Китае, Японии, Южной Корее и Вьетнаме [1–3, 13–15]. Следовательно, срочно необходима разработка эффективной вакцины для SFTS. До сих пор сообщалось, что живой рекомбинантный вирус везикулярного стоматита или ДНК-вакцина, экспрессирующая гликопротеины (GP) SFTSV, произошли от гена GPC SFTSV, вызывающего защитный иммунитет против SFTSV в летальных моделях мышей или хорьков [16, 17].

    Вирус коровьей оспы (VAC) использовался в качестве вакцины против оспы, а вакцины против оспы, полученные с использованием различных штаммов VAC, использовались во время глобальной программы ликвидации оспы, проводимой Всемирной организацией здравоохранения.С тех пор как в 1980 г. было объявлено об искоренении оспы, VAC использовали в качестве вектора рекомбинантной вакцины с расчетом на иммуногенность [18, 19]. Однако, поскольку штаммы VAC, использовавшиеся в качестве вакцинного вектора в начале кампании по ликвидации, представляли собой в основном так называемые противооспенные вакцины второго поколения, которые ассоциировались с серьезными побочными эффектами, такими как энцефалит, энцефалопатия, конъюнктивит, прогрессирующая вакцина, вакцинная экзема и генерализованные ВАК-инфекции плода [18, 20, 21], применение ВАК не пользовалось популярностью.Подтверждено, что штамм VAC LC16m8 (m8), который классифицируется как противооспенная вакцина третьего поколения, а также модифицированная осповакцина Анкара (MVA) имеют сильно ослабленный фенотип, но сохраняют иммуногенность для защиты от других ортопоксвирусных инфекций, таких как как оспа обезьян [22–24]. Значительная разница в характеристиках между m8 и MVA заключается в способности к репликации in vitro. LC16m8 может инфицировать клетки млекопитающих и продуцировать потомство вирусов в клетках почек кролика, таких как первичные клетки почек кролика и клетки RK13, хотя диапазон типов клеток-хозяев ограничен.С другой стороны, MVA может инфицировать клетки млекопитающих, но не может хорошо реплицироваться в большинстве клеток млекопитающих [21]. m8 лицензирована для использования у здоровых людей в Японии, и к настоящему времени вакциной m8 было вакцинировано около 100 000 человек, с ответом антител, сравнимым с вакциной первого поколения [25], и без тяжелых поствакцинальных осложнений [25, 26]. Этот хорошо сбалансированный профиль безопасности и иммуногенности m8 представляет собой значительное преимущество перед первым и вторым поколениями VAC.В настоящем исследовании рекомбинантные штаммы m8, которые экспрессируют SFTSV N (m8-N), GPC (m8-GPC) или и N, и GPC (m8-N+GPC) (вакцины SFTSV на основе m8), были созданы в качестве кандидатов на вакцину SFTS. . Предполагается, что N и GPC способствовали клеточному иммунитету и/или гуморальному иммунитету против инфекции SFTSV. Иммуногенность и защитную эффективность вакцин SFTSV на основе m8 против SFTSV оценивали с использованием мышиной модели летального SFTS.

    Результаты

    Создание и характеристика рекомбинантного m8, содержащего гены SFTSV

    Окончательные рекомбинантные вакцины SFTSV на основе m8 содержали кассету экспрессии гена SFTSV во фланкирующей области между генами B4R и B6R вместо гена B5R (рис. 1А).SFTSV N и Gc были обнаружены в клетках, инфицированных m8-N и m8-GPC, соответственно, тогда как N и Gc были обнаружены в клетках, инфицированных m8-N + GPC (рис. 1B). Морфология бляшек, индуцированных каждым из рекомбинантных m8, была сходной. Бляшки клеток, инфицированных m8-N и m8-GPC, были положительными только по экспрессии SFTSV N и GP соответственно. Бляшки, образовавшиеся в клетках, инфицированных m8-N+GPC, показали положительную реакцию экспрессии как N, так и GP. Продукцию VLP в клетках, инфицированных m8-GPC или m8-N+GPC, оценивали с помощью электронной микроскопии (рис. 1C).Морфологические характеристики VLP были обернутыми и сферическими с приблизительным диаметром 100 нм и казались похожими на характеристики SFTSV. Затем оценивали включение белков N, Gn и Gc в VLP, полученную из клеток, инфицированных m8-N+GPC (рис. 2). Когда VLP удаляли при иммунопреципитации с использованием анти-SFTSV Gc mAb, количество белка N, выделенного из клеток, инфицированных m8-N+GPC, было более значительным, чем количество белка, инфицированного m8-N, по сравнению с тем, когда антитела не использовались. .С другой стороны, добавление антитела против SFTSV Gc не влияло на выделение белка N из супернатанта m8-N-инфицированных клеток, который не содержал VLP (рис. 2А и рис. S1). Из трех независимых экспериментов было подтверждено, что плотность N-белка в иммунопреципитации была значительно повышена, когда N-белок извлекали из супернатанта клеток, инфицированных m8-N+GPC, с использованием анти-SFTSV Gc mAb по сравнению с таковым при без использования антител (рис. 2В).Напротив, плотность белка N белка N, извлеченного из супернатанта клеток, инфицированных m8-N, с использованием антител против SFTSV Gc, была на том же уровне, что и без использования антител (фиг. 2B). Оценивали уровень включения белков Gn и Gc в VLP (рис. 2C). Плотность белков Gn и Gc увеличивалась, когда VLP, продуцируемые в m8-N+GPC- или m8-GPC-инфицированных клетках, подавляли иммунопреципитацией с использованием анти-SFTSV Gc mAb. Этот результат указывал на то, что клетки, инфицированные m8-GPC или m8-N+GPC, продуцировали SFTSV-подобные частицы и что гликопротеины или как N, так и гликопротеины были включены в VLP.

    Рис. 1. Конструирование, получение и характеристика рекомбинантного LC16m8, содержащего гены SFTSV N, GPC, а также гены N, GPC и EGFP.

    Схематическое изображение участка, содержащего гены EGFP, SFTSV в геноме вакцин m8-EGFP или SFTSV на основе m8 (A). Ген VAC B5R, фланкированный генами B4R и B6R, был заменен на ген SFTSV. Синтетический ранний/поздний промотор коровьей оспы обозначен буквой P в стрелке. Экспрессия SFTSV N и GP была подтверждена в бляшках клеток, инфицированных вакциной SFTSV на основе m8 (B).Образование бляшек было подтверждено с помощью фазово-контрастной микроскопии (фазоконтраст). Экспрессию SFTSV N определяли в ИФА с использованием кроличьего анти-SFTSV N (первое антитело) и DyLight 594-антикроличьего IgG (второе антитело) с визуализацией белка N с красным флуоресцентным сигналом. Экспрессию SFTSV GP определяли в ИФА с использованием мышиного анти-SFTSV Gc (первое антитело) и DyLight 488-анти-мышиного IgG (второе антитело) с визуализацией SFTSV GP зеленым флуоресцентным сигналом.Полоса на изображении указывает длину 100 мкм. Очищенные VLP из супернатанта клеток, инфицированных m8-N+GPC или m8-GPC, окрашивали отрицательно и наблюдали под просвечивающим электронным микроскопом (C). Супернатант осаждали с использованием ПЭГ 6000, и VLP связывали ультрацентрифугированием на границе раздела 20% и 60% (масса/объем) сахарозы с двойной подушкой. Клетки RK13 инфицировали m8-N+GPC или m8-GPC при MOI 0,1 на клетку, и культуральный супернатант собирали при 3 DPI. Собранные VLP в культуральном супернатанте разделяли на границе раздела 20/60% и затем отрицательно окрашивали 2% фосфорно-вольфрамовой кислотой.Полоса на изображении указывает длину 100 нм. Морфология SFTS VLP из m8-N+GPC-инфицированных клеток и m8-GPC была неотличима.

    https://doi.org/10.1371/journal.ppat.1008859.g001

    Рис. 2. Включение белков SFTSV N, Gn и Gc в VLP.

    Оценивали включение белка SFTSV N в VLP (A). Показан один представитель из трех независимых экспериментов, а оставшиеся два блота показаны на S1 рис.VLP в супернатанте клеток RK13, инфицированных m8-EGFP, m8-N или m8-N+GPC, реагировали с или без анти-SFTSV Gc mAb (клон C6C1) и затем осаждали магнитными шариками против IgG мыши. Осажденные магнитные шарики затем разделяли на SDS-PAGE и анализировали вестерн-блоттингом с использованием поликлонального антитела кролика против SFTSV N (SFTSV N), и расчетная плотность белка N показана внизу блота. Белок N и ген домашнего хозяйства, экспрессия белка GAPDH (GAPDH), в клеточных лизатах RK13, инфицированных m8-EGFP, m8-N или m8-N+GPC, показаны в качестве положительного контроля. Накопление белка N с анти-Gc mAb или без него для иммунопреципитации анализировали полуколичественно (B). Наносили расчетную плотность белка N на пятнах из трех независимых экспериментов. Оценивали включение белков SFTSV Gn и Gc в VLP, а также включение белка N (C). VLP в супернатанте клеток RK13, инфицированных m8-EGFP, m8-GPC или m8-N+GPC, удаляли с помощью магнитных гранул против SFTSV Gc mAb и против IgG мыши. Накопление белков Gn и Gc было подтверждено с помощью кроличьих поликлональных антител против SFTSV Gn (SFTSV Gn) и Gc (SFTSV Gc) соответственно.Рассчитанная плотность белков Gn и Gc также указана внизу блота. Экспрессия белков Gn, Gc и GAPDH в клеточных лизатах RK13, инфицированных m8-EGFP, m8-GCP или m8-N+GPC, показана в качестве положительного контроля. Критерий Крускала-Уоллиса с критерием множественного сравнения Данна использовали для определения уровня статистической значимости между плотностью белка N с добавлением и без добавления анти-SFTSV Gc mAb. Вычисленные значения р и кратность изменения среднего значения без анти-Gc и анти-Gc показаны над сравниваемыми группами. нс: не имеет значения.

    https://doi.org/10.1371/journal.ppat.1008859.g002

    Иммуногенность вакцин против SFTSV на основе m8 у мышей

    Группам (по 5 в группе) мышей в возрасте от семи до восьми недель, ранее не подвергавшихся лечению, с дефицитом рецептора интерферона альфа I типа (IFNAR-/-) дважды с двухнедельным интервалом подкожно инокулировали либо вакцину SFTSV на основе m8, либо вакцину m8. -EGFP в качестве отрицательного контроля. Ни у одной из мышей, вакцинированных какой-либо из вакцин SFTSV на основе m8, включая отрицательный контроль, не развились наблюдаемые клинические признаки заболевания, такие как взъерошенная шерсть или образование оспин в месте инокуляции.Для оценки иммуногенности вакцин SFTSV на основе m8 у мышей IFNAR-/- собирали сыворотку и подвергали IFA и тесту нейтрализации (NT). Пять мышей, ранее не получавших IFNAR-/-, были подкожно инфицированы 10 TCID 50 SFTSV YG-1 в качестве положительного контроля. Поскольку одна из пяти мышей умерла через 13 дней после заражения SFTSV, сыворотку крови собирали у четырех мышей через четыре недели после заражения. Кроме того, одна из сывороток, взятых у четырех мышей, инфицированных SFTSV, была исключена из последующих анализов, поскольку сыворотка не подвергалась сероконверсии (т.т. е. результаты как ИФА, так и НТ были отрицательными). Специфические IgG против SFTSV N или GP в сыворотке были выявлены при инфицировании мышей m8-N, m8-GPC или m8-N+GPC (фиг. 3A и 3B). Также были выявлены NT-антитела к SFTSV (рис. 3C). Титры 50% нейтрализации сывороток, собранных у мышей, инфицированных m8-GPC, m8-N+GPC и даже инфицированных SFTSV, существенно не отличались (рис. 3D). У двух мышей, инокулированных m8-N+GPC или m8-GPC, индуцировалось менее 10 из 50% титра антител против NT, хотя обе мыши индуцировали специфические IgG против SFTSV GP.Эти результаты показали, что вакцины SFTSV на основе m8 индуцируют гуморальный иммунитет, а эффективность индукции была сравнима с таковой, индуцированной аутентичным SFTSV.

    Рис. 3. Иммуногенность вакцин SFTSV на основе m8 у мышей.

    Наивным мышам IFNAR-/- вводили подкожно дважды с интервалом в 2 недели в дозе 1 × 10 6 БОЕ m8-EGFP, m8-N, m8-GPC или m8-N+GPC или инфицировали подкожно с 10 TCID 50 SFTSV YG-1 (инфекция SFTSV). Через две недели после второй инокуляции мышей рекомбинантным m8s или через 4 недели после заражения SFTSV мышей подвергали эвтаназии и умерщвляли.Кровь собирали для оценки продукции анти-SFTSV N-специфического (A) или GPs-специфического (B) IgG. Каждая точка представляет собой титр антител. Горизонтальные линии представляют среднее значение. Горизонтальная пунктирная линия «2 3 » указывает предел обнаружения. Также измеряли нейтрализующие антитела к SFTSV (C) SFTSV YG-1 смешивали и инкубировали с 3 серийными 4-кратными разведениями (1/10, 1/40 или 1/160) сыворотки. Процентный титр нейтрализации определяли путем деления количества очагов на количество мышей, не подвергавшихся лечению.Титр антител 50% NT (D) определяли по результату, показанному на фиг. 3C. Горизонтальная пунктирная линия «2 3,32 », равная действительному числу 10, указывает предел обнаружения. Критерий Крускала-Уоллиса с критерием множественного сравнения Данна использовался для определения уровня статистической значимости. Вычисленные p-значения показаны над сравниваемыми группами. нс: не имеет значения.

    https://doi.org/10.1371/journal.ppat.1008859.g003

    Эффективность вакцин против SFTSV на основе m8 у мышей

    Группам (от 8 до 10 на группу) мышей IFNAR-/- в возрасте от шести до девяти недель подкожно инокулировали дважды с двухнедельным интервалом каждой вакциной SFTSV на основе m8.Через две недели после второй инокуляции мышам подкожно вводили 1×10 3 или 1×10 5 TCID 50 SFTSV YG-1. В то время как почти все контрольные мыши умерли после развития клинических признаков, таких как взлохмаченный мех, сгорбленная осанка и потеря веса, все мыши, привитые либо m8-GPC, либо m8-N+GPC, выжили без каких-либо явных клинических признаков. в течение двухнедельного периода наблюдения после заражения SFTSV (рис. 4A–4D). Кроме того, все мыши, которым вводили m8-N, выжили без каких-либо явных клинических признаков после заражения SFTSV дозой 1 × 10 3 TCID 50 в течение двухнедельного периода наблюдения (рис. 4A и 4C). .С другой стороны, мыши, инокулированные m8-N, выжили, но у них временно развились клинические признаки при заражении 1 × 10 5 TCID 50 SFTSV (рис. 4B и 4D). Чтобы оценить иммунный ответ на N и GP SFTSV путем оценки сероконверсии, сыворотки, собранные у мышей, которые выжили через две недели после заражения SFTSV, подвергали IFA для измерения специфических IgG против SFTSV N и GP, которые не будут индуцироваться моновалентным m8. -GPC и m8-N соответственно. Поскольку мыши, привитые m8-N+GPC, индуцировали специфические IgG как против SFTSV N, так и против GP, сыворотку мышей, привитых m8-N+GPC, не подвергали IFA.SFTSV GPs-специфический IgG не индуцировался у мышей, инокулированных m8-N, в то время как N-специфический IgG индуцировался у пяти из восьми мышей, инокулированных m8-GPC, при заражении 1 × 10 3 TCID 50 SFTSV (рис. 4E). и 4Ф). С другой стороны, все мыши, инокулированные m8-N или m8-GPC, сероконверсировали после заражения 1 × 10 5 TCID 50 SFTSV. Эти результаты показали, что вакцины против SFTSV на основе m8 обеспечивали защиту от летального заражения SFTSV. Выявлена ​​разница в степени эффективности между m8-N и m8-GPC, включая m8-N+GPC.

    Рис. 4. Выживаемость, изменение веса и серопозитивность у мышей, привитых вакциной SFTSV на основе m8, с последующим летальным заражением SFTSV.

    IFNAR-/- мышам подкожно дважды с интервалом в 2 недели вводили дозу 1 × 10 6 БОЕ m8-EGFP, m8-N, m8-GPC или m8-N+GPC. Через две недели после второй прививки мышей вакцинами m8-EGFP или SFTSV на основе m8 мышам подкожно вводили 1 × 10 3 (A, C) или 1 × 10 5 (B, D). ТКИД 50 СФЦВ ЮГ-1.Выживаемость (А, Б) и последовательное изменение процентного веса от исходного (В, Г) отслеживали ежедневно в течение 2 недель. Количество мышей в группе указано как «n» в легенде. Для определения уровня статистической значимости использовали критерий логарифмического ранга. Рассчитанные p-значения показаны рядом со сравниваемыми группами. Оценивали серопозитивность у мышей, инокулированных m8-N или m8-GPC, а затем инфицированных SFTSV. Сыворотку собирали у мышей, инокулированных m8-N (E) и m8-GPC (F), через 2 недели после 1 × 10 3 или 1 × 10 5 TCID 50 инфекции SFTSV для проверки того, была ли сероконверсия индуцированной инфекцией SFTSV или нет.Были измерены специфические IgG против SFTSV GPs и N, которые должны индуцироваться инфекцией SFTSV и которые никогда не должны индуцироваться моновалентными m8-N и m8-GPC соответственно. Каждая точка представляет собой титр антител. Горизонтальная пунктирная линия 2 3 указывает предел обнаружения.

    https://doi.org/10.1371/journal.ppat.1008859.g004

    Влияние ранее существовавшего иммунитета против VAC

    Для оценки влияния ранее существовавшего иммунитета к VAC на защитный иммунитет, индуцированный вакцинами SFTSV на основе m8, мышей IFNAR-/- иммунизировали VAC, а затем инокулировали каждой вакциной SFTSV на основе m8 и заражали SFTSV. Выживаемость мышей, предварительно иммунизированных VAC, инфицированных 1 × 10 3 или 1 × 10 5 TCID 50 SFTSV, была улучшена путем инокуляции m8-N, m8-GPC или m8-N+GPC в сравнение с контрольными мышами, которым вводили m8-EGFP (рис. 5). Однако показатели выживаемости были ниже, чем у мышей, которые не были иммунизированы VAC Lister до вакцинации (фиг. 4А и 4В, 5А и 5В). Выживаемость мышей, инокулированных m8-N+GPC, была аналогична таковой у мышей, инокулированных m8-GPC, тогда как выживаемость мышей, инокулированных m8-N, была ниже по сравнению с m8-N+GPC- и m8-GPC. -привитые мыши.Тяжесть заболевания в группах имела тенденцию демонстрировать сходную тенденцию с выживаемостью. Хотя у всех мышей, даже инокулированных m8-N, m8-GPC, m8-N+GPC, клинические симптомы развились после заражения 1×10 3 TCID 50 или 1×10 5 TCID . 50 SFTSV, потеря веса у мышей, привитых вакцинами SFTSV на основе m8, особенно у мышей, привитых m8-GPC или m8-N+GPC, была более легкой по сравнению с мышами, привитыми m8-EGFP (рис. 5C и 5D). .Количество выживших мышей уменьшилось с десяти до шести и с четырех до трех у мышей, инокулированных m8-N+GPC, и у мышей, инокулированных m8-N, соответственно, за счет увеличения дозы SFTSV с 1 × 10 3 до 1 × 10 5 TCID 50 (рис. 5А и 5В). Хотя количество выживших у мышей, инокулированных m8-GPC, увеличилось с шести до семи, это увеличение могло быть связано с экспериментальными колебаниями. Это предположение, по-видимому, подтверждается тенденцией изменения массы тела (рис. 5C и 5D).Не было различий в тенденции изменения массы тела между мышами, привитыми m8-GPC, зараженными 1 × 10 3 TCID 50 SFTSV, и мышами, зараженными 1 × 10 5 TCID 50 SFTSV. Подобные явления были также продемонстрированы между мышами, привитыми m8-N+GPC, зараженными 1 × 10 3 TCID 50 SFTSV, и мышами, зараженными 1 × 10 5 TCID 50 SFTSV. С другой стороны, тенденция изменения массы тела у мышей, инокулированных m8-N, напоминала тенденцию у мышей, инокулированных m8-EGFP, хотя мыши, инокулированные m8-N, частично выжили (рис. 5C и 5D).LC16m8-GPC и m8-N+GPC были столь же эффективны, как и вакцины SFTSV. Эти результаты показали, что вакцины против SFTSV на основе m8 обеспечивали защиту от летального заражения SFTSV у мышей, даже при наличии ранее существовавшего иммунитета к VAC.

    Рис. 5. Выживаемость и изменение массы тела у мышей, иммунизированных VAC, до инокуляции вакциной SFTSV на основе m8.

    Мышей IFNAR-/- инокулировали дважды с интервалом в 2 недели в дозе 1 × 10 6 БОЕ m8-EGFP, m8-N, m8-GPC или m8-N+GPC через 1 месяц после инокуляции с 1 × 10 6 БОЕ VAC штамм Lister.Через две недели после второй инокуляции m8-EGFP, m8-N, m8-GPC или m8-N+GPC мышам подкожно вводили 1 × 10 3 (A, C) или 1 × 10 5 (Б, Г) ТКИД 50 СФЦВ ЮГ-1. Выживаемость (А, В) и процентное последовательное изменение веса по сравнению с исходным (С, D) отслеживали ежедневно в течение 2 недель. Количество мышей, используемых в группе, указано как «n» в легенде. Для определения уровня статистической значимости использовали логарифмический ранговый критерий с поправкой Бонферрони. Для корректировки уровня значимости базовый уровень значимости был разделен на количество проверенных нулевых гипотез (т. е. 0,05/3 = 0,017). Рассчитанные p-значения показаны рядом со сравниваемыми группами.

    https://doi.org/10.1371/journal.ppat.1008859.g005

    Динамика инфекции SFTSV у мышей, привитых вакцинами против SFTSV на основе m8

    Для изучения эффективности вакцин против SFTSV на основе m8 у мышей в отношении пространственной и временной динамики инфекции SFTSV 6-недельным мышам IFNAR-/- (по три в группе в каждый день сбора) подкожно инокулировали дважды с двухнедельным интервалом с вакцинами SFTSV на основе m8.Через две недели после второй инокуляции мышам подкожно вводили 1 × 10 5 TCID 50 SFTSV YG-1, а сыворотку и ткани собирали на 1, 3 и 5 DPI. Сыворотки, собранные у мышей, инокулированных m8-EGFP, показали высокий титр SFTSV (фиг. 6А). Напротив, в сыворотке мышей, инокулированных m8-N, m8-GPC или m8-N+GPC, SFTSV был ниже предела обнаружения или было обнаружено небольшое количество вируса (рис. 6A). РНК SFTSV была обнаружена в сыворотке у одной трети мышей, инокулированных m8-EGFP, при 1 DPI, а количество копий резко увеличилось при 3 и 5 DPI (фиг. 6B).Средние уровни вирусной РНК в 1 мл сыворотки составили 1×10 6,3 и 1×10 7,5 копий при 3 и 5 DPI соответственно. С другой стороны, уровень вирусной РНК в сыворотке мышей, привитых вакцинами SFTSV на основе m8, был значительно ниже, чем у мышей, привитых m8-EGFP. Однако переход уровня отличался среди мышей, инокулированных m8-N, m8-GPC и m8-N+GPC (фиг. 6B). РНК SFTSV была обнаружена у мышей, инокулированных m8-N, в течение 3–5 дней, хотя количество вирусной РНК было небольшим.В сыворотке мышей, инокулированных m8-GPC, вирусная РНК была обнаружена при 3 DPI, но была ниже предела обнаружения при 5 DPI. Уровень вирусной РНК был ниже предела обнаружения в сыворотке мышей, инокулированных m8-N+GPC, не только на 3, но и на 5 ДПИ. Также измеряли последовательное изменение уровня вирусной РНК в селезенке (фиг. 6С). Хотя количество вирусной РНК и положительное число были небольшими, вирусная РНК была обнаружена в селезенке мышей, инокулированных m8-GPC, и мышей, инокулированных m8-N, при 1 DPI, а также была обнаружена в селезенке мышей m8-N. +GPC-инокулированные мыши при 3 DPI у одной из 3 мышей в каждой.На 5 DPI уровень вирусной РНК в селезенке повышался не только у мышей, инокулированных m8-EGFP, но и у мышей, инокулированных m8-N. Эти результаты также показали, что сероконверсия против белка N у мышей, инокулированных m8-GPC, произошла из-за инфекции SFTSV, что подтверждается обнаружением вирусной РНК низкого уровня (рис. 4F и 6).

    Рис. 6. Инфекционные уровни генома SFTSV и SFTSV и гистопатологические изменения в ткани мышей, привитых вакциной на основе m8.

    IFNAR-/- мышам вводили m8-N, m8-GPC, m8-N+GPC или m8-EGFP.Через две недели после второй инокуляции мышам подкожно вводили 1×10 5 TCID 50 SFTSV YG-1. Трех инфицированных мышей умерщвляли и собирали кровь на 1, 3 и 5 DPI. Последовательное изменение титров инфекционных вирусов SFTSV в сыворотке определяли с помощью стандартного анализа TCID 50 (А). Копии РНК SFTSV определяли в сыворотке с помощью количественной ПЦР (Б) и в селезенке (В), нормализованной по 1×10 7 копий мышиного β-актина.Двусторонний дисперсионный анализ с тестом множественного сравнения Сидака использовался для определения уровня статистической значимости. Вычисленные p-значения показаны над сравниваемыми группами. ЕД, ниже предела обнаружения, который составляет 32 TCID 50 на мл, 125 копий на мл сыворотки или 10 копий на 1×10 7 копий мышиного β-актина в селезенке.

    https://doi.org/10.1371/journal.ppat.1008859.g006

    Гистопатологический и иммуногистохимический анализ

    Печень, почки, селезенка и шейные лимфатические узлы, вырезанные у мышей, которым инокулировали m8-N, m8-GPC, m8-N+GPC и m8-EGFP после заражения SFTSV на 1, 3 и 5 DPI, подвергали гистопатологическому исследованию. и иммуногистохимические анализы.Патологические изменения этих органов различались между группами, вакцинированными 3 SFTSV на основе m8, и контрольными мышами, привитыми m8-EGFP. Не было никаких гистопатологических изменений и каких-либо клеток с вирусным антигеном в исследованных органах, вырезанных из мышей, инокулированных m8-GPC или m8-N+GPC (таблицы 1 и 2 и фиг. 7A и 7B). У мышей, инокулированных m8-N, наблюдалась очаговая инфильтрация лимфоцитов в печени на 1 и 3 DPI, хотя вирусные антиген-положительные клетки в это время не обнаруживались. На 5 ДПИ отмечались патологические изменения, в том числе многоочаговый некроз в печени, умеренная интерстициальная лимфоцитарная инфильтрация в почках, очаговая инфильтрация нейтрофилами в белой пульпе селезенки (рис. 7С вверху и внизу слева) и истощение лимфоцитов в шейные лимфатические узлы.Кроме того, у мышей, инокулированных m8-N, вирусные антиген-положительные большие мононуклеарные клетки были обнаружены только в селезенке и шейных лимфатических узлах, как это также наблюдалось у мышей, инокулированных m8-EGFP (таблица 2 и рис. 7C внизу справа). Это наблюдение коррелировало с обнаружением более высокого уровня вирусной РНК в селезенке мышей, инокулированных m8-N, при 5 DPI (рис. 6C и 7C). У контрольных мышей, инокулированных m8-EGFP, наблюдались следующие гистопатологические изменения. Очаговый некроз с инфильтрацией нейтрофилами и лимфоцитами и легкой инфильтрацией мононуклеарными клетками был выявлен в печени и почках на 1 ДПИ.Эти поражения печени и почек со временем постепенно распространяются (таблица 1). Лимфоцитарное истощение с апоптозом и инфильтрация нейтрофилов также были обнаружены в некоторых белых пульпах в селезенке и шейных лимфатических узлах при 3 DPI, и поражения прогрессировали как тяжелое лимфоцитарное истощение с массивным некрозом в селезеночной белой пульпе, а шейные лимфатические узлы вызывали почти фолликулярную структуру. исчезло на 5 DPI (рис. 7D вверху и внизу слева). Некоторые вирусные антиген-положительные клетки, которые представляли собой крупные мононуклеарные клетки, начали выявляться при 3DPI (таблица 2 и рис. 7D внизу справа), и клетки постоянно локализовались в очагах поражения, включая печень, почки, селезенку и лимфатические узлы.

    Рис. 7. Гистопатологические изменения в селезенке через 5 дней у мышей, привитых вакциной на основе m8 после заражения SFTSV.

    Показана гистопатология селезенки мышей, инокулированных m8-N+GPC (A), m8-GPC (B), m8-N (C) и m8-EGFP (D) после заражения SFTSV. Срезы ткани, окрашенные гематоксилином и эозином, с большим увеличением (слева) и иммуногистохимия (справа) интересующих областей показаны внизу изображений с малым увеличением каждой группы.

    https://дои.org/10.1371/journal.ppat.1008859.g007

    Эти результаты показали, что вакцинация любой из вакцин против SFTSV на основе m8 вызывала защитный иммунитет, который подавлял размножение SFTSV и воспаление in vivo . Однако следует отметить, что эффективность, индуцированная вакциной SFTSV GPC на основе m8, превосходит эффективность, индуцированную вакцинацией m8-N.

    Вклад антител, индуцированных вакциной SFTSV на основе m8

    Чтобы проверить вклад гуморального иммунитета, индуцированного вакцинами SFTSV на основе m8, сыворотку, полученную от мышей, инокулированных каждой вакциной в предыдущем эксперименте, как показано на рис. 3, пассивно перенесли наивным мышам и заразили SFTSV.В качестве контроля группе наивных мышей вводили сыворотку, полученную от мышей через три недели после заражения 1 × 10 1 TCID 50 SFTSV. Мышам в возрасте от 6 до 10 недель, ранее не получавшим IFNAR-/- (5 или 2 на группу), внутрибрюшинно вводили 100 мкл сыворотки за день до (-1 DPI) и непосредственно перед (0 DPI) заражением SFTSV в дозе 1 × 10 3 TCID 50 подкожно. Сыворотки, использованные для этого эксперимента по пассивному переносу сыворотки, были собраны у мышей, привитых каждой вакциной на основе m8.Для оценки эффективности сыворотки, собранной от каждой группы мышей, инокулированных каждой вакциной SFTSV на основе m8, оценивали связь между титрами антител в сыворотке и исходом. Показаны индивидуальные титры антител IFA и NT в сыворотке, использованной для этого эксперимента по пассивному переносу сыворотки, которые в целом показаны на фиг. 3 (таблица 3). Уровень выживаемости мышей, обработанных каждой сывороткой, полученной от мышей, иммунизированных каждой вакциной SFTSV на основе m8, не показал значительного улучшения по сравнению с контрольными мышами, инокулированными m8-EGFP (фиг. 8).Однако было несколько мышей, у которых не наблюдалось потери веса в каждой группе мышей, обработанных сывороткой, полученной от мышей, инокулированных m8-GPC, m8-N+GPC- или YG-1. Не было существенной корреляции между уровнем индивидуальных титров 50% NT антител и исходом мыши-реципиента после заражения SFTSV (таблица 3). На основании результатов для следующего эксперимента по пассивному переносу использовали увеличенное количество сыворотки. Группам мышей, ранее не получавших IFNAR-/- (от 15 до 16 мышей в группе), дважды с двухнедельным интервалом подкожно вводили каждую вакцину SFTSV на основе m8. Сыворотки собирали у мышей и объединяли в каждой группе мышей. Подтверждено, что объединенные сыворотки содержат специфичные к вирусному белку и NT антитела против SFTSV (таблица 4). Затем пяти-шестинедельным мышам, ранее не подвергавшимся воздействию IFNAR-/- (по пять на группу), внутрибрюшинно вводили 400 мкл объединенной сыворотки при -1, 0 и 1 DPI заражения SFTSV. Сыворотку и селезенку собирали у мышей, зараженных при 5 DPI, и подвергали определению инфекционных титров SFTSV и количества копий РНК SFTSV.Тенденция к потере массы тела, по-видимому, улучшилась только в группе мышей m8-N+GPC, которым вводили сыворотку, по сравнению с мышами m8-EGFP, которым вводили сыворотку (рис. 9A–9D). Хотя изменение массы тела, по-видимому, улучшилось у мышей, получавших сыворотку у мышей m8-GPC, и у мышей, инокулированных m8-N, у мышей, которым вводили сыворотку, при 5 DPI, статистически значимое улучшение было достигнуто только у мышей m8-N+GPC. мыши, которым вводили сыворотку, по сравнению с контрольными мышами, которым вводили сыворотку m8-EGFP-мышей (фиг. 9E).Инфекционные титры SFTSV в сыворотке были значительно ниже у мышей m8-N+GPC-мышам, которым вводили сыворотку, и у мышей m8-GPC-мышей, которым вводили сыворотку, чем у контрольных мышей, которым вводили сыворотку m8-EGFP-мышей. (Рис. 9F). Интересно, что титр SFTSV в сыворотке мышей m8-N-мышей, которым вводили сыворотку, был в 1,66 log10 раз ниже, чем у мышей m8-EGFP-мышей, которым вводили сыворотку, хотя разница не была статистически значимой. В общем, уровни вирусной РНК, измеренные с помощью количественной ОТ-ПЦР, не отражают уровни инфекционного вируса.Четыре из пяти мышей m8-N+GPC, которым вводили сыворотку, не содержали обнаруживаемых количеств РНК SFTSV, и уровни были значительно ниже, чем у мышей m8-EGFP, которым вводили сыворотку (рис. 9G). Уровни вирусной РНК в сыворотке, собранной у мышей, которым вводили сыворотку m8-GPC-мышей, были примерно в 2,0 log10 раз ниже, чем у m8-EGFP, хотя разница не была статистически значимой. Кроме того, уровни РНК SFTSV в селезенке мышей m8-N+GPC, которым вводили сыворотку, были равны 3. в 37 log10 раз ниже, чем у мышей m8-EGFP с инокулированной сывороткой. Однако разница также не была статистически значимой (фиг. 9H). Эти результаты показали, что передача как гуморального иммунитета против SFTSV GP, так и N одновременно способствовала — в определенной степени — приданию защитного иммунитета против SFTSV.

    Рис. 8. Изменение веса у мышей, которым пассивно вводили сыворотку, полученную от мышей, инокулированных каждой вакциной SFTSV на основе m8.

    Мышей IFNAR-/- пассивно переносили 100 мкл сыворотки, полученной от мышей, инокулированных m8-EGFP (A), m8-N (B), m8-GPC (C) или m8-N+GPC (D) в 1 за день до и непосредственно перед подкожным введением SFTSV YG-1 в дозе 1 × 10 3 TCID 50 .В качестве положительного контроля группе интактных мышей вводили сыворотку, полученную от мышей через 3 недели после заражения 10 TCID 50 SFTSV YG-1 (E). Процентное изменение веса каждой особи в группах от исходного веса измеряли ежедневно в течение 2 недель. Количество мышей, используемых в группе, указано как «n» в легенде. Звездочка указывает конечную точку отдельных лиц.

    https://doi.org/10.1371/journal.ppat.1008859.g008

    Рис. 9.Последовательные изменения массы тела и вирусной нагрузки у мышей, которым пассивно вводили сыворотку, полученную от мышей, инокулированных каждой вакциной SFTSV на основе m8.

    Мышей IFNAR-/- (по пять на группу) пассивно переносили 400 мкл объединенной сыворотки, полученной от мышей, инокулированных m8-EGFP (A), m8-N (B), m8-GPC (C) или m8- N+GPC (D) при -1, 0 и 1 DPI подкожного заражения SFTSV при 1 × 10 3 TCID 50 . Процентное изменение веса каждого индивидуума в каждой группе от исходного веса измеряли ежедневно до 5 DPI.Процентное изменение веса по сравнению с начальным при 5 DPI было нанесено на график (E). Инфекционные титры SFTSV в сыворотке измеряли с помощью стандартного анализа TCID 50 (F). Копии РНК SFTSV определяли с помощью количественной ПЦР в сыворотке (G) и в селезенке (H). Значения показаны после нормализации на основе 1 × 10 7 копий генома β-актина мыши при 5 DPI. Средние значения в каждой группе мышей показаны вверху каждого графика (F-H). Когда титры вируса и количество копий РНК вируса SFTSV были ниже предела обнаружения, титры инфекционного вируса и количество копий вирусной РНК определяли как предел обнаружения (32 TCID 50 на мл для титров инфекционного вируса, 125 копий на мл). мл сыворотки и 10 копий на 1 × 10 7 копий мышиного β-актина в селезенке для количества копий вирусной РНК).Критерий Крускала-Уоллиса с критерием множественного сравнения Данна использовали для определения уровня статистической значимости. Вычисленные p-значения показаны над сравниваемыми группами. ЕД, ниже предела обнаружения, который составляет 32 TCID 50 на мл, 125 копий на мл сыворотки, или 10 копий на 1×10 7 копий мышиного β-актина в селезенке.

    https://doi.org/10.1371/journal.ppat.1008859. g009

    Вклад CD8-позитивных клеток в борьбу с инфекциями SFTSV

    Эффективность mAb против CD8 для уничтожения CD8-позитивных клеток in vivo сначала была подтверждена с использованием мышей, не получавших IFNAR-/-.Популяция CD8-отрицательных:положительных клеток в спленоцитах, собранных через 1 и 3 дня после инокуляции моноклональных антител к CD8, составляла 96,1:3,9 и 99,2:0,8 соответственно, когда 250 мкг крысиного моноклонального антитела против мышиного CD8 клона 2.43 вводили внутрибрюшинно у каждой мыши, тогда как популяция контрольных мышей, инокулированных контрольным mAb, составляла 36,1:63,9 через 1 день после инокуляции (фиг. 10А). Этот результат указывает на то, что CD8-позитивные клетки истощались не полностью, но эффективно. Затем CD8-положительные клетки были истощены in vivo во время заражения SFTSV, что было выполнено для проверки вклада CD8-положительных клеток, которые, как известно, играют значительную роль в клеточном иммунитете. Истощение CD8-позитивных клеток во время заражения SFTSV не изменило уровень выживаемости у мышей, привитых любой из вакцин SFTSV на основе m8, или у мышей, привитых контрольным m8-EGFP (рис. 10B–10E). Кроме того, не было заметной разницы в последовательном изменении массы тела в группах, получавших анти-CD8 и контрольное mAb (фиг. 11). Эти результаты свидетельствуют о том, что CD8-позитивные клетки не вносят вклада в формирование защитного клеточного иммунитета против SFTSV.

    Рис. 10.Выживание у мышей, инокулированных геном m8-SFTSV, с истощением CD8-положительных клеток после летального заражения SFTSV. (А). Ворота (R1), которые разделяли популяцию CD8-позитивных и негативных клеток, регулировали с помощью гистограммы спленоцитов через 1 день после контрольной инокуляции mAb (гистограмма Грея), и соотношение CD8-негативных и позитивных клеток составляло 36,1:63,9. На основе гейта соотношение CD8-отрицательных:положительных клеток в спленоцитах через 1 день (синяя гистограмма) и 3 дня (красная гистограмма) после инокуляции mAb против CD8 составляло 96. 1:3,9 и 99,2:0,8 соответственно. Затем мышам IFNAR-/- дважды с интервалом в 2 недели подкожно вводили вакцину SFTSV на основе m8 в дозе 1 × 10 6 БОЕ. Через две недели после второй инокуляции мышей m8-N+GPC (A), m8-GPC (B), m8-N (C) или m8-EGFP (D) мышей заражали 1 × 10 3 (синий кружок) или 1 × 10 5 (красный квадрат) TCID 50 SFTSV YG-1 и инокулировали mAb против CD8 (сплошная линия с закрашенным символом) для истощения CD8-позитивных клеток или контроля (пунктирная линия с открытым символом) mAb на -1, 2, 5 и 8 DPI до и после заражения SFTSV.Выживаемость оценивали ежедневно в течение 2 недель. Количество мышей в группе указано как «n» в легенде.

    https://doi.org/10.1371/journal.ppat.1008859.g010

    Рис. 11. Изменение веса мышей с инокулированным геном m8-SFTSV после летального заражения SFTSV с истощением CD8-положительных клеток.

    График инокуляции и пояснения к рисункам представлены на рис. 10. Процентное изменение веса по сравнению с начальным весом измеряли ежедневно в течение 2 недель.

    https://дои.org/10.1371/journal.ppat.1008859.g011

    Обсуждение

    Срочно нужна вакцина SFTS. Одной из стратегий разработки безопасных и эффективных вакцин является использование рекомбинантных вакцинных векторов. VAC использовался в качестве рекомбинантного вакцинного вектора для многих типов инфекционных заболеваний, включая высокопатогенные инфекционные заболевания [18]. В частности, сообщалось, что рекомбинантные вакцины на основе MVA против ККГЛ и болезни, вызванной вирусом Эбола, эффективны на животных моделях [27–29]. Поскольку существует много общего между CCHF и SFTS (например,g., Bunyavirales порядка , клещевые инфекционные заболевания, вирусная геморрагическая лихорадка и другие клинические проявления) [30, 31], мы предположили, что рекомбинантная вакцина на основе m8 может быть эффективной при SFTS.

    Интересно, что это исследование показало, что как m8-N, так и m8-GPC обеспечивают защиту от летального заражения SFTSV у мышей, хотя m8-N оказался менее эффективным, чем m8-GPC. Принимая во внимание, что вирус ККГЛ (CCHFV), экспрессирующий GPC MVA, но не вирус ККГЛ (CCHFV), экспрессирующий MVA, обеспечивает защиту от летального заражения ККГЛВ [27, 28].Предполагается, что активный приобретенный иммунитет, вызванный SFTSV N и CCHFV N, представляет собой преимущественно клеточный иммунитет, поскольку специфическое антитело не может получить доступ к N в вирионе. Следовательно, клеточный иммунитет против инфекции SFTSV может играть более важную роль, чем иммунитет против инфекции CCHFV.

    Экспрессия гена GPC в клетках, инфицированных вирусом Уукуниеми и вирусом лихорадки долины Рифт у Phenuiviridae , необходима и достаточна для формирования ВПЧ [32–34].Поскольку ВПЧ представляют антигены в целом плотно и многократно, ВПЧ выгодны для использования в вакцинах, поскольку они эффективно поглощаются и процессируются антигенпрезентирующими клетками, а также активируют В-клетки посредством физического перекрестного связывания рецепторов В-клеток [35, 36]. В этом исследовании было подтверждено, что VLP SFTSV продуцируется в клетках in vitro при инфицировании m8-GPC или m8-N+GPC. Что касается живых рекомбинантных вакцин SFTSV, m8-GPC и m8-N+GPC обладают преимуществом продукции VLP, которая может происходить не только in vitro , но также in vivo , вызывая сильный клеточный и гуморальный ответ.Хотя иммуногенность (с точки зрения гуморального иммунитета) у мышей, индуцированных аутентичной инфекцией SFTSV, была несколько выше, чем у мышей, индуцированных рекомбинантными вакцинами SFTSV на основе m8 (рис. 3), иммунный ответ, индуцированный вакцинацией m8-GPC или m8-N +GPC полностью защищен от летальной инфекции SFTSV (рис. 4). Этот результат предполагает, что механизм, с помощью которого m8-N+GPC индуцирует защитный иммунитет к инфекции SFTSV, имитирует механизм подлинной инфекции SFTSV.

    Основная целевая группа населения для вакцинации SFTS — люди старше 50 лет, поскольку возраст является критическим фактором риска тяжелого и летального течения SFTS [4, 37–39]. К 1980 г. все страны прекратили обычную программу вакцинации детей против оспы. Например, плановая программа вакцинации против оспы была прекращена в Японии в 1976 г. фактор, который может повлиять на способность вакцин на основе m8 индуцировать защиту от SFTSV. Это исследование продемонстрировало значительную эффективность вакцин m8-GPC и m8-N+GPC у мышей, предварительно вакцинированных VAC, даже несмотря на то, что между прививкой вакциной VAC (Lister) и прививкой вакцины SFTSV на основе m8 был всего один месяц. (рис. 5).За более чем 40 лет с тех пор, как люди, получившие вакцину против оспы, получили последнюю прививку, не было эпидемий ортопоксвируса. Таким образом, весьма вероятно, что вакцины SFTSV на основе m8 будут по-прежнему эффективны для лиц, ранее получавших вакцину против оспы.

    В общем, рекомбинантный VAC вызывает как гуморальный (т. е. антитела), так и клеточный иммунитет (т. е. цитотоксические Т-лимфоциты) против антигена-мишени [27, 28]. Ключевыми игроками в гуморальном и клеточном иммунитете являются антитела и цитотоксические CD8-положительные Т-лимфоциты. В экспериментах с пассивным переносом сыворотки антитела, индуцированные m8-N+GPC и m8-GPC, значительно снижали уровень инфекционного SFTSV in vivo (фиг. 9F). Тем не менее, уровень эффективности был разным (рис. 9). Титры антител ИФА к SFTSV GPC и титры антител к 50% NT в объединенных сыворотках мышей, инокулированных m8-N+GPC, были выше, чем у мышей, инокулированных m8-GPC, но разница была небольшой (табл. 4). Очевидное различие заключалось в способности индуцировать специфические антитела против SFTSV N между m8-N+GPC и m8-GPC.В настоящем исследовании m8-N не индуцировал антитела NT к SFTSV in vitro . Однако перенос объединенной сыворотки, собранной у мышей, инокулированных m8-N, снизил титры SFTSV в десять раз больше, чем сыворотки, собранные у мышей, инокулированных m8-EGFP in vivo , хотя разница между двумя группами не была статистически значимой. Сообщалось об аналогичном результате, а именно о том, что мыши были защищены от заражения вирусом гриппа, а вирус гриппа был значительно удален из легких путем внутрибрюшинного введения мышам нуклеопротеин-иммунной сыворотки вируса гриппа [40]. Кроме того, защита индуцировалась зависимым от FcγR и CD8 T-клетками образом. Исходя из результатов, авторы предположили, что FcγR-зависимая активация дендритных клеток иммунными комплексами, образованными с анти-NP-антителами, может усиливать вирусную антигенпрезентирующую активность в отношении Т-клеток CD8. Хотя необходимы дальнейшие исследования, очевидно, что антитела против N могут обладать способностью снижать способность к репликации SFTSV in vivo по неизвестному механизму. Кроме того, иммунный ответ против SFTSV N может действовать аддитивно или синергически с ответом против GPC.С другой стороны, CD8-положительные клетки, специфичные для гена SFTSV, индуцированные вакцинами против SFTSV на основе m8, были незаменимы для защиты от заражения SFTSV. Вполне возможно, что CD8-положительные клетки были эффективны, но не могли полностью истощаться. Необходимы дальнейшие исследования для выяснения роли клеточного иммунитета в защите субъектов, включая людей, от инфекции SFTSV.

    Интересно, что ранее сообщалось, что истощение in vivo CD8-позитивных Т-лимфоцитов у крыс, иммунизированных рекомбинантным VAC, экспрессирующим гены кори, не изменяло защитный эффект против заражения вирусом кори [41, 42].Хотя авторы не тестировали истощение in vivo CD4-положительных клеток, они предположили, что CD4-положительный Т-клеточный опосредованный иммунный ответ, специфичный для продуктов гена кори, достаточен для контроля инфекции вируса кори. Следует изучить вклад CD4-позитивных Т-клеток у мышей, привитых каждой из вакцин против SFTSV на основе m8 во время заражения SFTSV.

    Таким образом, был создан новый рекомбинантный m8, который экспрессирует SFTSV N, GPC или и N, и GPC.m8-GPC-инфекция и m8-N+GPC-инфекция клеток индуцировали продукцию SFTSV-подобных частиц. В дополнение к m8-GPC и m8-N+GPC было подтверждено, что m8-N обеспечивает защитную эффективность против летальной инфекции SFTSV у мышей. Мы пришли к выводу, что вакцины SFTSV на основе m8 являются многообещающими кандидатами для SFTS.

    Материалы и методы

    Заявление об этике

    Все эксперименты, связанные с животными, проводились в лабораториях с уровнем биологической безопасности животных 2 или 3 в Национальном институте инфекционных заболеваний Японии (NIID) в соответствии со строгими правилами проведения экспериментов на животных NIID.Протокол был одобрен Институциональным комитетом по уходу и использованию животных NIID (№ 117059, 117130, 117131, 118127, 118129 и 118173).

    Клетки и вирусы

    Клетки

    293FT (Thermo Fisher Scientific, Waltham, MA), клетки Vero и клетки RK13 выращивали в среде Игла, модифицированной Дульбекко (DMEM; Вако, Осака, Япония), с добавлением 5% термоинактивированной фетальной бычьей сыворотки (FBS) и антибиотики (Sigma-Aldrich Japan, Токио). Штамм VAC Lister, который является прародительским штаммом m8 (инвентарный номерAY678276) [43], m8 (инвентарный номер AY678275) и рекомбинантный m8, экспрессирующий усиленный зеленый флуоресцентный белок (m8-EGFP), полученный ранее [44], размножали в клетках RK13. Инфекционный титр в клетках RK13 определяли с помощью стандартного анализа бляшкообразующих единиц (БОЕ) [43]. Штаммы SFTSV YG-1 (регистрационные № AB817979, AB817987, AB817995), SPL005 (AB817982, AB817990, AB817998) и SPL010 (AB817983, AB817991, AB817999) размножали в клетках Vero. Инфекционную дозу SFTSV штамма YG-1 в клетках Vero определяли с помощью анализа инфекционной дозы 50% стандартной культуры ткани (TCID 50 ) с визуализацией инфекции в лунках 96-луночного планшета с помощью IFA, как описано ранее [14], потому что CPE не был очевиден для визуализации как характеристика инфекции SFTSV in vitro .Вкратце, клетки, инфицированные SFTSV, реагировали с поликлональным антителом кролика против SFTSV N собственного производства, затем окрашивали конъюгированным с Alexa Fluor 488 козьим антителом против кроличьего IgG H+L (Thermo Fisher Scientific).

    Плазмиды

    Открытые рамки считывания (ORF) N и GPC штамма SFTSV SPL005 амплифицировали с использованием РНК, очищенной из клеток, инфицированных SFTSV, с помощью двухэтапной традиционной RT-PCR. Эти ORF, содержащие синтетический ранний/поздний промотор VAC [45], были также клонированы в сайт NotI (N) или XhoI (GPC) precB5R, плазмиды для создания рекомбинантных m8s путем гомологичной рекомбинации [44].Плазмиды, вставленные с генами N и GPC, были названы precB5R-N и precB5R-GPC соответственно. ORF N с ранним/поздним промотором осповакцины встраивали в сайт NotI precB5R-GPC для конструирования плазмиды, названной precB5R-N+GPC, которая содержала обе ORF: N и GPC. Экспрессионную плазмиду млекопитающих pHEK293 Ultra Expression Vector II (Takara Bio Inc., Shiga, Japan) также встраивали с ORF N или GPC в сайт BamHI сайтов множественного клонирования. Плазмиды со вставкой N и GPC были названы pHEK293-N и -GPC соответственно.Плазмиду для экспрессии белка N встраивали с геном N с меткой FLAG на С-конце гена.

    Создание рекомбинантного m8, содержащего гены SFTSV

    Рекомбинантные m8, m8-N, m8-GPC и m8-N+GPC со вставкой только гена N, только гена GPC и обоих генов N и GPC соответственно во фланкирующей области между B4R и B6R гены были созданы методом гомологичной рекомбинации для вставки чужеродного гена, как описано ранее [44]. Вкратце, клетки 293FT трансфицировали каждой из следующих плазмид: precB5R-N, precB5R-GPC и precB5R-N+GPC с использованием X-tremeGENE 9 (Roche Diagnostics K.K., Токио, Япония). Клетки, трансфицированные каждой плазмидой, затем инфицировали m8 при множественности заражения (MOI) 0,05 на клетку. Клетки культивировали в среде DMEM с добавлением 5% FBS в течение 3 дней. Затем культуральную среду вместе с клетками собирали и трижды замораживали-оттаивали для получения сырых промежуточных рекомбинантных маточных растворов m8.Монослои клеток RK13 инокулировали каждым из сырых промежуточных рекомбинантных исходных материалов m8. Затем инокулированный раствор удаляли и на клетки наносили минимальную эссенциальную среду Игла (EMEM, Wako), содержащую 2% FBS, 20 мкг/мл микофеноловой кислоты (MPA, Sigma-Aldrich), 250 мкг/мл ксантина, 15 мкг/мл гипоксантина и 1% ME агарозы (Iwai Chemicals, Токио, Япония). Через три дня флуоресцентно-положительные бляшки mCherry идентифицировали либо с помощью флуоресцентной микроскопии, либо с помощью светодиодного трансиллюминатора (GELmieru, WAKO) при длине волны 500 нм. Одну флуоресцентно-положительную бляшку в агарозной пробке собирали и смешивали с DMEM, дополненной 5% FBS, для приготовления запасов промежуточных рекомбинантных клонов m8. Клетки RK13 в монослое в 96-луночном планшете инокулировали промежуточными клонами для подтверждения экспрессионной способности SFTSV N и/или GPC с использованием IFA. Инокулированные клетки фиксировали смесью метанол:ацетон 1:1 при двух DPI. Затем клетки реагировали либо с кроличьим поликлональным антителом против SFTSV N собственного производства, либо с клоном C6C1 mAb мыши против SFTSV Gc собственного производства с последующей реакцией с конъюгированным с DyLight 594 козьим антикроличьим IgG H+L. антитело (Abcam, Кембридж, Великобритания) и козье антимышиное антитело IgG H+L, конъюгированное с DyLight 488 (Abcam), соответственно.Затем флуоресцентно-положительные экспрессионные клоны дополнительно очищали выделением бляшек не менее трех раз. Клетки RK13 инфицировали очищенными промежуточными клонами без добавления МФК, ксантина и гипоксантина с получением неочищенных конечных рекомбинантных запасов m8. Конечные рекомбинантные вакцины SFTSV на основе m8, из которых маркерные гены селекции были самовырезаны, что привело к их делеции, клонировали путем отбора флуоресцентно-негативных бляшек. Таким образом, однослойные клетки RK13 инфицировали одним из последних сырых рекомбинантных растворов m8, и клетки покрывали агарозой, содержащей МЕМ с добавлением 2% FBS без добавления МФК, ксантина и гипоксантина.Через три дня флуоресцентно-негативные бляшки mCherry собирали под светодиодным трансиллюминатором. Положительные по экспрессии N и/или GPC и отрицательные по флуоресценции mCherry клоны затем очищали путем выделения бляшек по меньшей мере три раза для получения конечных рекомбинантов. Экспрессию генов SFTSV в клетках, инфицированных каждым конечным рекомбинантным вирусом, подтверждали с помощью ИФА. Вкратце, клетки на планшете для тканевых культур инфицировали m8-N, m8-GPC, m8-N+GPC или m8-EGFP, а затем клетки фиксировали смесью метанол:ацетон 1:1, которая гасила инфекцию. Флуоресценция EGFP при 3 DPI. Поскольку вирус коровьей оспы распространяется путем передачи от клетки к клетке, бляшки образовывались без наложения среды (например, агарозы или метилцеллюлозы) для предотвращения движения жидкости в культуре. Клетки реагировали со смесью кроличьего N поликлонального антитела против SFTSV N собственного производства и собственного мышиного mAb против SFTSV Gc с последующей реакцией со смесью козьего антикроличьего IgG, конъюгированного с DyLight 594. Антитело H+L (Abcam) и козье антитело против мышиного IgG H+L, конъюгированное с DyLight 488 (Abcam). m8-N, m8-GPC, m8-N+GPC и m8-EGFP размножали в клетках RK13, и их инфекционные дозы определяли с помощью стандартного анализа бляшек.

    Подтверждение SFTS вирусоподобных частиц (VLP)

    клеток RK13 инфицировали m8-GPC или m8-N+GPC при MOI 0,1. Супернатант культуры собирали при 3 DPI и смешивали с полиэтиленгликолем (PEG) 6000 в конечной концентрации 8 вес./об.% для осаждения VLP, и смесь инкубировали при 4°C в течение ночи. Осадки ПЭГ осаждали центрифугированием в течение 30 мин при 1500×g при 4°С в поворотном роторе. Осадки ресуспендировали в DMEM с добавлением 5% FBS.VLP очищали с помощью двойной подушки из 20% и 60% сахарозы в H 2 O в поворотном роторе SW-41 путем ультрацентрифугирования (Beckman Coulter, Бреа, Калифорния) в течение 2 часов при 25000 об/мин при 4°С. C в поворотно-откидном роторе. Накопленные VLP, которые были разделены на границе раздела 20/60%, отрицательно окрашивались 2% фосфорно-вольфрамовой кислотой, а затем наблюдались с использованием просвечивающего электронного микроскопа JEM-1400 (JEOL, Токио, Япония).

    Иммунопреципитация

    Включение SFTSV N, Gn или Gc в VLP было подтверждено иммунопреципитацией.Вкратце, клетки RK13 инфицировали m8-EGFP, m8-N, m8-GPC или m8-N+GPC при MOI 0,05. Супернатанты культуры собирали для оценки включения N и GP в VLP при 2 DPI и 3 DPI соответственно. Оставшиеся клетки лизировали буфером для образцов с додецилсульфатом натрия (SDS) и нагревали при 95°C в течение 5 минут. Один миллилитр каждого супернатанта инкубировали с 15 мкл магнитных шариков козьего антимышиного IgG (New England Biolabs, Ипсвич, Массачусетс) при вращении в течение ночи при 4 o °C после добавления 3 мкг мышиного анти-SFTSV Gc mAb. (клон C6C1) или нет.Магнитные шарики в супернатанте собирали на магнитной подставке и дважды промывали PBS. Двадцать микролитров буфера для образца SDS добавляли к гранулам и нагревали при 95°C в течение 5 минут. Лизаты инфицированных клеток и иммунопреципитированные образцы фракционировали с помощью электрофореза в полиакриламидном геле с ДСН (ДСН-ПААГ) и подвергали вестерн-блоттингу. Мембрану реагировали с кроличьим поликлональным антителом против SFTSV N, кроличьим антителом против SFTSV Gn (номер NBP2-41153, Novus biols), кроличьим антителом против SFTSV Gc (номер NBP2-41156, Novus biols, Centennial, CO) или кроличьим антителом. поликлональное антитело против GAPDH (номер 10494-1-AP, Proteintech, Rosemont, IL) с последующей реакцией с конъюгированным с пероксидазой хрена (HRP) козьим антителом против кроличьего IgG (H+L) (KPL, Gaithersburg, MD). Иммунореактивные белки визуализировали с помощью LAS-4000mini (Fujifilm, Токио, Япония) с реагентами для детекции ECL Prime Western (GE Healthcare, Чикаго, Иллинойс). Плотность белков N или GP на вестерн-блотах измеряли с помощью ImageJ Fiji 1.53c [46].

    Животные

    мышей IFNAR-/- на фоне C57BL/6 использовали для всех экспериментов на животных. Мышей IFNAR-/- ранее получали путем скрещивания мышей с двойным нокаутом ДНКазы II/интерферонового рецептора I типа (штамм B6.129-Dnase2a Ifnar1) [47–49] и мышей C57BL/6 (возраст 4–10 недель, пол, самец или самка), выведенных в специфических свободных от патогенов (SPF) условиях в NIID [47–49]. 50].

    Оценка эффективности вакцины у VAC-иммунонегативных мышей

    Мышам дважды с двухнедельным интервалом подкожно вводили 1 × 10 6 БОЕ m8-EGFP, m8-N, m8-GPC или m8-N+GPC в объеме 100 мкл на мышь под наркозом с комбинацией мидазолама, медетомидина и буторфанола тартрата.Через две недели после второй инокуляции мышей подвергали эвтаназии изофлураном и умерщвляли для сбора крови для оценки иммуногенности или подкожно вводили 1 × 10 3 или 1 × 10 5 TCID 50 штамма SFTSV YG-1 в объем 100 мкл на мышь под анестезией комбинацией мидазолама, медетомидина и буторфанола тартрата для оценки защитной эффективности каждого кандидата на вакцину SFTSV на основе m8. Массу тела и клинические признаки мышей, инфицированных SFTSV, контролировали ежедневно в течение двух недель.В экспериментах с заражением SFTSV мышей подвергали эвтаназии с помощью изофлурана, когда мыши умирали или ожидали смерти из-за трудностей с едой и/или питьем.

    Оценка эффективности вакцины у VAC-иммунопозитивных мышей

    Четырех-пятинедельным мышам IFNAR-/- (по 10 в группе) подкожно инокулировали 1 × 10 6 БОЕ штамма VAC Lister, штамма противооспенной вакцины второго поколения, в объеме 100 мкл. на мышь за 4 недели до первой инокуляции вакциной SFTSV на основе m8.Предварительно привитым VAC мышам затем подкожно дважды с двухнедельным интервалом вводили каждую вакцину SFTSV на основе m8 с последующим подкожным заражением 1 × 10 3 или 1 × 10 5 TCID 50 SFTSV YG- 1, как описано выше. Массу тела и клинические признаки мышей, инфицированных SFTSV, контролировали ежедневно в течение двух недель.

    Валидация эффективности mAb против CD8 при истощении CD8-позитивных клеток

    in vivo

    мышам, не подвергавшимся лечению, внутрибрюшинно инокулировали 250 мкг крысиного анти-CD8 mAb клона 2. 43 (BioXCell, Западный Ливан, Нью-Гэмпшир) для истощения CD8-позитивных клеток in vivo , как описано ранее [51]. Клон LTF-2 mAb крысы против гемоцианина лимфы лимфы (BioXCell) также использовали в качестве контрольного антитела. Селезенку собирали через 1 или 3 дня после введения антитела. Клетки селезенки ресуспендировали в PBS с 2% фетальной телячьей сывороткой (FCS) и окрашивали конъюгированным с FITC mAb против CD8a (клон 53–6.7, Thermo Fisher Scientific). Данные проточной цитометрии были получены на проточных цитометрах Guava easyCyte Flow Cytometer (Luminex, Austin, TX).

    Оценка эффективности переноса антител против SFTSV и клеточного иммунитета у мышей

    Следующий эксперимент был разработан для оценки гуморального иммунитета, вызванного вакцинацией вакцинами SFTSV на основе m8. Сыворотку собирали у мышей, дважды подкожно инокулированных 1 × 10 6 БОЕ m8-EGFP, m8-N, m8-GPC или m8-N+GPC с двухнедельным интервалом, как описано выше. Наивных мышей дважды пассивно переносили по 100 мкл сыворотки в 1 день (-1 DPI) и непосредственно перед (0 DPI) подкожным заражением SFTSV в дозе 1 × 10 3 TCID 50 . В другом эксперименте наивным мышам трижды пассивно переносили 400 мкл объединенной смеси сывороток, собранных из каждой группы мышей, инокулированных 1 × 10 6 БОЕ m8-EGFP, m8-N, m8-GPC или m8-N+. GPC при -1, 0 и 1 DPI подкожного заражения SFTSV при 1 × 10 3 TCID 50 . Для оценки клеточного иммунитета, индуцированного вакцинами SFTSV на основе m8, CD8-положительные клетки были истощены in vivo введением mAb против CD8. Мышам IFNAR-/- в возрасте от 6 до 9 недель (от 4 до 5 в группе) дважды подкожно инокулировали 1 × 10 6 БОЕ m8-EGFP, m8-N, m8-GPC или m8-N. +GPC с интервалом в 2 недели, как описано выше.Две недели спустя мышам подкожно вводили 1×10 3 или 1×10 5 TCID 50 SFTSV YG-1 и внутрибрюшинно инокулировали 250 мкг mAb против CD8 клона 2.43 или Rat anti- Клон LTF-2 mAb гемоцианина лимфы улитки в качестве контроля на -1, 2, 5 и 8 DPI после заражения SFTSV. Массу тела и клинические признаки мышей, инфицированных SFTSV, контролировали ежедневно в течение двух недель.

    Непрямой иммунофлуоресцентный анализ

    предметных стекол с пятнами антигена IFA, клетки 293FT трансфицировали либо pHEK293-N, либо pHEK293-GPC с плазмидой, усиливающей экспрессию, pHEK293 (Takara Bio Inc.). Смесь клеток 293FT, трансфицированных векторами экспрессии в комбинации, и нетрансфицированных клеток 293FT в соотношении 1:3 промывали PBS, наносили на предметные стекла (Matsunami Glass IND., Ltd., Осака, Япония), фиксировали в сухом виде, и обработан ацетоном. Для определения титра SFTSV N- или GPC-специфических IgG у мышей образцы сыворотки, иммобилизованные при 56°C в течение 30 мин, серийно разбавляли в два раза и добавляли к антигенам на предметных стеклах. Затем антигены реагировали с конъюгированным с Alexa Fluor 488 козьим антимышиным антителом IgG H+L (Thermo Fisher Scientific).Титр антител определяли как величину, обратную самому высокому уровню разведения, при котором обнаруживался специфический флуоресцентный сигнал.

    Тест нейтрализации уменьшения фокуса

    Для определения титра нейтрализующих антител к SFTSV в сыворотке мыши аликвоты 100 TCID 50 SFTSV смешивали с 4-кратными серийно разведенными иммобилизованными сыворотками и инкубировали в течение 1 часа. Сливающиеся культуры клеток Vero в 12-луночных планшетах для микротитрования инокулировали каждой смесью вируса и сыворотки в течение 1 часа, покрывали DMEM, содержащей 2% FBS и 1% метилцеллюлозу, а затем культивировали в течение 4-5 дней.Клетки фиксировали PBS, содержащим 10% формалина, и реагировали с кроличьим поликлональным антителом против SFTSV N. Очаги инфекции SFTSV затем визуализировали с помощью стандартного иммунопероксидазного метода. Процентный титр антител против NT определяли путем деления количества очагов в лунке, инокулированной вирусом и сывороткой мыши, инокулированной геном m8-SFTSV, или мыши, инокулированной SFTSV, на количество очагов у интактных мышей. Титр 50% NT-антител определяли как величину, обратную степени разведения сыворотки, приводящую к уменьшению очагов на 50%.

    Количественная одностадийная ОТ-ПЦР

    Специфическая количественная одноэтапная ПЦР с обратной транскрипцией (qPCR) была проведена для измерения числа копий РНК SFTSV, как сообщалось ранее [52]. Специфические наборы праймеров и зондов для количественной ПЦР, направленные на S-сегмент генома SFTSV (прямой; TGTCAGTGGTCCAGGATT, обратный; ACCTGTCTCCTTCAGCTCTCT, зонд; FAM-TGGAGTTTGGTGAGCAGCAGC-BHQ1) и мышиный β-актин (прямой; TGCTGACAGGATGCAGAAGG, обратный; ACTCCTGCTTGCTGATCCAC, зонд; FAM-TCGGTGGCTCC) BHQ1).Суммарные РНК экстрагировали из 200 мкл сыворотки или селезенки мышей с использованием набора High Pure вирусной РНК (Roche Applied Science) или набора ISOGEN со спин-колонкой (NIPPON GENE, Токио, Япония) соответственно в соответствии с протоколами производителя. Объем элюции для выделения РНК составлял 50 мкл. Для количественной ПЦР аликвоту экстрагированного раствора РНК добавляли к реакционной смеси для набора QuantiTect probe RT-PCR (Qiagen, Hilden, Germany), который содержал 2x QuantiTect probe RT-PCR master mix, смесь QuantiTect RT, h3O , и смесь 10x праймер-зонд, которая содержала 4 мкМ каждого конкретного праймера, 2 мкМ зонда (зондов) TaqMan и 2 мкМ зонда контампликона. Реакцию обратной транскрипции проводили при 50°С в течение 30 мин с последующим 45 циклами амплификации в следующих условиях: 94°С в течение 15 с и 60°С в течение 60 с после активации ПЦР при 95°С в течение 15 мин в LightCycler 96 (Roche).

    Гистопатология и иммуногистохимия

    Как описано выше, мышам IFNAR-/- подкожно вводили 1 × 10 6 БОЕ вакцины m8-EGFP или каждой вакцины SFTSV на основе m8 дважды с интервалом в 2 недели и внутрибрюшинно вводили 1 × 10 5 TCID 50 СФЦВ ЮГ-1, через 2 недели после второй прививки.Мышей, инфицированных SFTSV, подвергали эвтаназии с помощью изофлюрана и умерщвляли через 1, 3 и 5 DPI, после чего собирали кровь, шейные лимфатические узлы, селезенку, печень и почки. Ткани фиксировали PBS, содержащим 10% формалина, и заливали парафином для приготовления блоков. Из блока ткани готовили срезы и окрашивали гематоксилин-эозином для гистопатологического исследования. Иммуногистохимический анализ для выявления белка SFTSV N проводили, как описано ранее [14]. Сначала срезы реагировали с кроличьим поликлональным антителом против SFTSV N.Антигены выделяли гидролитическим автоклавированием в цитратном буфере (рН 6,0) в течение 10 мин при 121°С. Затем проводили окрашивание ИГХ с использованием стандартного метода иммунопероксидазы.

    Статистический анализ

    Все статистические анализы были выполнены с использованием GraphPad Prism 7 (GraphPad Software, La Jolla, CA). Кривые выживания были построены в соответствии с анализом Каплана-Мейера, а защитная эффективность вакцин SFTSV на основе m8 против заражения SFTSV у мышей оценивалась с использованием критерия логарифмического ранга с поправкой Бонферрони для корректировки уровня значимости для множественных сравнений.Равенство медианы 50% титров NT-антител в сыворотке мышей, медианы плотности N-белка на вестерн-блоттинге, изменения массы тела, титров SFTSV в сыворотке и копий РНК SFTSV в сыворотке и селезенке оценивали с помощью теста Краскала. Критерий Уоллиса с критерием множественного сравнения Данна.

    Оставить комментарий

    Ваш адрес email не будет опубликован.